Mutual regulation of microglia and astrocytes after Gas6 inhibits spinal cord injury.

JOURNAL/nrgr/04.03/01300535-202502000-00032/figure1/v/2024-05-28T214302Z/r/image-tiff Invasive inflammation and excessive scar formation are the main reasons for the difficulty in repairing nervous tissue after spinal cord injury. Microglia and astrocytes play key roles in the spinal cord injury micro-environment and share a close interaction. However, the mechanisms involved remain unclear. In this study, we found that after spinal cord injury, resting microglia (M0) were polarized into pro-inflammatory phenotypes (MG1 and MG3), while resting astrocytes were polarized into reactive and scar-forming phenotypes. The expression of growth arrest-specific 6 (Gas6) and its receptor Axl were significantly down-regulated in microglia and astrocytes after spinal cord injury. In vitro experiments showed that Gas6 had negative effects on the polarization of reactive astrocytes and pro-inflammatory microglia, and even inhibited the cross-regulation between them. We further demonstrated that Gas6 can inhibit the polarization of reactive astrocytes by suppressing the activation of the Yes-associated protein signaling pathway. This, in turn, inhibited the polarization of pro-inflammatory microglia by suppressing the activation of the nuclear factor-κB/p65 and Janus kinase/signal transducer and activator of transcription signaling pathways. In vivo experiments showed that Gas6 inhibited the polarization of pro-inflammatory microglia and reactive astrocytes in the injured spinal cord, thereby promoting tissue repair and motor function recovery. Overall, Gas6 may play a role in the treatment of spinal cord injury. It can inhibit the inflammatory pathway of microglia and polarization of astrocytes, attenuate the interaction between microglia and astrocytes in the inflammatory microenvironment, and thereby alleviate local inflammation and reduce scar formation in the spinal cord.

First Report of metaplexis yellow mottle-associated virus Infecting Metaplexis japonica (Thunb.) Makino in Shandong, China.

Metaplexis japonica (Thunb.) Makino, commonly known as rough potato, has a wide distribution in China, Japan, Korea, and adjacent Russia. In China, M. japonica is a traditional herbal medicinal plant, which is also cultivated as a vegetable (Shi et al. 2020; Wei et al. 2019). In July 2023, leaves of M. japonica plants growing near a soybean field in Qingdao, Shandong province, exhibited leaf crinkling, mosaic and distorting symptoms of probable virus infection (Supplementary Figure 1). The disease incidence in a 50 m2 area was approximately 40%. To identify the suspected viral etiological agents, symptomatic leaves from 10 M. japonica plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq). TransZol Up Total RNA Extraction Kit (TransGen Biotech, Beijing, China) was used to extract total RNA. Small RNA library construction and high-throughput sequencing (HTS) were performed on Illumina NovaSeq platform by Genepioneer (Nanjing, China) (Li et al. 2024). A total of 17,384,311 raw reads were obtained. Redundant reads were removed by cutadapt software (version 1.18) to obtain 11,580,876 clean reads with 18 to 26 nucleotide (nt) sizes. The clean reads were assembled using velvet software (version 1.1.07). A total of forty-six small contigs from 42 to 283 nt were identified, with 85 to 100% nucleotide sequence identities, respectively, to metaplexis yellow mottle-associated virus (MeYMaV, genus Caulimovirus, family Caulimoviridae, accession numbers: NC_077108.1). Finally, 1,355,955 reads (11.71% mapped ratio of total reads, cover 56.7% over the MeYMaV genome) were mapped to the genome of MeYMaV by bwa software (version 0.7.17-r1188). To confirm the sRNA-Seq results, PCR was performed with specific primers MeYMaV-N-F/MeYMaV-N-R (5'-TGGTATCAGAGCCTAGTTAA-3'/5'-GGAGTTGGTAATGTATTACC-3') and MeYMaV-C-F/MeYMaV-C-R (5'-AATGGAACGGCTGTTAGTAT3'/TTAATTTCTAGCCCTTGGCTACTTAC). Both the primer pairs were designed using GenBank accession numbers: NC_077108.1 (Yang et al. 2021) to obtain the N and C terminals genome fragments of 10 MeYMaV plants. Two amplicons approximately in 4000-, and 3900-bp sizes were amplified (Supplementary Figure 2), sequenced (tsingke, Beijing, China) and aligned to obtain 7,742-nt complete MeYMaV genome sequence (Accession no. PP892524). BLASTn analysis revealed 90.16% and 92.18% sequence identity, respectively, with the MeYMaV isolate LM-Cau-A (NC_077108.1) based on complete genome and coat protein sequences, respectively. Previously, cucumber mosaic virus and MeYMaV were reported in M. japonica from Jiangsu and Liaoning provinces in China, respectively (Yang et al. 2018; 2021). To our knowledge, this is the first natural infection report of MeYMaV in M. japonica in Shandong, China. The natural occurrence of MeYMaV is not only affects the quality of M. japonica, but also poses a potential threat to surrounding crops. This study enriches information on the disease distribution of MeYMaV and will be helpful for disease management.

Outdoor light at night is a modifiable environmental factor for metabolic syndrome: The 33 Communities Chinese Health Study (33CCHS).

Metabolic syndrome (MetS) is a significant public health problem and presents an escalating clinical challenge globally. To combat this problem effectively, urgent measures including identify some modifiable environmental factors are necessary. Outdoor artificial light at night (LAN) exposure garnered much attention due to its impact on circadian rhythms and metabolic process. However, epidemiological evidence on the association between outdoor LAN exposure and MetS remains limited. To determine the relationship between outdoor LAN exposure and MetS, 15,477 adults participated the 33 Communities Chinese Health Study (33CCHS) in 2009 were evaluated. Annual levels of outdoor LAN exposure at participants' residential addresses were assessed using satellite data from the Defense Meteorological Satellite Program (DMSP) Operational Linescan System (OLS). Generalized linear mixed effect models were utilized to assess the association of LAN exposure with MetS and its components, including elevated waist circumference (WC), triglycerides (TG), blood pressure (BP), fasting blood glucose (FBG), and reduced high-density lipoprotein cholesterol (HDL-C). Effect modification by various social demographic and behavior factors was also examined. Overall, 4701 (30.37 %) participants were defined as MetS. The LAN exposure ranged from 6.03 to 175.00 nW/cm2/sr. The adjusted odds ratio (OR) of MetS each quartile increment of LAN exposure were 1.43 (95 % CI: 1.21-1.69), 1.44 (95 % CI: 1.19-1.74) and 1.52 (95 % CI: 1.11-2.08), respectively from Q2-Q4. Similar adverse associations were also found for the components of MetS, especially for elevated BP, TG and FBG. Interaction analyses indicated that the above associations were stronger in participants without habitual exercise compared with those with habitual exercise (e.g. OR were 1.52 [95 % CI: 1.28-1.82] vs. 1.27 [95 % CI, 1.04-1.55], P-interaction = 0.042 for MetS). These findings suggest that long-term exposure to LAN can have a significant deleterious effect on MetS, potentially making LAN an important modifiable environmental factor to target in future preventive strategies.

Design and characteristic analysis of micro multi-core fiber vibration sensor.

We proposed and fabricated a miniaturized multi-core fiber grating vibration sensor. The size of the miniaturized vibration sensor is 10mm × 10mm × 10 mm with a mass of only 0.25g. Finite element analysis and experimental tests were carried out to validate the performance of the vibration sensor. The experiment results indicate that the sensor has a sensitivity of 68.72 pm/g in the X direction and 64.52 pm/g in the Y direction within the operating frequency range of 20-240Hz. The cross-interference between the two directions of vibration measurement falls within 4 %. The sensor is suitable for measuring mechanical vibrations in the mid-low frequency range, especially in cases where size, quality, and distributed measurement are of particular concern.

To explore the postoperative nutritional status and factors influencing prognosis in patients with chronic constipation complicated by malnutrition.

Background: Many patients with constipation also suffer from varying degrees of malnutrition, and the relationship between the two conditions is a vicious cycle. Surgery is the final step in the treatment of constipation, with a success rate of up to 95%. This study aims to investigate the effects of surgical treatment on the nutritional status of patients with chronic constipation and malnutrition. Methods: A total of 60 patients with chronic constipation and various degrees of malnutrition who underwent surgery in our department from January 2020 to March 2023 were included in this study. Biochemical tests including BMI, albumin, total protein, hemoglobin, cholesterol and lymphocyte count were conducted, as well as measurements of inflammatory markers such as Interleukin-6 (IL-6), Interleukin-8 (IL-8), and C-reactive protein (CRP). Additionally, multiple nutritional risk screening scales (NRS2002, MUST, NRI, and MNA) and the prognostic nutritional index (PNI) were used to assess the nutritional status of patients before surgery, as well as at 1 month, 3 months, and 6 months post-surgery. Finally, we analyzed the factors influencing postoperative recovery outcomes in patients. Results: Compared to pre-operation, the BMI of patients significantly increased at 1 month, 3 months, and 6 months after the operation, with statistically significant differences (p < 0.001). Multiple nutritional risk assessment tools (NRS2002, MUST, NRI, and MNA), as well as the prognostic nutritional index (NPI), indicated a reduction in nutritional risk and improvement in nutritional status at 1, 3, and 6 months post-surgery, compared to pre-surgery levels (p < 0.001). The levels of albumin, total protein, and hemoglobin in patients at 1, 3, and 6 months after the surgery were significantly higher than those before the surgery (p < 0.001). However, there was no significant change in the number of lymphocytes. Inflammatory markers such as IL-6, IL-8, and CRP exhibited a significant decrease after the surgery, reaching normal levels at 6 months post-surgery (p < 0.001). Low BMI, low PNI, and low cholesterol levels are independent risk factors for patient prognosis (p < 0.05). Conclusion: Surgical treatment can enhance the nutritional status of constipation patients with malnutrition, which in turn promotes the restoration of intestinal motility. The patient's nutritional status will impact the postoperative recovery outcomes.

Effects of plant nutrient acquisition strategies on biomass allocation patterns in wetlands along successional sequences in the semi-arid upper Yellow River basin.

The ecological environment of wetlands in semi-arid regions has deteriorated, and vegetation succession has accelerated due to climate warming-induced aridification and human interference. The nutrient acquisition strategies and biomass allocation patterns reflect plant growth strategies in response to environmental changes. However, the impact of nutrient acquisition strategies on biomass allocation in successional vegetation remains unclear. We investigated 87 plant communities from 13 wetland sites in the semi-arid upper Yellow River basin. These communities were divided into three successional sequences: the herbaceous community (HC), the herbaceous-shrub mixed community (HSC), and the shrub community (SC). The nutrient composition of stems and leaves, as well as the biomass distribution above and belowground, were investigated. Results revealed that aboveground biomass increased with succession while belowground biomass decreased. Specifically, SC exhibited the highest stem biomass of 1,194.53 g m-2, while HC had the highest belowground biomass of 2,054.37 g m-2. Additionally, significant positive correlations were observed between leaf and stem biomasses in both HC and SC. The nitrogen (N) and phosphorus (P) contents within aboveground parts displayed an evident upward trend along the succession sequence. The highest N and P contents were found in SC, followed by HSC, and the lowest in HC. Stem N was negatively correlated with stem, leaf, and belowground biomass but positively correlated with root-shoot ratio. Leaf P displayed positive correlations with aboveground biomass while showing negative correlations with belowground biomass and root-shoot ratio. The ratios of C:N, C:P, and N:P in stem and leaf exhibited positive correlations with belowground biomass. The random forest model further demonstrated that stem N and leaf P exerted significant effects on aboveground biomass, while leaf P, stem N and P, and leaf C:P ratio had significant effects on belowground components. Additionally, the root-shoot ratio was significantly influenced by leaf P, leaf C:P ratio, and stem N, P, and C:P ratio. Therefore, the aboveground and belowground biomasses exhibited asynchronism across successional sequences, while plant nutrient acquisition strategies, involving nutrient levels and stoichiometric ratios, determined the biomass allocation pattern. This study offers valuable insights for assessing vegetation adaptability and formulating restoration plans in the semi-arid upper Yellow River basin.

Molecular Dynamics Simulations Guide the Gasification Process of Carbon-Supported Nickel Catalysts in Biomass Supercritical Water.

In this study, the Density Functional Theory (DFT) Calculations for Molecules and Clusters-ADF module is employed to model carbon-supported nickel catalysts and lignin monomers, integrating the ReaxFF module to simulate molecular dynamics under supercritical water conditions, with a focus on lignin decomposition reactions. Molecular dynamics models for supercritical water gasification are established under various conditions such as catalyst presence, water molecule quantities, and reaction temperature. By comparing simulation systems under different conditions, the yields of and variations in combustible gases (hydrogen and carbon monoxide) are summarized. Introducing heteroatoms into the lattice of the carbon support can alter the electronic structure within graphene, thereby influencing its electrical and electrochemical properties, increasing the number of active sites, and significantly enhancing electrocatalytic activity. Simulation results indicate that carbon-supported nickel metal catalysts can promote the cleavage of C-C bonds in lignin monomers, thereby increasing the rate of water-gas shift reactions and boosting hydrogen production in the system by 105%. Increasing water molecule quantities favored water-gas shift reactions and hydrogen generation while lowering carbon monoxide formation. Moreover, elevating reaction temperatures led to increased hydrogen and carbon monoxide production rates, which were particularly pronounced between 2500 K and 3500 K. These findings offer crucial theoretical insights for advancing efficient hydrogen production through biomass supercritical water gasification.

Meta Pairwise Relationship Distillation for Unsupervised Person Re-Identification.

Unsupervised person re-identification (Re-ID) is challenging due to the lack of ground-truth labels. Most existing methods rely on pseudo labels estimated via iterative clustering and thus are highly susceptible to performance penalties incurred by the inaccurate estimated number of clusters. Alternatively, we utilize the sample pairs with pairwise pseudo labels to guide the feature learning to avoid the dilemma of determining cluster numbers. In this article, we propose a meta pairwise relationship distillation (MPRD) method that incorporates a graph convolutional network (GCN) to provide high-fidelity pairwise relationships to supervise the model training. A small amount of metadata with very-confidence pairwise relationships and the unlabeled pairs with the provided pseudo pairwise relationships participate in the GCN training. Besides, we introduce a hard sample deduction (HSD) module to timely mine the sample pairs with error-prone pairwise pseudo labels to mitigate the misled optimization by noisy labels. Furthermore, since the features of each positive pair represent the same person, we design a positive pair alignment (PPA) module to reduce the redundant information in each feature, which is achieved by minimizing the difference between each positive pair's feature distributions. Extensive experiments on the Market-1501, DukeMTMC-reID, and MSMT17 datasets show that our method outperforms the state-of-the-art unsupervised methods.

Curculigoside Regulates Apoptosis and Oxidative Stress Against Spinal Cord Injury by Modulating the Nrf-2/NQO-1 Signaling Pathway In Vitro and In Vivo.

Spinal cord injury (SCI) is a severe neurological disorder that can lead to paralysis or death. Oxidative stress during SCI is a critical phase causing extensive nerve cell damage and apoptosis, thereby impairing spinal cord healing. Thus, a primary goal of SCI drug therapy is to mitigate oxidative stress. Curculigoside (CUR), a phenolic glucoside extracted from the dried root and rhizome of Curculigo orchioides Gaertn, possesses neuroprotective and antioxidant properties. This study aimed to investigate whether CUR effectively promotes the recovery of spinal cord tissue following SCI and elucidate its mechanism. We employed a hydrogen peroxide (H2O2)-induced PC12 cell model and an SCI rat model to observe the effects of CUR on oxidation and apoptosis. The results demonstrated that CUR significantly reduced the expression of apoptosis-related proteins (Bax and Caspase-3), Annexin V/propidium iodide (PI), and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL), while increasing the expression of the anti-apoptotic protein Bcl-2. Moreover, CUR effectively enhanced levels of antioxidants (glutathione [GSH)] and decreased reactive oxygen species (ROS) in vitro. Furthermore, CUR facilitated functional recovery through its anti-apoptotic and anti-oxidative stress effects on spinal cord tissues in SCI rats. These effects were mediated via the Nrf2/NQO1 signaling pathway. Therefore, our study showed that CUR acted as an anti-apoptotic and anti-oxidative stress agent, inhibiting astrocyte activation and promoting neuronal reconstruction and functional recovery. These findings may contribute significantly to the development of SCI treatments and advance the field of SCI drug therapy.

Highly sensitive volumetric single-molecule imaging.

Volumetric subcellular imaging has long been essential for studying structures and dynamics in cells and tissues. However, due to limited imaging speed and depth of field, it has been challenging to perform live-cell imaging and single-particle tracking. Here we report a 2.5D fluorescence microscopy combined with highly inclined illumination beams, which significantly reduce not only the image acquisition time but also the out-of-focus background by ∼2-fold compared to epi-illumination. Instead of sequential z-scanning, our method projects a certain depth of volumetric information onto a 2D plane in a single shot using multi-layered glass for incoherent wavefront splitting, enabling high photon detection efficiency. We apply our method to multi-color immunofluorescence imaging and volumetric super-resolution imaging, covering ∼3-4 µm thickness of samples without z-scanning. Additionally, we demonstrate that our approach can substantially extend the observation time of single-particle tracking in living cells.

Carbonylation Reactions at Carbon-Centered Radicals with an Adjacent Heteroatom.

Heteroatoms are essential to living organisms and present in almost all molecules with medicinal usage. The catalytic functionalization at the carbon-centered radical with an adjacent heteroatom provides an effective way to value added moiety while retaining the unique physicochemical and pharmacological properties of heteroatoms, which can promote the development of pharmaceutical and fine chemical production. Carbonylative transformation was discovered nearly a century ago which is an efficient method for the synthesis of carbonyl-containing molecules with potent applications in both industry and academia. Despite numerous advances in new reaction development, carbonylative transformation involving adjacent heteroatom carbon radical remain a subject that deserves to be discussed. In this minireview, we systematically summarized and discussed the recent advances in carbonylative transformations involving carbon-centered radicals with an adjacent heteroatom, including oxygen (O), nitrogen (N), phosphorus (P), silicon (Si), sulfur (S), boron (B), fluorine (F), and chlorine (Cl). The related reaction mechanism was also discussed.

A synchronous-fluorescence analysis method combing with simple one-step extraction for determination of leonurine in traditional Chinese medicine.

Synchronous fluorescence spectroscopy (SFS) technology exhibits significant advantages in identifying target fluorescence signals within complex mixtures of multiple fluorescent compounds, owing to their closely overlapping spectra. In this study, a SFS method is reported for the first time for the direct analysis of leonurine in drugs containing concurrent natural products. By setting the wavelength interval (Δλ) to 30 nm, the characteristic emission peak of leonurine is observed at 307 nm, which increases proportionally with the concentration of leonurine without spectral overlap from other fluorescent species. The limit of detection (LOD) is estimated to be about 0.22 µM, and a low linear range of 0 to 20 µM is obtained. The common cations, anions and concomitant compounds display no interference with the SFS signal of leonurine, supporting the practical application of this method. Thus, we successfully applied this SFS method to detect leonurine in several real samples (leonurus granules, capsules, ointment and pills), in which the good relative standard deviation (RSD) values (0.04-4.24%) and recoveries (95.63-113%) were obtained. As a result, this work provides an efficient and convenient method to identify the target active compound from natural products without complex pre-treatment to diminish the fluorescent chaos that might be serving a potential role in the study of traditional Chinese medicine.

Disentangled Sample Guidance Learning for Unsupervised Person Re-identification.

Unsupervised person re-identification (Re-ID) is challenging due to the lack of ground truth labels. Most existing methods employ iterative clustering to generate pseudo labels for unlabeled training data to guide the learning process. However, how to select samples that are both associated with high-confidence pseudo labels and hard (discriminative) enough remains a critical problem. To address this issue, a disentangled sample guidance learning (DSGL) method is proposed for unsupervised Re-ID. The method consists of disentangled sample mining (DSM) and discriminative feature learning (DFL). DSM disentangles (unlabeled) person images into identity-relevant and identity-irrelevant factors, which are used to construct disentangled positive/negative groups that contain discriminative enough information. DFL incorporates the mined disentangled sample groups into model training by a surrogate disentangled learning loss and a disentangled second-order similarity regularization, to help the model better distinguish the characteristics of different persons. By using the DSGL training strategy, the mAP on Market-1501 and MSMT17 increases by 6.6% and 10.1% when applying the ResNet50 framework, and by 0.6% and 6.9% with the vision transformer (VIT) framework, respectively, validating the effectiveness of the DSGL method. Moreover, DSGL surpasses previous state-of-the-art methods by achieving higher Top-1 accuracy and mAP on the Market-1501, MSMT17, PersonX, and VeRi-776 datasets. The source code for this paper is available at https://github.com/jihaoxuanye/DiseSGL.

Contrast-Enhanced Computed Tomography-Based Machine Learning Radiomics Predicts IDH1 Expression and Clinical Prognosis in Head and Neck Squamous Cell Carcinoma.

RATIONALE AND OBJECTIVES: Isocitrate dehydrogenase 1 (IDH1) is a potential therapeutic target across various tumor types. Here, we aimed to devise a radiomic model capable of predicting the IDH1 expression levels in patients with head and neck squamous cell carcinoma (HNSCC) and examined its prognostic significance. MATERIALS AND METHODS: We utilized genomic data, clinicopathological features, and contrast-enhanced computed tomography (CECT) images from The Cancer Genome Atlas and the Cancer Imaging Archive for prognosis analysis and radiomic model construction. The selection of optimal features was conducted using the intraclass correlation coefficient, minimum redundancy maximum relevance, and recursive feature elimination algorithms. A radiomic model for IDH1 prediction and radiomic score (RS) were established using a gradient-boosting machine. Associations between IDH1 expression, RS, clinicopathological variables, and overall survival (OS) were determined using univariate and multivariate Cox proportional hazards regression analyses and Kaplan-Meier curves. RESULTS: IDH1 emerged as a distinct predictive factor in patients with HNSCC (hazard ratio [HR] 1.535, 95% confidence interval [CI]: 1.117-2.11, P = 0.008). The radiomic model, built on eight optimal features, demonstrated area under the curve values of 0.848 and 0.779 in the training and validation sets, respectively, for predicting IDH1 expression levels. Calibration and decision curve analyses validated the model's suitability and clinical utility. RS was significantly associated with OS (HR=2.22, 95% CI: 1.026-4.805, P = 0.043). CONCLUSION: IDH1 expression is a significant prognostic marker. The developed radiomic model, derived from CECT features, offers a promising approach for diagnosing and prognosticating HNSCC.

The impact of small intestinal bacterial overgrowth on the efficacy of fecal microbiota transplantation in patients with chronic constipation.

To investigate the impact of Small Intestinal Bacterial Overgrowth (SIBO) on the efficacy of Fecal Microbiota Transplantation (FMT) in patients with chronic constipation, our research team included 218 patients with chronic constipation treated with FMT. Based on the results of the SIBO breath test, the patients were divided into two groups: the constipation with SIBO group (SIBO) and the constipation without SIBO group (non-SIBO). The efficacy of the two groups was evaluated using constipation-related scoring scales. At the same time, feces and small intestinal fluid samples were collected from both groups before and after FMT to compare the changes in the intestinal microbiota through 16S rRNA sequencing. In this study, it was found that the clinical efficacy of FMT in the SIBO group was superior to that in the non-SIBO group. After FMT treatment, both groups showed a significant increase in bowel frequency and improvement in stool characteristics. Abdominal symptoms, rectal symptoms, and defecation symptoms were significantly alleviated (P < 0.05), and patients' quality of life was significantly enhanced (P < 0.05). After FMT, except for the Constipation Assessment Scale scores, other scale scores showed significant differences between the two groups, the SIBO group scoring significantly better than the non-SIBO group (P < 0.05). After FMT, there were minor changes in the colonic microbiota but more substantial changes in the small intestinal microbiota. At baseline, the SIBO group had a higher abundance of Veillonella, and lower abundances of Escherichia-Shigella and Acinetobacter compared to the non-SIBO group. Chronic constipation patients with SIBO have a better response to FMT than those without SIBO. IMPORTANCE: Existing studies have rarely considered the impact of the small intestine's microbial state on the efficacy of fecal microbiota transplantation (FMT), nor have they extensively explored the effect of the small intestine's microbial state on the recovery of colonic motility. Therefore, this study investigates the influence of small intestinal bacterial overgrowth (SIBO) on the efficacy of FMT in treating constipation, specifically the impact of the microbial state of the small intestine on the restoration of colonic homeostasis, and consequently on the recovery of colonic motility.

Maize Dek51 encodes a DEAD-box RNA helicase essential for pre-rRNA processing and seed development.

Pre-rRNA processing is essential to ribosome biosynthesis. However, the processing mechanism is not fully understood in plants. Here, we report a DEAD-box RNA helicase DEK51 that mediates the 3' end processing of 18S and 5.8S pre-rRNA in maize (Zea mays L.). DEK51 is localized in the nucleolus, and loss of DEK51 arrests maize seed development and blocks the 3' end processing of 18S and 5.8S pre-rRNA. DEK51 interacts with putative key factors in nuclear RNA exosome-mediated pre-rRNA processing, including ZmMTR4, ZmSMO4, ZmRRP44A, and ZmRRP6L2. This suggests that DEK51 facilitates pre-rRNA processing by interacting with the exosome. Loss of ZmMTR4 function arrests seed development and blocks the 3' end processing of 18S and 5.8S pre-rRNA, similar to dek51. DEK51 also interacts with endonucleases ZmUTP24 and ZmRCL1, suggesting that it may also be involved in the cleavage at site A2. These results show the critical role of DEK51 in promoting 3' end processing of pre-rRNA.

Visible light induced cooperative carbonylation and (hetero)aryl migration: synthesis of multi-carbonyl compounds.

Carbonylative transformation represents one of the most straightforward procedures for the synthesis of carbonyl-containing compounds. However, the carbonylative procedure toward 1,4-diketones is still limited which are key moieties with potent applications in various areas. Herein, we report a new strategy for the synthesis of multi-carbonyl compounds containing a 1,4-diketone skeleton through remote heteroaryl migration of traditionally restricted 1,3-migratory substrates utilizing carbon monoxide (CO) as the C1 synthon and diazonium compounds as the starting material.

Integrative plasma and fecal metabolomics identify functional metabolites in adenoma-colorectal cancer progression and as early diagnostic biomarkers.

Changes in plasma and fecal metabolomes in colorectal cancer (CRC) progression (normal-adenoma-CRC) remain unclear. Here, plasma and fecal samples were collected from four independent cohorts of 1,251 individuals (422 CRC, 399 colorectal adenoma [CRA], and 430 normal controls [NC]). By metabolomic profiling, signature plasma and fecal metabolites with consistent shift across NC, CRA, and CRC are identified, including CRC-enriched oleic acid and CRC-depleted allocholic acid. Oleic acid exhibits pro-tumorigenic effects in CRC cells, patient-derived organoids, and two murine CRC models, whereas allocholic acid has opposing effects. By integrative analysis, we found that oleic acid or allocholic acid directly binds to α-enolase or farnesoid X receptor-1 in CRC cells, respectively, to modulate cancer-associated pathways. Clinically, we establish a panel of 17 plasma metabolites that accurately diagnoses CRC in a discovery and three validation cohorts (AUC = 0.848-0.987). Overall, we characterize metabolite signatures, mechanistic significance, and diagnostic potential of plasma and fecal metabolomes in CRC.

Comparative analysis of the mitochondrial genomes of four Dendrobium species (Orchidaceae) reveals heterogeneity in structure, synteny, intercellular gene transfer, and RNA editing.

The genus Dendrobium, part of the Orchidaceae family, encompasses species of significant medicinal, nutritional, and economic value. However, many Dendrobium species are threatened by environmental stresses, low seed germination rates, and overharvesting. Mitochondria generate the energy necessary for various plant life activities. Despite their importance, research on the mitochondrial genomes of Dendrobium species is currently limited. To address this gap, we performed a comprehensive genetic analysis of four Dendrobium species-D. flexicaule, D. nobile, D. officinale, and D. huoshanense-focusing on their mitochondrial and chloroplast genomes to elucidate their genetic architecture and support conservation efforts. We utilized advanced sequencing technologies, including Illumina for high-throughput sequencing and Nanopore for long-read sequencing capabilities. Our findings revealed the multichromosomal mitochondrial genome structures, with total lengths ranging from 596,506 bp to 772,523 bp. The mitochondrial genomes contained 265 functional genes, including 64-69 protein-coding genes, 23-28 tRNA genes, and 3 rRNA genes. We identified 647 simple sequence repeats (SSRs) and 352 tandem repeats, along with 440 instances of plastid-to-mitochondrial gene transfer. Additionally, we predicted 2,023 RNA editing sites within the mitochondrial protein-coding genes, predominantly characterized by cytosine-to-thymine transitions. Comparative analysis of mitochondrial DNA across the species highlighted 25 conserved genes, with evidence of positive selection in five genes: ccmFC, matR, mttB, rps2, and rps10. Phylogenetic assessments suggested a close sister relationship between D. nobile and D. huoshanense, and a similar proximity between D. officinale and D. flexicaule. This comprehensive genomic study provides a critical foundation for further exploration into the genetic mechanisms and biodiversity of Dendrobium species, contributing valuable insights for their conservation and sustainable utilization.

Initialization-Free and Magnetic Field-Free Spin-Orbit p-Bits with Backhopping-like Magnetization Switching for Probabilistic Applications.

Probabilistic bits (p-bits) with thermal- and spin torque-induced nondeterministic magnetization switching are promising candidates for performing probabilistic computing. Previously reported spin torque p-bits include volatile low-energy barrier nanomagnets (LBNMs) with spontaneously fluctuating magnetizations and initialization-necessary nonvolatile magnets. However, initialization-free nonvolatile spin torque p-bits are still lacking. Here, we demonstrate moderately thermal stable spin-orbit torque (SOT) p-bits with non-consecutively deposited Pt//Pt/Co/Pt stacks. Backhopping-like (BH) magnetization switching with a wide range current-tunable probability of final up and down magnetization states from 0% to 100% was achieved, regardless of the initial magnetization state, which was attributed to the interplay of SOT and thermal contributions. Integer factorization using such BH-SOT p-bits in zero magnetic field was demonstrated at times that are significantly shorter than those of existing nonvolatile STT or volatile LBNMs p-bits. Our realization of initialization-free and magnetic field-free moderately thermally stable BH-SOT p-bits opens up a new perspective for probabilistic spintronic applications.