RESUMEN
Head and neck cancer (HNC) is a highly aggressive type of tumor characterized by delayed diagnosis, recurrence, metastasis, relapse, and drug resistance. The occurrence of HNC were associated with smoking, alcohol abuse (or both), human papillomavirus infection, and complex genetic and epigenetic predisposition. Currently, surgery and radiotherapy are the standard treatments for most patients with early-stage HNC. For recurrent or metastatic (R/M) HNC, the first-line treatment is platinum-based chemotherapy combined with the antiepidermal growth factor receptor drug cetuximab, when resurgery and radiation therapy are not an option. However, curing HNC remains challenging, especially in cases with metastasis. In this review, we summarize the pathogenesis of HNC, including genetic and epigenetic changes, abnormal signaling pathways, and immune regulation mechanisms, along with all potential therapeutic strategies such as molecular targeted therapy, immunotherapy, gene therapy, epigenetic modifications, and combination therapies. Recent preclinical and clinical studies that may offer therapeutic strategies for future research on HNC are also discussed. Additionally, new targets and treatment methods, including antibody-drug conjugates, photodynamic therapy, radionuclide therapy, and mRNA vaccines, have shown promising results in clinical trials, offering new prospects for the treatment of HNC.
RESUMEN
With the global spread of human immunodeficiency virus (HIV) infection and acquired immune deficiency syndrome (AIDS), the pursuit of potent treatments has ascended as a paramount concern in global healthcare. Traditional Chinese medicine (TCM) has been used for thousands of years in China and other East Asian countries and it offers remedies for an extensive array of ailments, including HIV and AIDS. This review focuses on the clinical significance of single herbs and composite tonics in TCM with antiviral activity against HIV. Initially, the anti-HIV activity of single herbs was analyzed in detail. Many herbs have been shown to have significant anti-HIV activity. The active ingredients of these herbs exhibit their anti-HIV effects through various mechanisms, such as inhibiting viral replication, preventing viral binding to host cells, and interfering with the viral lifecycle. Furthermore, we delved into the clinical significance of HIV-associated formulations provided as a result of Chinese compound prescription. These combinations of herbal ingredients are designed to amplify therapeutic efficacy and minimize adverse effects. Clinical trials have demonstrated the therapeutic benefits of these prescriptions for individuals infected with HIV. The intricate composition of these prescriptions potentially augments their anti-HIV activity through synergistic effects. Additionally, this review underscores the clinical importance of TCM in the context of HIV treatment. While numerous herbs and prescriptions exhibit anti-HIV activity, their safety and efficacy in clinical applications warrant further investigation. When combined with contemporary antiretroviral drugs, TCM may serve as an adjunctive therapy, assisting in reducing side effects, and enhancing patients' quality of life. To optimally harness these natural resources, further exploration is imperative to ascertain their efficacy, safety, and optimal utilization, thereby offering a broader spectrum of therapeutic options for HIV-afflicted individuals.
RESUMEN
Cholangiocarcinoma (CCA) displays enhanced glycolysis, pivotal for fulfilling the heightened energy demands intrinsic to its malignant progression. Recent research has indicated that endogenous glycogen rather than exogenous glucose acts as the major carbon source for glycolysis, highlighting the need to better understand the regulation of glycogen homeostasis in CCA. Here, through comprehensive integrative analysis, we identified that glycogen phosphorylase brain form (PYGB), the main enzyme involved in glycogen homeostasis, was markedly upregulated in CCA tissues, serving as an independent prognostic indicator for human CCA patients. Moreover, elevated PYGB expression potentiated cholangiocarcinogenesis and augmented CCA cell proliferation in both organoid and xenograft models. Hypoxia stimulated PYGB activity in a phosphoglycerate kinase 1 (PGK1)-dependent manner, leading to glycogenolysis and the subsequent release of glucose-6-phosphate (G6P) and thereby facilitating aerobic glycolysis. Notably, a virtual screening pinpointed the beta-blocker carvedilol as a potent pharmacological inhibitor of PYGB that could attenuate CCA progression. Collectively, these findings position PYGB as a promising prognostic biomarker and therapeutic target for CCA.
RESUMEN
Following the publication of the above article, an interested reader drew to our attention the fact that the forward primer reported in Table I on p. 3 for miR5453p (5'TGGCTCAGTTCAGCAGGAAC3') was actually for miR243p (5'UGGCUCAGUUCAGCAGGAACAG3'). Upon performing an independent analysis of the primer sequences in the Editorial Office, the sequence presented for miR6705p also appeared to have potentially been written incorrectly. After having drawn these matters to the attention of the authors, they realized that these sequences had indeed been written incorrectly in Table I. The corrected version of Table I, featuring the correct forward and reverse primer sequences for both miR6705p and miR5453p, is shown opposite. The authors wish to thank the interested reader for drawing this error to their attention, and are grateful to the Editor of Molecular Medicine Reports for allowing them this opportunity to publish a Corrigendum. They also apologize to the readership for any inconvenience caused. [Molecular Medicine Reports 25: 202, 2022; DOI: 10.3892/mmr.2022.12718].
RESUMEN
The utility of the mitochondrial genomes (mitogenomes) in analyzing the evolutionary history of animals has been proven. Five deep-sea corals (Bathypathes sp.1, Bathypathes sp.2, Schizopathidae 1, Trissopathes sp., and Leiopathes sp.) were collected in the South China Sea (SCS). Initially, the structures and collinearity of the five deep-sea coral mitogenomes were analyzed. The gene arrangements in the five deep-sea coral mitogenomes were similar to those in the order Antipatharia, which evidenced their conservation throughout evolutionary history. Additionally, to elucidate the slow evolutionary rates in Hexacorallia mitogenomes, we conducted comprehensive analyses, including examining phylogenetic relationships, performing average nucleotide identity (ANI) analysis, and assessing GC-skew dissimilarity combining five deep-sea coral mitogenomes and 522 reference Hexacorallia mitogenomes. Phylogenetic analysis using 13 conserved proteins revealed that species clustered together at the order level, and they exhibited interspersed distributions at the family level. The ANI results revealed that species had significant similarities (identity > 85%) within the same order, while species from different orders showed notable differences (identity < 80%). The investigation of the Hexacorallia mitogenomes also highlighted that the GC-skew dissimilarity was highly significant at the order level, but not as pronounced at the family level. These results might be attributed to the slow evolution rate of Hexacorallia mitogenomes and provide evidence of mitogenomic diversity. Furthermore, divergence time analysis revealed older divergence times assessed via mitogenomes compared with nuclear data, shedding light on significant evolutionary events shaping distinct orders within Hexacorallia corals. Those findings provide new insights into understanding the slow evolutionary rates of deep-sea corals in all lineages of Hexacorallia using their mitogenomes.
Asunto(s)
Antozoos , Evolución Molecular , Genoma Mitocondrial , Filogenia , Antozoos/genética , Antozoos/clasificación , Animales , Composición de BaseRESUMEN
Background: Sleep complaints were reported to be associated with stroke, however, the evidence on the association between healthy sleep pattern and stroke risk in Chinese is limited. Objective: The aim of this study was to investigate the association between healthy sleep pattern and stroke in Chinese, and the influence of metabolic diseases on the association. Methods: A total of 11,851 participants from the Kailuan study in China without stroke at baseline were included. We calculated a healthy sleep score according to four sleep factors, and defined the low-risk groups as follows: no insomnia, no excessive daytime sleepiness, no frequent snoring, and sleep 7-8h/d. Each low-risk sleep factor was assigned a score of 1. Cox proportional hazard models were used to assess the association between healthy sleep score and stroke. Mediation analysis was used to estimate the role of metabolic diseases (obesity, diabetes, and hypertension) in the healthy sleep score-stroke association. Results: During a mean follow-up period of 7.7 years, 504 cases of stroke were identified. A higher healthy sleep score was associated with a lower risk of stroke in a dose-response manner (P-trend=0.03). The adjusted hazard ratio (HR) for participants with a healthy sleep score of 4 versus ≤2 was 0.75 (95% confidence interval [CI]: 0.56, 0.96). In addition, obesity, diabetes, and hypertension collectively explained 21.9% (95% CI: 17.2, 26.5) of the association between healthy sleep score and stroke. Conclusion: Adherence to healthy sleep pattern was associated with a lower risk of stroke, and the favorable association was partially mediated by metabolic diseases.
RESUMEN
Using global data for around 180 countries and territories and 170 food/feed types primarily derived from FAOSTAT, we have systematically analyzed the changes in greenhouse gas (GHG) emission intensity (GHGi) (kg CO2eq per kg protein production) over the past six decades. We found that, with large spatial heterogeneity, emission intensity decreased by nearly two-thirds from 1961 to 2019, predominantly in the earlier years due to agronomic improvement in productivity. However, in the most recent decade, emission intensity has become stagnant, and in a few countries even showed an increase, due to the rapid increase in livestock production and land use changes. The trade of final produced protein between countries has potentially reduced the global GHGi, especially for countries that are net importers with high GHGi, such as many in Africa and South Asia. Overall, a continuous decline of emission intensity in the future relies on countries with higher emission intensity to increase agricultural productivity and minimize land use changes. Countries with lower emission intensity should reduce livestock production and increase the free trade of agricultural products and improve the trade optimality.
Asunto(s)
Agricultura , Gases de Efecto Invernadero , Agricultura/métodos , Gases de Efecto Invernadero/análisis , Carbono/metabolismo , Ganado , Animales , Productos AgrícolasRESUMEN
AIMS: Schizophrenia is characterized by alterations in resting-state spontaneous brain activity; however, it remains uncertain whether variations at diverse spatial scales are capable of effectively distinguishing patients from healthy controls. Additionally, the genetic underpinnings of these alterations remain poorly elucidated. We aimed to address these questions in this study to gain better understanding of brain alterations and their underlying genetic factors in schizophrenia. METHODS: A cohort of 103 individuals with diagnosed schizophrenia and 110 healthy controls underwent resting-state functional MRI scans. Spontaneous brain activity was assessed using the regional homogeneity (ReHo) metric at four spatial scales: voxel-level (Scale 1) and regional-level (Scales 2-4: 272, 53, 17 regions, respectively). For each spatial scale, multivariate pattern analysis was performed to classify schizophrenia patients from healthy controls, and a transcriptome-neuroimaging association analysis was performed to establish connections between gene expression data and ReHo alterations in schizophrenia. RESULTS: The ReHo metrics at all spatial scales effectively discriminated schizophrenia from healthy controls. Scale 2 showed the highest classification accuracy at 84.6%, followed by Scale 1 (83.1%) and Scale 3 (78.5%), while Scale 4 exhibited the lowest accuracy (74.2%). Furthermore, the transcriptome-neuroimaging association analysis showed that there were not only shared but also unique enriched biological processes across the four spatial scales. These related biological processes were mainly linked to immune responses, inflammation, synaptic signaling, ion channels, cellular development, myelination, and transporter activity. CONCLUSIONS: This study highlights the potential of multi-scale ReHo as a valuable neuroimaging biomarker in the diagnosis of schizophrenia. By elucidating the complex molecular basis underlying the ReHo alterations of this disorder, this study not only enhances our understanding of its pathophysiology, but also pave the way for future advancements in genetic diagnosis and treatment of schizophrenia.
Asunto(s)
Encéfalo , Imagen por Resonancia Magnética , Neuroimagen , Esquizofrenia , Transcriptoma , Humanos , Esquizofrenia/genética , Esquizofrenia/diagnóstico por imagen , Esquizofrenia/metabolismo , Femenino , Masculino , Adulto , Imagen por Resonancia Magnética/métodos , Encéfalo/diagnóstico por imagen , Encéfalo/metabolismo , Neuroimagen/métodos , Análisis Multivariante , Adulto Joven , Persona de Mediana Edad , Estudios de Cohortes , Biomarcadores/metabolismoRESUMEN
Two-dimensional (2D) Pd-based nanostructures with a high active surface area and a large number of active sites are commonly used in alcohol oxidation research, whereas the less explored ring structure made of nanosheets with large pores is of interest. In this study, we detail the fabrication of PdCu nanorings (NRs) featuring hollow interiors and low coordinated sites using a straightforward solvothermal approach. Due to increased exposure of active sites and the synergistic effects of bimetallics, the PdCu NRs exhibited superior catalytic performance in both the ethanol oxidation reaction (EOR) and the ethylene glycol oxidation reaction (EGOR). The mass activities of PdCu NRs for EOR and EGOR were measured at 7.05 A/mg and 8.12 A/mg, respectively, surpassing those of commercial Pd/C. Furthermore, the PdCu NRs demonstrated enhanced catalytic stability, maintaining higher mass activity levels compared to other catalysts during stability testing. This research offers valuable insights for the development of efficient catalysts for alcohol oxidation.
RESUMEN
Systolic blood pressure variability (SBPV) is associated with outcome in acute ischemic stroke. Remote ischemic conditioning (RIC) has been demonstrated to be effective in stroke and may affect blood pressure. Relationship between SBPV and RIC treatment after stroke warrants investigation. A total of 1707 patients from per-protocol analysis set of RICAMIS study were included. The SBPV was calculated based on blood pressure measured at admission, Day 7, and Day 12. (I) To investigate the effect of SBPV on efficacy of RIC in stroke, patients were divided into High and Low categories in each SBPV parameter. Primary outcome was excellent functional outcome at 90 days. Compared with Control, efficacy of RIC in each category and interaction between categories were investigated. (II) To investigate the effect of RIC treatment on SBPV, SBPV parameters were compared between RIC and Control groups. Compared with Control, a higher likelihood of primary outcome in RIC was found in high category (max-min: adjusted risk difference [RD] = 7.2, 95% CI 1.2-13.1, P = 0.02; standard deviation: adjusted RD = 11.5, 95% CI 1.6-21.4, P = 0.02; coefficient of variation: adjusted RD = 11.2, 95% CI 1.4-21.0, P = 0.03). Significant interaction of RIC on outcomes were found between High and Low standard deviations (adjusted P < 0.05). No significant difference in SBPV parameters were found between treatment groups. This is the first report that Chinese patients with acute moderate ischemic stroke and presenting with higher SBPV, who were non-cardioemoblic stroke and not candidates for intravenous thrombolysis or endovascular therapy, would benefit more from RIC with respect to functional outcomes at 90 days, but 2-week RIC treatment has no effect on SBPV during hospital.
Asunto(s)
Presión Sanguínea , Precondicionamiento Isquémico , Accidente Cerebrovascular Isquémico , Humanos , Masculino , Femenino , Presión Sanguínea/fisiología , Anciano , Accidente Cerebrovascular Isquémico/terapia , Accidente Cerebrovascular Isquémico/fisiopatología , Persona de Mediana Edad , Precondicionamiento Isquémico/métodos , Resultado del Tratamiento , Sístole/fisiologíaRESUMEN
Bacterial keratitis is among the most prevalent causes of blindness. Currently, the abuse of antibiotics in clinical settings not only lacks bactericidal effects but also readily induces bacterial resistance, making the clinical treatment of bacterial keratitis a significant challenge. In this study, we present an injectable hydrogel (GS-PNH-FF@CuS/MnS) containing self-assembled diphenylalanine dipeptide (FF) and CuS/MnS nanocomposites (CuS/MnS NCs) that destroy bacterial cell walls through a synergistic combination of mild photothermal therapy (PTT), chemodynamic therapy (CDT), ion release chemotherapy, and self-assembled dipeptide contact, thereby eliminating Pseudomonas aeruginosa. Under 808 nm laser irradiation, the bactericidal efficiency of GS-PNH-FF@CuS/MnS hydrogel against P. aeruginosa in vitro reach up to 96.97 %. Furthermore, GS-PNH-FF@CuS/MnS hydrogel is applied topically to kill bacteria, reduce inflammation, and promote wound healing. Hematoxylin-eosin (H&E) staining, Masson staining, immunohistochemistry and immunofluorescence staining are used to evaluate the therapeutic effect on infected rabbit cornea models in vivo. The GS-PNH-FF@CuS/MnS demonstrate good biocompatibility with human corneal epithelial cells and exhibit no obvious eyes side effects. In conclusion, the GS-PNH-FF@CuS/MnS hydrogel in this study provides an effective and safe treatment strategy for bacterial keratitis through a multimodal approach.
Asunto(s)
Alginatos , Antibacterianos , Gelatina , Hidrogeles , Queratitis , Pseudomonas aeruginosa , Queratitis/tratamiento farmacológico , Queratitis/microbiología , Hidrogeles/química , Animales , Antibacterianos/farmacología , Antibacterianos/química , Antibacterianos/administración & dosificación , Antibacterianos/uso terapéutico , Conejos , Pseudomonas aeruginosa/efectos de los fármacos , Gelatina/química , Alginatos/química , Humanos , Inyecciones , Terapia Fototérmica/métodosRESUMEN
INTRODUCTION: China is the largest tobacco consumer in the world, and tobacco poses a serious threat to the health of pregnant women. However, there are relatively few domestic studies on smoking during pregnancy and childbirth outcomes among pregnant women. The purpose of this study was to analyze the effect of active and passive smoking on pregnant women and their pregnancy outcomes, providing evidence and recommendations for intervention measures. METHODS: This was a cohort study in Shanghai from April 2021 to September 2023. According to the smoking status of pregnant women, they were divided into three groups: active smokers, passive smokers and non-smokers. A self-designed questionnaire was utilized to conduct the survey, and their pregnancy outcomes were tracked and followed up. RESULTS: A total of 3446 pregnant women were included in this study, among which 2.1% were active smokers, 43.5% were passive smokers, and 54.4% were non-smokers. The average age of the pregnant women was 29.9 years, and 41.2% had a university degree or higher. The education level of active smokers and passive smokers was significantly lower than that of non-smokers (p<0.05).The average gestational age of non-smokers was 38.6 weeks, and the birth weight was 3283.2 g, which was higher than those of active smokers and passive smokers (p<0.05). Logistic regression analysis showed that passive smoking increased the likelihood of preterm birth (AOR=1.38; 95% CI: 1.05-1.81), low birth weight (AOR=1.53; 95% CI: 1.10-2.12), and intrauterine growth restriction (AOR=1.35; 95% CI: 1.02-1.79), while active smoking increased the likelihood of preterm birth (AOR=2.98; 95% CI: 1.50-5.90), low birth weight (AOR=4.29; 95% CI: 2.07-8.88), intrauterine growth restriction (AOR=2.70; 95% CI: 1.37-5.33) , and birth defects (AOR=2.66; 95% CI: 1.00-6.97). CONCLUSIONS: Our findings illustrate that active and passive smoking can lead to adverse pregnancy outcomes. This study provides data on the relationship between smoking during pregnancy and delivery outcomes among pregnant women. In the future, we need more effective strategies to protect pregnant women from the harm of tobacco.
RESUMEN
By utilizing Metal-organic framework (MOF) materials as a base, constructing electrocatalysts with heterogeneous structures offers advantages for catalyzing water splitting. In this study, a hollow heterogeneous nanocatalyst, Ir-MIL-88A@NiFe-LDHs, was prepared by growing a layered double hydroxides (LDHs) shell on MIL-88A substrate. The catalyst shows excellent oxygen evolution reaction (OER) performance in a 1.0 M KOH solution, requiring only 217 mV overpotential to achieve a current density of 10 mA cm-2 with a Tafel slope of 62.18 mV dec-1, indicating significant electrocatalytic performance and reaction kinetics characteristics. Furthermore, long-term OER testing also demonstrates the catalyst's outstanding stability. Emphasizing the interfacial interaction between MOF and LDHs, as well as the synergistic effect among Ni, Fe, and Ir elements, the study highlights how these factors collaboratively control the local electronic structure of the hollow Ir-MIL-88A@NiFe-LDHs, resulting in an efficient MOF-derived electrocatalyst.
RESUMEN
Diabetes-related slow healing of wounds is primarily driven by bacterial infections and angiogenesis disorder and presents a substantial hurdle in clinical treatment. To solve the above problems, an advanced multifunctional hydrogel system based on natural polymer was created here to facilitate wound healing in patients with chronic diabetes. The prepared dressing was composed of an outer hydrogel containing polyvinyl alcohol and hydroxypropyl methyl cellulose in dimethyl sulfoxide and water as binary solvents, and an inner hydrogel containing chitosan quaternary ammonium salt, flaxseed gum, and polyvinyl alcohol. Thus, a polysaccharide based bilayer hydrogel (BH) with superior mechanical strength and biocompatibility was created. This bilayer hydrogel could easily bind to dynamic tissue surfaces, thereby generating a protective barrier. Meanwhile, L-arginine-modified polyoxometalate (POM@L-Arg) nanoclusters were loaded in the inner hydrogel. They released NO when stimulated by the peroxide microenvironment of diabetic wounds. NO as a signal molecule regulated vascular tension and promoted cell proliferation and migration. Additionally, because of the synergistic effect of NO and the chitosan quaternary ammonium salt, the hydrogel system exhibited excellent antibacterial performance. The NO released reduced the levels of proinflammatory factors IL-6 and TNF-α in the diabetic wounds, which thus accelerated wound healing. In short, BH + POM@L-Arg is expected to serve as an ideal wound dressing as it exerts a good promotion effect on diabetes-related wound healing.
Asunto(s)
Antibacterianos , Arginina , Hidrogeles , Derivados de la Hipromelosa , Compuestos de Tungsteno , Cicatrización de Heridas , Cicatrización de Heridas/efectos de los fármacos , Arginina/química , Arginina/farmacología , Hidrogeles/química , Hidrogeles/farmacología , Animales , Antibacterianos/farmacología , Antibacterianos/química , Compuestos de Tungsteno/química , Compuestos de Tungsteno/farmacología , Derivados de la Hipromelosa/química , Vendajes , Masculino , Humanos , Quitosano/química , Quitosano/farmacología , Proliferación Celular/efectos de los fármacos , Ratones , Diabetes Mellitus Experimental/tratamiento farmacológico , Ratas , Ratas Sprague-DawleyRESUMEN
Sugarcane is the main source of sugar worldwide, and 80% of the sucrose production comes from sugarcane. However, the genetic differentiation and basis of agronomic traits remain obscure. Here, we sequenced the whole-genome of 219 elite worldwide sugarcane cultivar accessions. A total of approximately 6 million high-quality genome-wide single nucleotide polymorphisms (SNPs) were detected. A genome-wide association study identified a total of 2198 SNPs that were significantly associated with sucrose content, stalk number, plant height, stalk diameter, cane yield, and sugar yield. We observed homozygous tendency of favor alleles of these loci, and over 80% of cultivar accessions carried the favor alleles of the SNPs or haplotypes associated with sucrose content. Gene introgression analysis showed that the number of chromosome segments from Saccharum spontaneum decreased with the breeding time of cultivars, while those from S. officinarum increased in recent cultivars. A series of selection signatures were identified in sugarcane improvement procession, of which 104 were simultaneously associated with agronomic traits and 45 of them were mainly associated with sucrose content. We further proposed that as per sugarcane transgenic experiments, ShN/AINV3.1 plays a positive role in increasing stalk number, plant height, and stalk diameter. These findings provide comprehensive resources for understanding the genetic basis of agronomic traits and will be beneficial to germplasm innovation, screening molecular markers, and future sugarcane cultivar improvement.
RESUMEN
OBJECTIVE: We performed a post hoc exploratory analysis of Remote Ischemic Conditioning for Acute Moderate Ischemic Stroke (RICAMIS) to determine whether hypertension history and baseline systolic blood pressure (SBP) affect the efficacy of remote ischemic conditioning (RIC). METHODS: Based on the full analysis set of RICAMIS, patients were divided into hypertension versus non-hypertension group, or <140 mmHg versus ≥140 mmHg group. Each group was further subdivided into RIC and control subgroups. The primary outcome was modified Rankin Scale (mRS) 0-1 at 90 days. Efficacy of RIC was compared among patients with hypertension versus nonhypertension history and SBP of <140 mmHg versus ≥140 mmHg. Furthermore, the interaction effect of treatment with hypertension and SBP was assessed. RESULTS: Compared with control group, RIC produced a significantly higher proportion of patients with excellent functional outcome in the nonhypertension group (RIC vs. control: 65.7% vs. 57.0%, OR 1.45, 95% CI 1.06-1.98; p = 0.02), but no significant difference was observed in the hypertension group (RIC vs. control: 69.1% vs. 65.2%, p = 0.17). Similar results were observed in SBP ≥140 mmHg group (RIC vs. control: 68.0% vs. 61.2%, p = 0.009) and SBP <140 mmHg group (RIC vs. control: 65.6% vs. 64.7%, p = 0.77). No interaction effect of RIC on primary outcome was identified. INTERPRETATION: Hypertension and baseline SBP did not affect the neuroprotective effect of RIC, but they were associated with higher probability of excellent functional outcome in patients with acute moderate ischemic stroke who received RIC treatment.
Asunto(s)
Presión Sanguínea , Hipertensión , Precondicionamiento Isquémico , Accidente Cerebrovascular Isquémico , Humanos , Hipertensión/terapia , Hipertensión/fisiopatología , Masculino , Femenino , Anciano , Persona de Mediana Edad , Accidente Cerebrovascular Isquémico/terapia , Accidente Cerebrovascular Isquémico/fisiopatología , Presión Sanguínea/fisiología , Precondicionamiento Isquémico/métodos , Anciano de 80 o más AñosRESUMEN
INTRODUCTION: Alcoholic liver disease (ALD) encompasses a spectrum of liver conditions, including liver steatosis, alcoholic hepatitis (AH), fibrosis, cirrhosis, and hepatocellular carcinoma (HCC). microRNAs (miRNAs) have garnered significant interest as potential biomarkers for ALD. METHODS: We searched PubMed, Embase, Web of Science and Cochrane Central Register of Controlled Trials (CENTRAL) systemically from inception to June 2024. All extracted data was stratified according to the stages of ALD. The vote-counting strategy performed a meta-analysis on miRNA expression profiles. RESULTS: We included 40 studies. In serum of individuals with alcohol-use vs. no alcohol-use, miRNA-122 and miRNA-155 were upregulated, and miRNA-146a was downregulated. In patients with ALD vs. healthy controls, miRNA-122 and miRNA-155 were also upregulated, and miRNA-146a was downregulated. However, in patients with AH vs. healthy individuals, only the serum miRNA-122 level was upregulated. Due to insufficient data on diagnostic accuracy, we failed to conclude the ability of miRNAs to distinguish between different stages of ALD-related liver fibrosis. The results for ALD-related HCC were also insufficient and controversial. CONCLUSIONS: Circulating miRNA-122 was the most promising biomarker to manage individuals with ALD. More studies were needed for the diagnostic accuracy of miRNAs in ALD. REGISTRATION: This protocol was registered on the International Prospective Register of Systematic Reviews (PROSPERO) (www.crd.york.ac.uk/prospero/) with registration number CRD42023391931.
Asunto(s)
Biomarcadores , Hepatopatías Alcohólicas , MicroARNs , Humanos , MicroARNs/sangre , MicroARNs/genética , Hepatopatías Alcohólicas/genética , Hepatopatías Alcohólicas/sangre , Biomarcadores/sangre , Carcinoma Hepatocelular/genética , Carcinoma Hepatocelular/sangre , Neoplasias Hepáticas/genética , Neoplasias Hepáticas/sangreRESUMEN
Spatial transcriptomics measures in situ gene expression at millions of locations within a tissue1, hitherto with some trade-off between transcriptome depth, spatial resolution and sample size2. Although integration of image-based segmentation has enabled impactful work in this context, it is limited by imaging quality and tissue heterogeneity. By contrast, recent array-based technologies offer the ability to measure the entire transcriptome at subcellular resolution across large samples3-6. Presently, there exist no approaches for cell type identification that directly leverage this information to annotate individual cells. Here we propose a multiscale approach to automatically classify cell types at this subcellular level, using both transcriptomic information and spatial context. We showcase this on both targeted and whole-transcriptome spatial platforms, improving cell classification and morphology for human kidney tissue and pinpointing individual sparsely distributed renal mouse immune cells without reliance on image data. By integrating these predictions into a topological pipeline based on multiparameter persistent homology7-9, we identify cell spatial relationships characteristic of a mouse model of lupus nephritis, which we validate experimentally by immunofluorescence. The proposed framework readily generalizes to new platforms, providing a comprehensive pipeline bridging different levels of biological organization from genes through to tissues.
Asunto(s)
Células , Perfilación de la Expresión Génica , Espacio Intracelular , Riñón , Transcriptoma , Animales , Femenino , Humanos , Ratones , Células/clasificación , Células/metabolismo , Modelos Animales de Enfermedad , Técnica del Anticuerpo Fluorescente , Perfilación de la Expresión Génica/métodos , Riñón/citología , Riñón/inmunología , Riñón/metabolismo , Riñón/patología , Nefritis Lúpica/genética , Nefritis Lúpica/inmunología , Nefritis Lúpica/metabolismo , Nefritis Lúpica/patología , Reproducibilidad de los Resultados , Espacio Intracelular/genética , Espacio Intracelular/metabolismoRESUMEN
Head and neck squamous cell carcinoma (HNSCC) represents the predominant malignancies in the head and neck region, and has limited therapeutic alternatives. Circular RNAs (circRNAs), a substantial category of non-coding RNA molecules, exert influential roles in human disease development and progression, employing various mechanisms such as microRNA sponging, interaction with RNA-binding proteins, and translational capabilities. Accumulating evidence highlights the differential expression of numerous circRNAs in HNSCC, and numerous dysregulated circRNAs underscore their crucial involvement in malignant advancement and resistance to treatment. This review aims to comprehensively outline the characteristics, biogenesis, and mechanisms of circRNAs, elucidating their functional significance in HNSCC. In addition, we delve into the clinical implications of circRNAs, considering their potential as biomarkers or targets for diagnosis, prognosis, and therapeutic applications in HNSCC. The discussion extends to exploring future challenges in the clinical translation of circRNAs, emphasizing the need for further research.