Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 37
Filtrar
1.
Animals (Basel) ; 14(17)2024 Aug 31.
Artículo en Inglés | MEDLINE | ID: mdl-39272318

RESUMEN

Rapid urbanization and its associated human activities have facilitated the colonization and spread of non-native species, rendering urban ecosystems, particularly in megacities such as Beijing, highly susceptible to biological invasions. This study employed environmental DNA (eDNA) metabarcoding to evaluate the biodiversity and geographical distribution of non-native fish, as well as their interactions with native fish species, across three river basins in Beijing pertaining to the Daqing River, the North Canal, and the Ji Canal. Across all the 67 sampling sites, we identified 60 fish taxa, representing 11 orders, 23 families, and 40 genera, with an average of 33.0 taxa per site. Of these, 40 taxa were native, accounting for only 47.1% of the historically recorded native fish species. Additionally, we detected 20 non-native fish taxa, spanning 11 orders, 13 families, and 17 genera. Native fish exhibited geographical homogenization across the basins, while non-native taxa displayed varied geographical distributions. Non-metric multidimensional scaling (NMDS) and analysis of similarities (ANOSIM) revealed no significant variation in the non-native communities across the river basins. Although most of the non-native taxa were widespread, some were restricted to specific sites or basins. The North Canal exhibited significantly lower non-native biodiversity compared with the Ji Canal across all alpha diversity indices. Simple linear regression analyses indicated positive correlations between the number of taxa and species richness for both native and non-native taxa. Interestingly, species co-occurrence analyses revealed predominantly positive interactions among both native and non-native species pairs, with only two negative relationships involving one native and two non-native taxa. This study provides insights into the biodiversity and geographical distribution of non-native fish in Beijing and establishes a baseline for future biomonitoring and conservation efforts. The findings underscore the need for further investigation into the mechanisms and dynamics of biological invasions within urban environments in Beijing.

2.
Front Genet ; 15: 1435793, 2024.
Artículo en Inglés | MEDLINE | ID: mdl-39119576

RESUMEN

Introduction: To enhance the beef cattle industry, Heilongjiang Province has developed a new Crossbred beef cattle variety through crossbreeding with exotic commercial breeds. This new variety exhibits relatively excellent meat quality, and efficient reproductive performance, catering to market demands. Method: This study employed whole genome resequencing technology to analyze the genetic pedigree and diversity of 19 Heilongjiang Crossbred beef cattle, alongside 59 published genomes from East Asian, Eurasian, and European taurine cattle as controls. In addition, genes related to production traits were also searched by identifying Runs of Homozygosity (ROH) islands and important fragments from ancestors. Results: A total of 14,427,729 biallelic SNPs were discovered, with the majority located in intergenic and intron regions and a small percentage in exon regions, impacting protein function. Population genetic analyses including Principal Component Analysis (PCA), Neighbor-Joining (NJ) tree, and ADMIXTURE identified Angus, Holstein, and Mishima as the main ancestors of Crossbred beef cattle. In genetic diversity analysis, nucleotide diversity, linkage disequilibrium, and inbreeding coefficient analysis reveal that the genetic diversity of Crossbred beef cattle is at a moderate level, and a higher inbreeding coefficient indicates the need for careful breeding management. In addition, some genes related to economic traits are identified through the identification of Runs of Homozygosity (ROH) islands and important fragments from ancestors. Conclusion: This comprehensive genomic characterization supports the targeted improvement of economically important traits in Crossbred beef cattle, facilitating advanced breeding strategies.

3.
Sci Bull (Beijing) ; 2024 May 25.
Artículo en Inglés | MEDLINE | ID: mdl-38945748

RESUMEN

During the past 3000 years, cattle on the Qinghai-Xizang Plateau have developed adaptive phenotypes under the selective pressure of hypoxia, ultraviolet (UV) radiation, and extreme cold. The genetic mechanism underlying this rapid adaptation is not yet well understood. Here, we present whole-genome resequencing data for 258 cattle from 32 cattle breeds/populations, including 89 Tibetan cattle representing eight populations distributed at altitudes ranging from 3400 m to 4300 m. Our genomic analysis revealed that Tibetan cattle exhibited a continuous phylogeographic cline from the East Asian taurine to the South Asian indicine ancestries. We found that recently selected genes in Tibetan cattle were related to body size (HMGA2 and NCAPG) and energy expenditure (DUOXA2). We identified signals of sympatric introgression from yak into Tibetan cattle at different altitudes, covering 0.64%-3.26% of their genomes, which included introgressed genes responsible for hypoxia response (EGLN1), cold adaptation (LRP11), DNA damage repair (LATS1), and UV radiation resistance (GNPAT). We observed that introgressed yak alleles were associated with noncoding variants, including those in present EGLN1. In Tibetan cattle, three yak introgressed SNPs in the EGLN1 promoter region reduced the expression of EGLN1, suggesting that these genomic variants enhance hypoxia tolerance. Taken together, our results indicated complex adaptation processes in Tibetan cattle, where recently selected genes and introgressed yak alleles jointly facilitated rapid adaptation to high-altitude environments.

4.
Adv Sci (Weinh) ; 11(29): e2402038, 2024 Aug.
Artículo en Inglés | MEDLINE | ID: mdl-38810152

RESUMEN

The strong potential of platinum single atom (PtSA) in gas sensor technology is primarily attributed to its high atomic economy. Nevertheless, it is imperative to conduct further exploration to understand the impact of PtSA on the active sites. In this study, the evolution of PtSA on (100)CeO2 and (111)CeO2 is examined, revealing notable disparities in the position and activity of surface PtSA on different crystal planes. The PtSA in (100)CeO2 surface can enhance the stability of Ce3+ and construct a frustrated Lewis pair (FLP) to form a double active site by combining the steric hindrance effect of oxygen vacancies, which increases the response value from 1.8 to 27 and reduce the response-recovery time from 140-192 s to 25-26 s toward five ppm NO2 at room temperature. Conversely, PtSA tends to bind to terminal oxygen on the surface of (111)CeO2 and become an independent reaction site. The response value of PtSA-(111)CeO2 surface only increased from 1.6 to 3.8. This research underscores the correlation between single atoms and crystal plane effects, laying the groundwork for designing and synthesizing ultra-stable and efficient gas sensors.

5.
Anim Genet ; 55(4): 511-526, 2024 Aug.
Artículo en Inglés | MEDLINE | ID: mdl-38726735

RESUMEN

Kashmir cattle, which were kept by local pastoralists for centuries, are exceptionally resilient and adaptive to harsh environments. Despite its significance, the genomic characteristics of this cattle breed remain elusive. This study utilized whole genome sequences of Kashmir cattle (n = 20; newly sequenced) alongside published whole genomes of 32 distinct breeds and seven core cattle populations (n = 135). The analysis identified ~25.87 million biallelic single nucleotide polymorphisms in Kashmir cattle, predominantly in intergenic and intron regions. Population structure analyses revealed distinct clustering patterns of Kashmir cattle with proximity to the South Asian, African and Chinese indicine cattle populations. Genetic diversity analysis of Kashmir cattle demonstrated lower inbreeding and greater nucleotide diversity than analyzed global breeds. Homozygosity runs indicated less consanguineous mating in Kashmir cattle compared with European taurine breeds. Furthermore, six selection sweep detection methods were used within Kashmir cattle and other cattle populations to identify genes associated with vital traits, including immunity (BOLA-DQA5, BOLA-DQB, TNFAIP8L, FCRL4, AOAH, HIF1AN, FBXL3, MPEG1, CDC40, etc.), reproduction (GOLGA4, BRWD1, OSBP2, LEO1 ADCY5, etc.), growth (ADPRHL1, NRG2, TCF12, TMOD4, GBP4, IGF2, RSPO3, SCD, etc.), milk composition (MRPS30 and CSF1) and high-altitude adaptation (EDNRA, ITPR2, AGBL4 and SCG3). These findings provide essential genetic insights into the characteristics and establish the foundation for the scientific conservation and utilization of Kashmir cattle breed.


Asunto(s)
Filogenia , Polimorfismo de Nucleótido Simple , Animales , Bovinos/genética , Secuenciación Completa del Genoma/veterinaria , Variación Genética , Cruzamiento , India
6.
Adv Mater ; 36(30): e2403215, 2024 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-38706406

RESUMEN

Prolonging energetic hot electrons lifetimes and surface activity in the reactive site can overcome the slow kinetics and unfavorable thermodynamics of photo-activated gas sensors. However, bulk and surface recombination limit the simultaneous optimization of both kinetics and thermodynamics. Here tandem electric fields are deployed at (111)/(100)Au-CeO2 to ensure a sufficient driving force for carrier transfer and elucidate the mechanism of the relationship between charge transport and gas-sensing performance. The asymmetric structure of the (111)/(100)CeO2 facet junction provides interior electric fields, which facilitates electron transfer from the (100)face to the (111)face. This separation of reduction and oxidation reaction sites across different crystal faces helps inhibit surface recombination. The increased electron concentration at the (111)face intensifies the interface electric field, which promotes electron transfer to the Au site. The local electric field generated by the surface plasmon resonance effect promotes the generation of high-energy energy hot-electrons, which maintains charge concentration in the interface field by injecting into (111)/(100)CeO2, thereby provide thermodynamic contributions and inhibit bulk recombination. The tandem electric fields enable the (111)/(100)Au-CeO2 to rapidly detect 5 ppm of NO2 at room temperature with stability maintained within 20 s.

7.
Nat Commun ; 14(1): 7803, 2023 Nov 28.
Artículo en Inglés | MEDLINE | ID: mdl-38016956

RESUMEN

Indicine cattle, also referred to as zebu (Bos taurus indicus), play a central role in pastoral communities across a wide range of agro-ecosystems, from extremely hot semiarid regions to hot humid tropical regions. However, their adaptive genetic changes following their dispersal into East Asia from the Indian subcontinent have remained poorly documented. Here, we characterize their global genetic diversity using high-quality whole-genome sequencing data from 354 indicine cattle of 57 breeds/populations, including major indicine phylogeographic groups worldwide. We reveal their probable migration into East Asia was along a coastal route rather than inland routes and we detected introgression from other bovine species. Genomic regions carrying morphology-, immune-, and heat-tolerance-related genes underwent divergent selection according to Asian agro-ecologies. We identify distinct sets of loci that contain promising candidate variants for adaptation to hot semi-arid and hot humid tropical ecosystems. Our results indicate that the rapid and successful adaptation of East Asian indicine cattle to hot humid environments was promoted by localized introgression from banteng and/or gaur. Our findings provide insights into the history and environmental adaptation of indicine cattle.


Asunto(s)
Evolución Biológica , Ecosistema , Animales , Bovinos , Alelos , Variación Genética , Secuenciación Completa del Genoma , Polimorfismo de Nucleótido Simple
8.
Pediatr Surg Int ; 39(1): 268, 2023 Sep 07.
Artículo en Inglés | MEDLINE | ID: mdl-37676292

RESUMEN

PURPOSE: The aim of this study is to use RNA sequencing and RT-qPCR to identify the main susceptibility genes linked to the occurrence and development of Hirschsprung disease in the colonic tissues of EDNRBm1yzcm and wild mice. METHODS: RNA was extracted from colon tissues of 3 mutant homozygous mice and 3 wild mice. RNA degradation, contamination concentration, and integrity were then measured. The extracted RNA was then sequenced using the Illumina platform. The obtained sequence data are filtered to ensure data quality and compared to the reference genome for further analysis. DESeq2 was used for gene expression analysis of the raw data. In addition, graphene oxide enrichment analysis and RT-qPCR validation were also performed. RESULTS: This study identified 8354 differentially expressed genes in EDNRBm1yzcm and wild mouse colon tissues by RNA sequencing, including 4346 upregulated genes and 4005 downregulated genes. Correspondingly, the results of RT-qPCR analysis showed good correlation with the transcriptome data. In addition, GO and KEGG enrichment results suggested that there were 8103 terms and 320 pathways in all DEGs. When P < 0.05, 1081 GO terms and 320 KEGG pathways reached a significant level. Finally, through the existing studies and the enrichment results of differentially expressed genes, it was determined that axon guidance and the focal adhesion pathway may be closely related to the occurrence of HSCR. CONCLUSIONS: This study analyzed and identified the differential genes in colonic tissues between EDNRBm1yzcm mice and wild mice, which provided new insight for further mining the potential pathogenic genes of Hirschsprung's disease.


Asunto(s)
Enfermedad de Hirschsprung , Animales , Ratones , Enfermedad de Hirschsprung/genética , Perfilación de la Expresión Génica , ARN , ARN Mensajero
9.
Stress Biol ; 3(1): 8, 2023 Apr 18.
Artículo en Inglés | MEDLINE | ID: mdl-37676580

RESUMEN

Domestic cattle have spread across the globe and inhabit variable and unpredictable environments. They have been exposed to a plethora of selective pressures and have adapted to a variety of local ecological and management conditions, including UV exposure, diseases, and stall-feeding systems. These selective pressures have resulted in unique and important phenotypic and genetic differences among modern cattle breeds/populations. Ongoing efforts to sequence the genomes of local and commercial cattle breeds/populations, along with the growing availability of ancient bovid DNA data, have significantly advanced our understanding of the genomic architecture, recent evolution of complex traits, common diseases, and local adaptation in cattle. Here, we review the origin and spread of domestic cattle and illustrate the environmental adaptations of local cattle breeds/populations.

10.
Reprod Domest Anim ; 58(5): 646-656, 2023 May.
Artículo en Inglés | MEDLINE | ID: mdl-36843275

RESUMEN

Testicular development and spermatogenesis are tightly regulated by the number of genes and noncoding genes, and mRNAs and lncRNAs play vital roles in regulating posttranscriptional gene expression. However, mRNAs and lncRNAs have not been systematically identified in the testes of donkeys. In this study, mRNA and lncRNA expression profiles in the testes of DeZhou donkeys between 2 months and 2 years of age were comprehensively analysed by RNA sequencing. We identified 56,605 lncRNAs and 61,857 mRNAs by gene expression analysis, and 21,845 lncRNAs (p < .05) and 14,109 mRNAs (p < .05) were differentially expressed in the immature (2-month-old, n = 3, noADGW) and mature (2-year-old, n = 3, ADGW) stages. In addition, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses revealed that the predicted target genes were enriched in the adherens junction, cell cycle, propanoate metabolism and cell adhesion molecule pathways. This study identified and analysed a comprehensive catalogue of lncRNAs and mRNAs in donkey testes, which provides a useful resource for further investigation of biological function in donkey lncRNAs.


Asunto(s)
ARN Largo no Codificante , Testículo , Masculino , Animales , Caballos/genética , Testículo/metabolismo , ARN Largo no Codificante/genética , ARN Largo no Codificante/metabolismo , Equidae/genética , ARN Mensajero/genética , Perfilación de la Expresión Génica/veterinaria
11.
Anim Biotechnol ; 34(4): 1436-1446, 2023 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-35130471

RESUMEN

Numerous studies have shown that several microRNAs (miRNAs) are specifically expressed in testis, play an essential role in regulating testicular spermatogenesis. Hainan and Mongolian cattle are two representative Chinese native cattle breeds representing Bos indicus (indicine cattle) and Bos taurus (taurine cattle), respectively, which are distributed in hot Hainan and cold Inner Mongolia province. To study the functional differences of miRNA in spermatogenesis between indicine and taurine cattle, six mature testes samples from indicine cattle (n = 3) and taurine cattle (n = 3) were collected, respectively. We detected miRNA expression using small RNA sequencing technology following bioinformatic analysis. A total of 578 known miRNAs and 132 novel miRNAs were detected in the six libraries. Among the 710 miRNAs, 564 miRNAs were expressed in both indicine and taurine cattle, 73 miRNAs were found solely in indicine cattle and 73 miRNAs were found solely in taurine cattle. After further analysis, among the miRNAs were identified in both indicine and taurine cattle, 184 miRNAs were differentially expressed (|log2 fold change| ≥ 1 and corrected p-value <0.05). Among the miRNAs that were only expressed in indicine cattle, 10 miRNAs were differentially expressed, whereas, among the miRNAs that were only expressed in taurine cattle, six miRNAs were differentially expressed. The enrichment analysis result showed that predicted target genes of a total of 200 differentially expressed miRNAs were enriched on some testicular spermatogenesis-related Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, especially mitogen-activated protein kinase (MAPK) signaling pathway. These findings identify miRNAs as key factors to regulate spermatogenesis in both indicine and taurine cattle, which may also be helpful for improving cattle reproductive performance in future studies.


Asunto(s)
MicroARNs , Testículo , Masculino , Bovinos/genética , Animales , Testículo/metabolismo , MicroARNs/genética , MicroARNs/metabolismo , Transcriptoma , Espermatogénesis/genética , Perfilación de la Expresión Génica/veterinaria
12.
Anim Biotechnol ; 34(4): 1143-1153, 2023 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-34935579

RESUMEN

IGF2 is an insulin-like growth factor that plays an important role in the development of animal embryos. In order to determine whether IGF2 gene is associated with important economic characteristics of donkeys, we investigated the association between single nucleotide polymorphisms (SNPs) of IGF2 gene and body size traits of Chinese Dezhou donkeys and analyzed the expression level of IGF2 gene in different tissues of juvenile and adult Dezhou donkeys. In this study, two SNPs (g.281766 G > A and g.291322 C > T) were detected in IGF2 gene, both of which were in Hardy-Weinberg equilibrium (P > 0.05) and were moderately polymorphic (0.25 < PIC < 0.50). Association analysis showed that the two SNP loci were significantly correlated with body length and rump height (p < 0.05) of female Dezhou donkeys. Quantitative results showed that the expression of IGF2 gene was higher in heart, liver, spleen, lung, kidney, stomach and muscle tissues of juvenile donkeys than that of adult donkeys. Together, IGF2 can be considered as a candidate gene for growth and development of female Dezhou donkey, and its polymorphism can be used as a molecular marker for the Dezhou donkey breeding.


Asunto(s)
Equidae , Polimorfismo de Nucleótido Simple , Femenino , Animales , Equidae/genética , Fenotipo , Polimorfismo de Nucleótido Simple/genética , Tamaño Corporal
13.
Anim Biotechnol ; 34(3): 503-507, 2023 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-34543156

RESUMEN

The discovery of molecular markers which associate with livestock economic traits is of great significance for livestock breeding. Selective analysis has found a potential correlation between CDKL5 and growth traits, but there is still a lack of experimental proof. In this study, a 31-bp deletion (g.176595_176626delATGTCACATGTGGTACTGCCATGTGGAATTT) of CDKL5 gene was found by sequencing. The 31-bp indel was then genotyped in 380 individuals of Dezhou donkeys by polyacrylamide gel electrophoresis and there were three genotypes in this population. After the association analysis between growth traits and genotypes, it was found that this 31-bp indel polymorphism was significantly associated with the chest circumference of Dezhou donkeys (p < 0.05), and body length, chest depth and rump width (p < 0.01). In addition, all individuals with DD genotype were better than those with other genotypes in growth traits. This study revealed that a newly identified polymorphic locus in the CDKL5 gene is related to growth traits, which provides a molecular marker for genetic improvement of Dezhou donkey and may lay a solid foundation for the breeding of Dezhou donkey.


Asunto(s)
Equidae , Polimorfismo Genético , Animales , Equidae/genética , Fenotipo , Genotipo , Biomarcadores
14.
Front Microbiol ; 14: 1306039, 2023.
Artículo en Inglés | MEDLINE | ID: mdl-38282742

RESUMEN

Weaning is undoubtedly one of the most crucial stages in the growth and development of all mammalian animals, including donkey foals. Weaning is a dynamic and coordinated process of the body, which is closely associated with the health, nutrition, and metabolism of the host. Many studies have shown that the intestinal microbiota and serum metabolites of mammals exhibit different changes during lactation, weaning, and postweaning. However, the alterations in serum metabolites in donkey foals before and postweaning and the correlation between serum metabolites and intestinal microbiota are largely unknown. This study is based on the fecal 16S rRNA and serum metabolomes of Dezhou donkey foals. In total, 10 samples (fecal and serum) were collected during the following three stages: before weaning (F.M.1), during weaning (F.M.3), and postweaning (F.M.6). To study the alterations in intestinal microflora, serum metabolites, and their correlation before and postweaning. We found that with the growth and weaning progress of donkey foals, the intestinal microbiota of donkey foals underwent obvious changes, and the diversity of fecal bacteria increased (Chao1 and Shannon indexes). The main intestinal microbial flora of donkey foals include Bacteroides and Firmicutes. We found many microbiota that are associated with immunity and digestion in the postweaning group, such as Verrucomicrobiales, Clostridia, Oscillospiraceae, Akkermansia, and Rikenellaceae, which can be considered microbial markers for the transition from liquid milk to solid pellet feed. Clostridia and Oscillospiraceae can produce organic acids, including butyric acid and acetic acid, which are crucial for regulating the intestinal microecological balance of donkeys. Furthermore, the metabolome showed that the serum metabolites enriched before and postweaning were mainly related to arachidonic acid metabolism and riboflavin metabolism. Riboflavin was associated with the development of the small intestine and affected the absorption of the small intestine. We also found that the changes in the gut microbiome of the foals were significantly correlated with changes in serum metabolites, including lysophosphatidylcholine (LPC; 12,0) and positively correlated with Lachnoclostridium and Roseburia. To summarize, this study provides theoretical data for the changes in the intestinal microbiome and serum metabolism during the entire weaning period of donkey foals.

15.
Biology (Basel) ; 11(9)2022 Sep 09.
Artículo en Inglés | MEDLINE | ID: mdl-36138810

RESUMEN

Dehong humped cattle are precious livestock resources of Yunnan Province, China; they have typical zebu traits. Here, we investigated their genetic characteristics using whole-genome resequencing data of Dehong humped animals (n = 18). When comparing our data with the publicly-available data, we found that Dehong humped cattle have high nucleotide diversity. Based on clustering models in a population structure analysis, Dehong humped cattle had a mutual genome ancestor with Chinese and Indian indicine cattle. While using the RFMix method, it is speculated that the body sizes of Dehong humped cattle were influenced by the Chinese indicine segments and that the immune systems of Dehong humped cattle were affected by additional ancestral segments (Indian indicine). Furthermore, we explored the position selection regions harboring genes in the Dehong humped cattle, which were related to heat tolerance (FILIP1L, ABHD6) and immune responses (GZMM, PRKCZ, STOML2, LRBA, PIK3CD). Notably, missense mutations were detected in the candidate gene ABHD6 (c.870C>A p.Asp290Glu; c.987C>A p.Ser329Arg). The missense mutations may have implications for Dehong humped cattle adaptation to hot environments. This study provides valuable genomic resource data at the genome-wide level and paves the way for future genetic breeding work in the Dehong humped cattle.

16.
Genomics ; 114(6): 110476, 2022 11.
Artículo en Inglés | MEDLINE | ID: mdl-36057425

RESUMEN

Liangzhou donkey is a domestic animal breed distributed on the edge of the Tengger Desert in Gansu Province of China. It has small body size and strong adaptability to dry environments. Here, we sequenced 10 Liangzhou donkey genomes and compared them to the 55 genomes of 8 representative donkey breeds worldwide. The population structure analysis revealed that Liangzhou donkey harboured the ancestry with the Asian domestic donkeys (0.863) and European domestic donkeys (0.137). Three methods (nucleotide diversity, linkage disequilibrium decay and runs of homozygosity) implied the genetic diversity in Liangzhou donkey. In addition, we analyzed the genetic basis of the small body size and drought adaptation of Liangzhou donkey by using Fst, θπ-ratio, XP-EHH, CLR and θπ methods. We found that the NCAPG-LCORL on chromosome 3 may be a candidate region for small body size trait of Liangzhou donkey. The CYP4A11 gene located on chromosome 5 showed strong sign of selection sweep. CYP4A11 can convert arachidonic acid into 19(S)-HETE, which can promote water reabsorption in renal tubule and enhance the ability of Liangzhou donkey to adapt to dry environment. These results contribute to a better understanding of the underlying population structure of Liangzhou donkeys and provides a valuable resource for future research on donkey breeding in response to climate change.


Asunto(s)
Equidae , Animales , Equidae/genética , China , Tamaño Corporal/genética
17.
Reprod Domest Anim ; 57(12): 1593-1601, 2022 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-36018481

RESUMEN

Sperm cryopreservation technology has laid the foundation for promoting the popularity of artificial insemination in donkey reproduction, but the freeze-thaw process can cause sperm damage, and the viability of frozen sperm is greatly reduced, resulting in low insemination ability. Sperm metabolites play an important role in the freezing process of spermatozoa and have a major influence on the freezability of spermatozoa. The aim of this study was to explore the differential metabolites in donkey spermatozoa before and after cryopreservation by liquid chromatography-tandem mass spectrometry (LC-MS/MS). We analysed ejaculate samples from male donkeys obtained before and after freezing and identified 1323 metabolites. Compared with fresh sperm (F), the metabolites of cryopreserved sperm (CRY) were significantly changed, and 570 metabolites were significantly different between the two groups (p < .05). Among them, 277 metabolites were higher in frozen sperm, while the opposite was true for 293 metabolites. These metabolites mainly include phospholipids, lysophospholipids and amino acids., most of which are associated with oxidative stress and sperm capacitation. We describe significantly different metabolites before and after freezing that are significantly associated with decreased sperm motility post-freezing and can be used as biomarkers of decreased sperm motility post-freezing.


Asunto(s)
Preservación de Semen , Masculino , Animales , Preservación de Semen/veterinaria , Preservación de Semen/métodos , Equidae , Motilidad Espermática , Cromatografía Liquida/veterinaria , Semen , Espectrometría de Masas en Tándem/veterinaria , Criopreservación/veterinaria , Criopreservación/métodos , Espermatozoides , Congelación
18.
Front Genet ; 13: 818420, 2022.
Artículo en Inglés | MEDLINE | ID: mdl-35646088

RESUMEN

The diversity of livestock coat color results from human positive selection and is an indispensable part of breed registration. As an important biodiversity resource, Asiatic wild ass has many special characteristics, including the most visualized feature, its yellowish-brown coat color, and excellent adaptation. To explore the genetic mechanisms of phenotypic characteristics in Asiatic wild ass and its hybrids, we resequenced the whole genome of one Mongolian Kulan (a subspecies of Asiatic wild ass) and 29 Kulan hybrids (Mongolian Kulan ♂×Xinjiang♀), and the ancestor composition indicated the true lineage of the hybrids. XP-EHH (Cross Population Extended Haplotype Homozygosity), θπ-ratio (Nucleotide Diversity Ratio), CLR (Composite Likelihood Ratio) and θπ (Nucleotide Diversity) methods were used to detect the candidate regions of positive selection in Asiatic wild ass and its hybrids. Several immune genes (DEFA1, DEFA5, DEFA7, GIMAP4, GIMAP1, IGLC1, IGLL5, GZMB and HLA) were observed by the CLR and θπ methods. XP-EHH and θπ-ratio revealed that these genes are potentially responsible for coat color (KITLG) and meat quality traits (PDE1B and MYLK2). Furthermore, the heatmap was able to show the clear difference in the haplotype of the KITLG gene between the Kulan hybrids and Asiatic wild ass group and the Guanzhong black donkey group, which is a powerful demonstration of the key role of KITLG in donkey color. Therefore, our study may provide new insights into the genetic basis of coat color, meat quality traits and immunity of Asiatic wild ass and its hybrids.

19.
Reprod Domest Anim ; 57(10): 1165-1175, 2022 Oct.
Artículo en Inglés | MEDLINE | ID: mdl-35713115

RESUMEN

Donkeys are indispensable livestock in China because they have transport function and medicinal value. With the popularization of artificial insemination on donkeys, semen cryopreservation technology has gradually become a research hotspot. Seminal plasma is a necessary medium for transporting sperm and provides energy and nutrition for sperm. Seminal plasma metabolites play an important role in the process of sperm freezing, and also have an important impact on sperm motility and fertilization rate after freezing and thawing. In this study, liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis was used to compare the metabolic characteristics of seminal plasma of high freezability (HF) and low freezability (LF) male donkeys. We identified 672 metabolites from donkey seminal plasma, of which 33 metabolites were significantly different between the two groups. Metabolites were identified and categorized according to their major chemical classes, including homogeneous non-metal compounds, nucleosides, nucleotides, and analogues, organosulphur compounds, phenylpropanoids and polyketide, organoheterocyclic compounds, organic oxygen compounds, benzenoids, organic acids and derivatives, lipids and lipid-like molecules, organooxygen compounds, alkaloids and derivatives, organic nitrogen compounds. The results showed that the contents of phosphatidylcholine, piceatannol and enkephalin in donkey semen of HF group were significantly higher than those of LF group (p < .05), while the contents of taurocholic and lysophosphatidic acid were significantly lower than those of LF group (p < .05). The different metabolites were mainly related to sperm biological pathway response and oxidative stress. These metabolites may be considered as candidate biomarkers for different fertility in jacks.


Asunto(s)
Policétidos , Preservación de Semen , Animales , Biomarcadores/análisis , Cromatografía Liquida/veterinaria , Criopreservación/métodos , Criopreservación/veterinaria , Encefalinas/análisis , Equidae , Lisofosfolípidos/análisis , Masculino , Compuestos de Nitrógeno/análisis , Nucleótidos/análisis , Fosfatidilcolinas/análisis , Policétidos/análisis , Semen/fisiología , Preservación de Semen/métodos , Preservación de Semen/veterinaria , Motilidad Espermática , Espermatozoides/fisiología , Espectrometría de Masas en Tándem/veterinaria
20.
Animals (Basel) ; 12(4)2022 Feb 17.
Artículo en Inglés | MEDLINE | ID: mdl-35203213

RESUMEN

Skeletal muscle plays an important role in the growth and development of meat animals. MicroRNAs (miRNAs) can participate in the regulation of muscle development-related functions; however, there have been few reports on whether there are related miRNAs that conservatively regulate muscle development among different species. In this study, the miRNA transcriptome sequencing data of the muscle tissue of cattle, rat, goat, and pig showed that miR-24-3p may conservatively regulate muscle development in these species. Furthermore, mmu-miR-24-3p can positively regulate C2C12 cell proliferation and apoptosis by regulating key proliferation and apoptosis genes in muscle development, which was verified by CCK-8 and RT-qPCR. Bta-miR-24-3p can also positively regulate the proliferation and apoptosis of bovine muscle primary cells by regulating key proliferation and apoptosis genes in the process of muscle development, as verified by CCK-8 and RT-qPCR. The target genes of miR-24-3p in cattle, rat, goat, and pig, which include a large proportion of target genes shared among the four species, are enriched in multiple cell functions and signal pathways that are closely related to muscle development, as revealed by GO and KEGG enrichment analysis. A double luciferase test showed that the shared target genes WNT4, CAMK2B, and TCF7 were targeted by mmu-miR-24-3p in rat and bta-miR-24-3p in cattle. These three shared target genes WNT4, CAMK2B, and TCF7 are involved in the Wnt signaling pathway, which showed that miR-24-3p plays an important role in rat and cattle. The shared target gene (CAMK2B) in rat and cattle increased significantly after the inhibition of miR-24-3p by RT-qPCR. The findings of this study contribute to a better understanding of the role of miR-24-3p in the regulation of muscle development.

SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA