Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 290
Filtrar
Más filtros

Tipo del documento
Intervalo de año de publicación
1.
J Hand Surg Asian Pac Vol ; 29(3): 248-251, 2024 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-38726487

RESUMEN

Ectodermal dysplasia-syndactyly syndrome 1 (EDSS1) is an exceedingly rare condition associated with mutations in the PVL4 gene. It is characterised by sparse, brittle hair, eyebrows and eyelashes, abnormal dentition and nails, along with bilateral cutaneous syndactyly involving the fingers and toes. We report a 2-year-old girl who presented to us with bilateral complete simple syndactyly of the third and fourth web spaces of the hands, along with bilateral syndactyly of both feet involving the second to fourth toes. Upon examination, sparse hair and eyebrows, along with abnormal dentition, were noted. Thorough clinical examination and genetic analysis were conducted on the affected child and her father, who exhibited similar clinical features. Genetic analysis revealed a homozygous nonsense mutation in the PVL4 gene in both individuals. According to the literature, EDSS1 has been reported in only 10 families worldwide, and there are no reported cases from India. Level of Evidence: Level V (Therapeutic).


Asunto(s)
Displasia Ectodérmica , Sindactilia , Preescolar , Femenino , Humanos , Codón sin Sentido , Displasia Ectodérmica/genética , Displasia Ectodérmica/diagnóstico , Displasia Ectodérmica/patología , Sindactilia/genética , Sindactilia/diagnóstico , Sindactilia/patología
2.
Neoreviews ; 25(5): e282-e285, 2024 May 01.
Artículo en Inglés | MEDLINE | ID: mdl-38688887
3.
Surg Radiol Anat ; 46(4): 501-506, 2024 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-38310170

RESUMEN

INTRODUCTION: Fraser syndrome, named after George Fraser, is an autosomal recessive disorder showing a highly variable interfamilial phenotypic variation, with malformations ranging from minor symptoms to lethal anomalies like renal agenesis, incompatible with survival. Limb reduction defects have not been reported to be associated with it. CASE PRESENTATION: A 21-year-old primigravida presented to the antenatal outpatient department with a level two targeted anomaly scan report suggestive of severe oligohydramnios with suspected renal agenesis. The cranial vault bones were compressed, and orbital globes and lenses could not be visualized. Renal agenesis was confirmed due to sleeping adrenals sign, non-visualization of the urinary bladder, and Doppler of renal arteries. A detailed examination of the fetal head in the sagittal section showed the absence of an eye globe and lens, arousing suspicion of Fraser syndrome. After pregnancy termination, a complete fetal autopsy was done to look for any additional findings. CONCLUSION: Patients who have a syndromic mix of acrofacial and urogenital abnormalities with or without cryptophthalmos should be evaluated for Fraser syndrome, which can be diagnosed by clinical examination and perinatal autopsy.


Asunto(s)
Anomalías Múltiples , Anomalías Congénitas , Síndrome de Fraser , Enfermedades Renales/congénito , Riñón/anomalías , Sindactilia , Anomalías Urogenitales , Humanos , Femenino , Embarazo , Adulto Joven , Adulto , Síndrome de Fraser/diagnóstico , Sindactilia/diagnóstico , Anomalías Múltiples/diagnóstico , Variación Anatómica
4.
Neonatology ; 121(3): 388-395, 2024.
Artículo en Inglés | MEDLINE | ID: mdl-38211567

RESUMEN

INTRODUCTION: Timothy syndrome (TS) is an extremely rare, multisystem disorder classically associated with long QT, syndactyly, ventricular arrhythmias, and hypoglycaemia. A neonatal diagnosis allows maximal medical and device therapy to be implemented to avoid malignant arrhythmias and sudden cardiac death. METHODS: This was a retrospective case series study of type I TS (TS1) patients using data from the Timothy Syndrome Foundation's international registry, encompassing patients with a genetic diagnosis (CACNA1C variant G406R in exon 8A) recruited over a 28-year period. RESULTS: Forty-four cases of TS1 were included (26 male; 60%). Mean gestational age (GA) was 35.6 weeks (range 28 weeks - term), with 43% of patients born less than 37 weeks GA. In TS1 patients presenting with foetal bradycardia, mean GA was significantly lower (34.2 weeks, p < 0.05). Foetal bradycardia secondary to atrioventricular block was present in 20 patients (45%), resulting in premature delivery in 14 patients (32%). Fifteen patients (34%) were diagnosed with TS1 as neonates. Long QT at birth helped secure a diagnosis in 25 patients (57%). Syndactyly was seen in most patients (n = 40, 91%). Twenty patients died, with an average age of death of 2.3 years (range 1 month-6 years). Of the 7 patients who died before the first year of life (16%), the average age of death was 2.5 months. CONCLUSION: TS is associated with high early mortality. TS should be considered in paediatric patients presenting with long QT and syndactyly. Recognition of TS in the neonatal period allows for early intervention to prevent life-threatening arrhythmias.


Asunto(s)
Trastorno Autístico , Edad Gestacional , Síndrome de QT Prolongado , Sindactilia , Humanos , Femenino , Masculino , Estudios Retrospectivos , Recién Nacido , Sindactilia/genética , Sindactilia/diagnóstico , Síndrome de QT Prolongado/diagnóstico , Síndrome de QT Prolongado/terapia , Síndrome de QT Prolongado/mortalidad , Síndrome de QT Prolongado/complicaciones , Trastorno Autístico/complicaciones , Trastorno Autístico/diagnóstico , Trastorno Autístico/epidemiología , Sistema de Registros , Lactante , Bradicardia/terapia , Bradicardia/diagnóstico , Bradicardia/etiología , Bloqueo Atrioventricular/terapia , Bloqueo Atrioventricular/diagnóstico , Bloqueo Atrioventricular/etiología , Bloqueo Atrioventricular/mortalidad , Canales de Calcio Tipo L
5.
Am J Med Genet A ; 194(1): 94-99, 2024 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-37646430

RESUMEN

The gene CDH11 encodes cadherin-11, a Type II cadherin superfamily member that contains five extracellular cadherin (EC) domains. Cadherin-11 undergoes trans-dimerization via the EC1 domain to generate cadherin complexes. Compound heterozygous and homozygous loss-of-function CDH11 variants are observed in Elsahy-Waters syndrome (EWS), which shows characteristic craniofacial features, vertebral abnormalities, cutaneous syndactyly in 2-3 digits, genitourinary anomalies, and intellectual disability. Heterozygous CDH11 variants can cause Teebi hypertelorism syndrome (THS), which features widely spaced eyes and hypospadias. We report a THS patient with a novel CDH11 variant involving the EC1 domain. The patient was a 10-month-old male with normal developmental milestones, but had widely spaced eyes, strabismus, hypospadias, shawl scrotum, broad thumbs (right bifid thumb in x-ray), polysyndactyly of the left fourth finger, and cutaneous syndactyly of left third/fourth fingers. Exome sequencing identified a de novo heterozygous CDH11 variant (NM_001797.4:c.229C > T [p.Leu77Phe] NC_000016.9:g.64998856G > A). Clinical features were consistent with previously reported THS patients, but polysyndactyly, broad thumb, and cutaneous syndactyly overlapped phenotypic features of EWS. THS and EWS may represent a spectrum of CDH11-related disorders. Residue Leu77 in this novel CDH11 variant lines a large hydrophobic pocket where side chains of the partner cadherin-11 insert to trans-dimerize, suggesting that the cadherin-11 structure might be altered in this variant.


Asunto(s)
Anomalías Múltiples , Hipertelorismo , Hipospadias , Sindactilia , Humanos , Masculino , Lactante , Anomalías Múltiples/diagnóstico , Anomalías Múltiples/genética , Japón , Hipertelorismo/genética , Cadherinas/genética , Sindactilia/diagnóstico , Sindactilia/genética
6.
Mol Genet Genomic Med ; 12(1): e2319, 2024 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-38013226

RESUMEN

BACKGROUND: Cenani-Lenzsyndactyly syndrome (CLSS; OMIM 212780) is a rare autosomal recessive acral deformity, which is mainly manifested in the fusion of fingers or toes, disordered phalangeal structure, shortening or fusion of the radius and ulna, and renal hypoplasia. CASE PRESENTATION: Our report described an individual with mild phenotypes from China. His parents were not consanguineous. The affected individual was non-dysmorphic. Standard X-ray showed that the both hands have only four metacarpal bones. The distal end of the first metacarpal bone on the right was relatively slender, and the distal phalanx was absent. Multiple phalanges and some soft tissues of both hands were fused. Exome sequencing revealed a novel biallelic c.282C⟩Avariant in low-density lipoprotein receptor-related protein 4 (LRP4; OMIM604270; NM_002334.4) causing p. (Asn94Lys) change in the encoded protein. This variant is predicted to be potentially pathogenic, affecting protein structure and function. CONCLUSION: We report a novel missense variant present in homozygosity in LRP4 to broaden the pathogenic spectrum of LRP4 in syndactyly, and exome sequencing technology is a powerful tool for genetic analysis in prenatal diagnosis and medical research, as a preferred method for the diagnosis of syndactyly and related phenotypes.


Asunto(s)
Proteínas Relacionadas con Receptor de LDL , Sindactilia , Humanos , Mutación , Proteínas Relacionadas con Receptor de LDL/genética , Proteínas Relacionadas con Receptor de LDL/metabolismo , Sindactilia/genética , Sindactilia/diagnóstico , Mutación Missense
7.
Am J Cardiol ; 200: 13-17, 2023 08 01.
Artículo en Inglés | MEDLINE | ID: mdl-37271119

RESUMEN

Long QT syndrome (LQTS) 8 is a rare inherited channelopathy caused by CACNA1C gene mutations that affects calcium channels, and when combined with congenital heart defects, musculoskeletal defects, and neurodevelopmental defects, it is referred to as Timothy syndrome. A female patient, aged 17 years, presented with a witnessed episode of syncope secondary to ventricular fibrillation that was successfully cardioverted. Electrocardiogram showed sinus bradycardia 52/min, normal axis, and a QTc of 626 ms. In the hospital, she had another episode of asystole and Torsade de pointes and underwent successful cardiopulmonary resuscitation. Echocardiogram showed severely reduced left ventricular systolic function from postcardiac arrest myocardial dysfunction and no congenital heart defects. Long QT genetic test detected a missense mutation in the CACNA1C gene (NM_199460.3, variant c.2573G>A, p Arg858His, heterozygous, autosomal dominant), resulting in replacement of arginine with histidine at position 858(R858H), leading to the gain of function in the L-type calcium channel. Given the absence of congenital cardiac defects, musculoskeletal deformities, or neurodevelopmental delay a final diagnosis of LQTS subtype 8 was made. A cardioverter defibrillator was implanted. In conclusion, our case highlights the importance of genetic testing in the diagnosis of LQTS. Some CACNA1C mutations, such as R858H described here, cause LQTS without the extracardiac manifestations observed in classic Timothy syndrome and should be included in the genetic testing for LQTS. To the best of our knowledge, our case is the first one from United States with the R585H mutation. Three cases with similar mutations have been reported from Japan and one from New Zealand.


Asunto(s)
Cardiopatías Congénitas , Síndrome de QT Prolongado , Sindactilia , Humanos , Femenino , Síndrome de QT Prolongado/diagnóstico , Síndrome de QT Prolongado/genética , Síndrome de QT Prolongado/terapia , Pruebas Genéticas , Sindactilia/complicaciones , Sindactilia/diagnóstico , Sindactilia/genética , Mutación , Cardiopatías Congénitas/complicaciones , Cardiopatías Congénitas/diagnóstico , Cardiopatías Congénitas/genética , Electrocardiografía
9.
Am J Med Genet A ; 191(1): 64-69, 2023 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-36208065

RESUMEN

ERI1 is an evolutionary conserved 3'-5' exonuclease with an important function in multiple RNA processing pathways. Although the molecular mechanisms in which ERI1 is involved have been studied extensively in model organisms, the pathology associated with ERI1 variants in humans has remained elusive because no case has been reported so far. Here, we present a case of a female patient with a homozygous nonsense variant in ERI1 gene. The patient exhibits mild intellectual disability, eyelid ptosis, and anomalies in her hands and feet (brachydactyly, clinodactyly, dysplastic/short nail of halluces, brachytelephalangy, short metacarpals, and toe syndactyly). This case report is the first of its kind and is invaluable for understanding ERI1 pathology in humans.


Asunto(s)
Braquidactilia , Discapacidad Intelectual , Deformidades Congénitas de las Extremidades , Sindactilia , Humanos , Femenino , Deformidades Congénitas de las Extremidades/diagnóstico , Deformidades Congénitas de las Extremidades/genética , Sindactilia/diagnóstico , Sindactilia/genética , Discapacidad Intelectual/diagnóstico , Discapacidad Intelectual/genética , Síndrome , Exorribonucleasas/genética
10.
Medicine (Baltimore) ; 101(42): e31237, 2022 Oct 21.
Artículo en Inglés | MEDLINE | ID: mdl-36281136

RESUMEN

RATIONALE: Triphalangeal thumb (TPT) is a rare congenital malformation where the thumb has three phalanges instead of two. Syndactyly is a condition in which children are born with fused or webbed fingers. The combination of TPT, Syndactyly, and thumb duplication is extremely rare, especially when these deformities are combined in one hand. PATIENT CONCERNS: Hand abnormalities and polydactyl have been reported in a 1-year-old boy. DIAGNOSIS: A clinical examination reveals two thumb duplications, finger fusion (Syndactyly), and a thumb with three phalanges (TPT). The diagnosis was based on clinical findings and an X-ray image of the hand. INTERVENTIONS: The Z-plasty method was used to remove the adhesion between the thumb and forefinger, as well as the removal of the medial and distal phalanx of the thumb's medial tip. OUTCOMES: The patient was followed for 2 months and found him in good health. To authors' knowledge, we described an unusual case from Syria, considered the first in medical history. LESSONS LEARNED: General and plastic surgeons should be aware about this unusual mix of the three abnormalities. The family history must also be carefully investigated to explore the occurrence of hereditary illnesses.


Asunto(s)
Deformidades Congénitas de la Mano , Polidactilia , Sindactilia , Humanos , Masculino , Niño , Lactante , Pulgar/cirugía , Pulgar/anomalías , Sindactilia/diagnóstico , Sindactilia/genética , Sindactilia/cirugía , Deformidades Congénitas de la Mano/diagnóstico por imagen , Deformidades Congénitas de la Mano/genética , Polidactilia/diagnóstico , Polidactilia/cirugía
11.
Am J Med Genet A ; 188(11): 3236-3241, 2022 11.
Artículo en Inglés | MEDLINE | ID: mdl-36073773

RESUMEN

The term symbrachydactyly has been used for the phenotype of two or three short fingers or toes, hypoplasia of the middle and distal phalanges and variable syndactyly of the affected digits. Some clinicians have extended this diagnosis to include other phenotypes, specifically cleft hand, terminal transverse limb defects, hypoplasia of the thumb and fifth finger with nubbins for fingers 2, 3, and 4 and the hand deformity of the Poland anomaly. A malformations surveillance program can identify enough affected infants to characterize a phenotype. In the Active Malformations Surveillance Program in Boston (1972-2012) among 289,365 births, all infants and fetuses with structural abnormalities were identified from reading the examination findings by the pediatricians and pathologists and the results of diagnostic tests. Liveborn and stillborn infants were included, as well as fetuses from elective terminations because of anomalies identified in prenatal testing. We present the findings in 14 infants, all liveborn, who had symbrachydactyly of one or both hands (n = 12) or feet (n = 2). We suggest restricting the term symbrachydactyly to this single phenotype to improve counseling and to focus future research on identifying the cause(s).


Asunto(s)
Falanges de los Dedos de la Mano , Deformidades Congénitas de la Mano , Sindactilia , Femenino , Falanges de los Dedos de la Mano/anomalías , Dedos/anomalías , Deformidades Congénitas de la Mano/diagnóstico , Deformidades Congénitas de la Mano/epidemiología , Deformidades Congénitas de la Mano/genética , Humanos , Embarazo , Sindactilia/diagnóstico , Sindactilia/genética , Dedos del Pie/anomalías
12.
Int J Mol Sci ; 23(15)2022 Jul 22.
Artículo en Inglés | MEDLINE | ID: mdl-35897673

RESUMEN

The voltage-dependent L-type calcium channel isoform CaV1.2 is critically involved in many physiological processes, e.g., in cardiac action potential formation, electromechanical coupling and regulation of insulin secretion by beta cells. Gain-of-function mutations in the calcium voltage-gated channel subunit alpha 1 C (CACNA1C) gene, encoding the CaV1.2 α1-subunit, cause Timothy syndrome (TS), a multisystemic disorder that includes autism spectrum disorders and long QT (LQT) syndrome. Strikingly, TS patients frequently suffer from hypoglycemia of yet unproven origin. Using next-generation sequencing, we identified a novel heterozygous CACNA1C mutation in a patient with congenital hyperinsulinism (CHI) and associated hypoglycemic episodes. We characterized the electrophysiological phenotype of the mutated channel using voltage-clamp recordings and in silico action potential modeling experiments. The identified CaV1.2L566P mutation causes a mixed electrophysiological phenotype of gain- and loss-of-function effects. In silico action potential modeling supports that this mixed electrophysiological phenotype leads to a tissue-specific impact on beta cells compared to cardiomyocytes. Thus, CACNA1C variants may be associated with non-syndromic hyperinsulinemic hypoglycemia without long-QT syndrome, explained by very specific electrophysiological properties of the mutated channel. We discuss different biochemical characteristics and clinical impacts of hypoglycemia in the context of CACNA1C variants and show that these may be associated with significant morbidity for Timothy Syndrome patients. Our findings underline that the potential of hypoglycemia warrants careful attention in patients with CACNA1C variants, and such variants should be included in the differential diagnosis of non-syndromic congenital hyperinsulinism.


Asunto(s)
Hiperinsulinismo Congénito , Síndrome de QT Prolongado , Sindactilia , Trastorno Autístico , Canales de Calcio Tipo L/genética , Hiperinsulinismo Congénito/genética , Humanos , Mutación , Sindactilia/diagnóstico , Sindactilia/genética
13.
J Pak Med Assoc ; 72(5): 975-977, 2022 May.
Artículo en Inglés | MEDLINE | ID: mdl-35713069

RESUMEN

Fibular aplasia, tibial campomelia, and oligosyndactyly (FATCO syndrome) is a rare, genetic, congenital limb malformation characterised by unilateral or bilateral fibular aplasia, tibial campomelia, and lower limb oligosyndactyly involving the lateral rays. A newborn male born at term via a Caesarean Section presented with malformations consisting of tibial campomelia, unilateral fibular hypoplasia, and oligosyndactyly, a "FATCO variant" case. On radiographic examination, an anterolateral shortened and bowed right lower limb at the distal third of the tibia, a rudimentary right fibula and absence of three rays on right foot were revealed. "FATCO syndrome" although rare may be linked to involvement of different body systems with morbidity and mortality. Proper parent counseling is a key aspect of this syndrome. Timely diagnosis and management with a multidisciplinary approach is essential to avoid lifelong disability, which can be a hurdle in a developing country.


Asunto(s)
Displasia Campomélica , Sindactilia , Displasia Campomélica/diagnóstico , Displasia Campomélica/terapia , Cesárea , Femenino , Peroné/anomalías , Peroné/diagnóstico por imagen , Dedos/anomalías , Deformidades Congénitas del Pie , Deformidades Congénitas de la Mano , Humanos , Lactante , Recién Nacido , Masculino , Embarazo , Sindactilia/diagnóstico , Sindactilia/genética , Síndrome , Tibia/anomalías , Tibia/diagnóstico por imagen , Dedos del Pie/anomalías
14.
Orphanet J Rare Dis ; 17(1): 198, 2022 05 12.
Artículo en Inglés | MEDLINE | ID: mdl-35549993

RESUMEN

The formation of the digits is a tightly regulated process. During embryogenesis, disturbance of genetic pathways in limb development could result in syndactyly; a common congenital malformation consisting of webbing in adjacent digits. Currently, there is a paucity of knowledge regarding the exact developmental mechanism leading to this condition. The best studied canonical interactions of Wingless-type-Bone Morphogenic Protein-Fibroblast Growth Factor (WNT-BMP-FGF8), plays a role in the interdigital cell death (ICD) which is thought to be repressed in human syndactyly. Animal studies have displayed other pathways such as the Notch signaling, metalloprotease and non-canonical WNT-Planar cell polarity (PCP), to also contribute to failure of ICD, although less prominence has been given. The current diagnosis is based on a clinical evaluation followed by radiography when indicated, and surgical release of digits at 6 months of age is recommended. This review discusses the interactions repressing ICD in syndactyly, and characterizes genes associated with non-syndromic and selected syndromes involving syndactyly, according to the best studied canonical WNT-BMP-FGF interactions in humans. Additionally, the controversies regarding the current syndactyly classification and the effect of non-coding elements are evaluated, which to our knowledge has not been previously highlighted. The aim of the review is to better understand the developmental process leading to this condition.


Asunto(s)
Sindactilia , Animales , Extremidades/patología , Factores de Crecimiento de Fibroblastos , Humanos , Transducción de Señal/genética , Sindactilia/diagnóstico , Sindactilia/genética , Sindactilia/patología
15.
J Hum Genet ; 67(1): 43-49, 2022 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-34321610

RESUMEN

Syndactyly is the most common limb defect depicting the bony and/or cutaneous fusion of digits. Syndactyly can be of various types depending on the digits involved in the fusion. To date, eight syndactyly-associated genes have been reported, of which HOXD13 and GJA1 have been explored in a few syndactyly but most of them have unknown underlying genetics. In the present study HOXD13, GJA1 and TP63 genes have been screened by resequencing in 24 unrelated sporadic cases with various syndactyly. The screening revealed two pathogenic HOXD13 variants, NM_000523:c.500 A > G [p.(Y167C)], and NM_000523:c.961 A > C [p.(T321P)] in syndactyly type 1b and type 1c, respectively. This is the first report to identify HOXD13 pathogenic variant in syndactyly type 1b and third report in syndactyly type 1c pathogenesis. Furthermore, this study also reports a TP63 pathogenic variant, NM_003722:c.953 G > A [p.(R318H)] in Ectrodactyly and Cleft lip and palate (ECLP). In conclusion, the current study expands the clinical spectrum of HOXD13 and TP63-related disorders.


Asunto(s)
Predisposición Genética a la Enfermedad , Proteínas de Homeodominio/genética , Mutación , Fenotipo , Sindactilia/diagnóstico , Sindactilia/genética , Factores de Transcripción/genética , Proteínas Supresoras de Tumor/genética , Alelos , Estudios de Asociación Genética , Genotipo , Humanos
17.
Rev Med Liege ; 76(10): 715-718, 2021 Oct.
Artículo en Francés | MEDLINE | ID: mdl-34632738

RESUMEN

Apert syndrome, or acrocephalosyndactilia type I, is a rare genetic disorder caused by mutations in the FGFR2 gene and characterized by craniosynostosis, craniofacial dysmorphia and symmetrical syndactyly of the hands and feet. The estimated prevalence of this syndrome is 10 to 15.5 cases per 1,000,000 live births. This syndrome presents significant clinical variability and its early diagnosis is essential. We report an isolated case of Apert syndrome, diagnosed during follow-up of a biamniotic bichorium twin pregnancy.


Le syndrome d'Apert, ou acrocéphalosyndactilie de type I, est une maladie génétique rare causée par des mutations du gène FGFR2 et caractérisé par une craniosténose, une dysmorphie cranio-faciale et une syndactylie symétrique des mains et des pieds. La prévalence estimée de ce syndrome est de 10 à 15,5 cas pour 1.000.000 de naissances vivantes. Ce syndrome présente des variabilités cliniques importantes et son diagnostic précoce est essentiel. Nous rapportons un cas isolé de syndrome d'Apert, diagnostiqué en période prénatale, au cours d'un suivi d'une grossesse gémellaire bichoriale biamniotique.


Asunto(s)
Acrocefalosindactilia , Craneosinostosis , Sindactilia , Acrocefalosindactilia/diagnóstico , Acrocefalosindactilia/genética , Femenino , Humanos , Mutación , Embarazo , Receptor Tipo 2 de Factor de Crecimiento de Fibroblastos , Sindactilia/diagnóstico , Sindactilia/genética
18.
Clin Genet ; 100(6): 758-765, 2021 12.
Artículo en Inglés | MEDLINE | ID: mdl-34482537

RESUMEN

Loss of function variants of GLI3 are associated with a variety of forms of polysyndactyly: Pallister-Hall syndrome (PHS), Greig-Cephalopolysyndactyly syndrome (GCPS), and isolated polysyndactyly (IPD). Variants affecting the N-terminal and C-terminal thirds of the GLI3 protein have been associated with GCPS, those within the central third with PHS. Cases of IPD have been attributed to variants affecting the C-terminal third of the GLI3 protein. In this study, we further investigate these genotype-phenotype correlations. Sequencing of GLI3 was performed in patients with clinical findings suggestive of a GLI3-associated syndrome. Additionally, we searched the literature for reported cases of either manifestation with mutations in the GLI3 gene. Here, we report 48 novel cases from 16 families with polysyndactyly in whom we found causative variants in GLI3 and a review on 314 previously reported GLI3 variants. No differences in location of variants causing either GCPS or IPD were found. Review of published data confirmed the association of PHS and variants affecting the GLI3 protein's central third. We conclude that the observed manifestations of GLI3 variants as GCPS or IPD display different phenotypic severities of the same disorder and propose a binary division of GLI3-associated disorders in either PHS or GCPS/polysyndactyly.


Asunto(s)
Mutación , Proteínas del Tejido Nervioso/genética , Fenotipo , Dominios y Motivos de Interacción de Proteínas/genética , Sindactilia/diagnóstico , Sindactilia/genética , Proteína Gli3 con Dedos de Zinc/genética , Alelos , Sustitución de Aminoácidos , Femenino , Estudios de Asociación Genética , Predisposición Genética a la Enfermedad , Genotipo , Humanos , Masculino , Proteínas del Tejido Nervioso/química , Linaje , Radiografía , Proteína Gli3 con Dedos de Zinc/química
19.
Dev Dyn ; 250(9): 1220-1228, 2021 09.
Artículo en Inglés | MEDLINE | ID: mdl-33533119

RESUMEN

BACKGROUND: Polydactyly and syndactyly are the most common hereditary limb malformations. Molecular genetic testing is of great significance for hereditary limb malformations, which can establish prognosis and recurrence risk of surgical intervention. METHODS: The present study aimed to identify the genetic etiologies of a three-generation family with postaxial polydactyly and a four-generation family with postaxial syndactyly. Whole exome sequencing was used, followed by standard mutation screening procedure, Sanger sequencing and bioinformatics analysis. RESULTS: Two nonframeshifting insertion/deletion (indel) mutations in HOXD13 (c.206_207ins AGCGGCGGCTGCGGCGGCGGCGGC:p.A68insAAAAAAAA or c.171_182delGGCGGCGGCGGC: p.56_60delAAAA) were successfully identified as the pathogenic mutation. The two nonframeshifting indel mutations led to truncation or expansion of homopolymeric alanine (Poly-Ala) repeats of HOXD13 proteins. Sequence alignment of HOXD13 protein among many different species for Poly-Ala position is highly conserved. Hypothetical three-dimensional (3-D) structural analysis further showed mutant HOXD13 proteins (p.A68insAAAAAAAA and p.56_60delAAAA) converted the disordered fragment into a short ß-strand (residues 63-68 or residues 64-68), thereby forming a conformational change. CONCLUSIONS: The present study identified two nonframeshifting mutations of HOXD13 polyalanine repeat location in two Chinese families with postaxial polydactyly or postaxial syndactyly. Our results also provide new insights into genetic counseling and clinical management.


Asunto(s)
Mutación INDEL , Sindactilia , China , Proteínas de Homeodominio/genética , Humanos , Mutación , Linaje , Péptidos , Sindactilia/diagnóstico , Sindactilia/genética , Sindactilia/patología , Factores de Transcripción/genética
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA