Cellular migration into a subretinal honeycomb-shaped prosthesis for high-resolution prosthetic vision.

In patients blinded by geographic atrophy, a subretinal photovoltaic implant with 100 µm pixels provided visual acuity closely matching the pixel pitch. However, such flat bipolar pixels cannot be scaled below 75 µm, limiting the attainable visual acuity. This limitation can be overcome by shaping the electric field with 3-dimensional (3-D) electrodes. In particular, elevating the return electrode on top of the honeycomb-shaped vertical walls surrounding each pixel extends the electric field vertically and decouples its penetration into tissue from the pixel width. This approach relies on migration of the retinal cells into the honeycomb wells. Here, we demonstrate that majority of the inner retinal neurons migrate into the 25 µm deep wells, leaving the third-order neurons, such as amacrine and ganglion cells, outside. This enables selective stimulation of the second-order neurons inside the wells, thus preserving the intraretinal signal processing in prosthetic vision. Comparable glial response to that with flat implants suggests that migration and separation of the retinal cells by the walls does not cause additional stress. Furthermore, retinal migration into the honeycombs does not negatively affect its electrical excitability, while grating acuity matches the pixel pitch down to 40 µm and reaches the 27 µm limit of natural resolution in rats with 20 µm pixels. These findings pave the way for 3-D subretinal prostheses with pixel sizes of cellular dimensions.

Phase Engineering of Zirconium MOFs Enables Efficient Osmotic Energy Conversion: Structural Evolution Unveiled by Direct Imaging.

Creating structural defects in a controlled manner within metal-organic frameworks (MOFs) poses a significant challenge for synthesis, and concurrently, identifying the types and distributions of these defects is also a formidable task for characterization. In this study, we demonstrate that by employing 2-sulfonylterephthalic acid as the ligand for synthesizing Zr (or Hf)-based MOFs, a crystal phase transformation from the common fcu topology to the rare jmt topology can be easily facilitated using a straightforward mixed-solvent strategy. The jmt phase, characterized by an extensively open framework, can be considered a derivative of the fcu phase, generated through the introduction of missing-cluster defects. We have explicitly identified both MOF phases, their intermediate states, and the novel core-shell structures they form using ultralow-dose high-resolution transmission electron microscopy. In addition to facilitating phase engineering, the incorporation of sulfonic groups in MOFs imparts ionic selectivity, making them applicable for osmotic energy harvesting through mixed matrix membrane fabrication. The membrane containing the jmt-phase MOF exhibits an exceptionally high peak power density of 10.08 W m-2 under a 50-fold salinity gradient (NaCl: 0.5 M|0.01 M), which surpasses the threshold of 5 W m-2 for commercial applications and can be attributed to the combination of large pore size, extensive porosity, and abundant sulfonic groups in this novel MOF material.

Endoscopic transnasal and transoral resection of the odontoid process and C1 combined with occipitocervical fusion for osteoradionecrosis of the upper cervical spine: a case report and literature review.

BACKGROUND: Osteoradionecrosis (ORN) of the upper cervical spine is a rare but severe complication of head and neck cancer radiotherapy. To raise awareness of this condition, we describe a patient with a history of nasopharyngeal carcinoma who developed ORN of the upper cervical spine and review the published literature reporting surgical management. CASE PRESENTATION: A 59-year-old female patient with persistent neck pain for one month and limited range of neck motion who had undergone radiotherapy for nasopharyngeal carcinoma with a total dose of 69.96 Gy 15 years ago presented to our hospital. The patient underwent endoscopic transnasal and transoral resection of the odontoid process and C1 anterior arch, combined with occipitocervical fusion. To better understand surgical management of ORN of the upper cervical spine, the literature published in the PubMed, Ovid MEDLINE, and Embase databases was reviewed. Our patient experienced alleviation of cervical pain and did not exhibit any postoperative complications. Since 2005, 11 cases of surgical management of ORN of the upper cervical spine (including the present case) have been published. Basilar invagination and/or atlantoaxial subluxation were observed in 4 /11 cases. Endoscopic procedures were performed in 4/11 cases, and occipitocervical fusion was performed in 8 /11 cases. CONCLUSION: Endoscopic transnasal and transoral resection of the odontoid process and C1 anterior arch is a safe and effective treatment option for ORN of the upper cervical spine. Occipitocervical fusion is useful in patients with basilar invagination and atlantoaxial subluxation.

Chiral Metal-Organic Frameworks.

In the past two decades, metal-organic frameworks (MOFs) or porous coordination polymers (PCPs) assembled from metal ions or clusters and organic linkers via metal-ligand coordination bonds have captivated significant scientific interest on account of their high crystallinity, exceptional porosity, and tunable pore size, high modularity, and diverse functionality. The opportunity to achieve functional porous materials by design with promising properties, unattainable for solid-state materials in general, distinguishes MOFs from other classes of materials, in particular, traditional porous materials such as activated carbon, silica, and zeolites, thereby leading to complementary properties. Scientists have conducted intense research in the production of chiral MOF (CMOF) materials for specific applications including but not limited to chiral recognition, separation, and catalysis since the discovery of the first functional CMOF (i.e., d- or l-POST-1). At present, CMOFs have become interdisciplinary between chirality chemistry, coordination chemistry, and material chemistry, which involve in many subjects including chemistry, physics, optics, medicine, pharmacology, biology, crystal engineering, environmental science, etc. In this review, we will systematically summarize the recent progress of CMOFs regarding design strategies, synthetic approaches, and cutting-edge applications. In particular, we will highlight the successful implementation of CMOFs in asymmetric catalysis, enantioselective separation, enantioselective recognition, and sensing. We envision that this review will provide readers a good understanding of CMOF chemistry and, more importantly, facilitate research endeavors for the rational design of multifunctional CMOFs and their industrial implementation.

First Report of Meloidogyne incognita on Coral dealbatus in Shaanxi, China.

Coral dealbatus belonging to Crassulaceae, is a new kind of health care vegetable as both medicine and food (Qin et al., 2022). Because of its obvious health care function, C. dealbatus was widely cultivated in China and market demand increased quickly. In August of 2022, a large number of C. dealbatus showed the symptoms of stunting and leaf yellowing in Dali county, Weinan, Shaanxi province, China (109°43'E, 34°36'N). Many galls were observed on the roots of infected plants, and females were observed under the plant epidermis. Infected roots and soil samples were collected, the females, males and second-stage juveniles (J2s) were isolated. The female had a spherical body with a protruding neck, the stylet of females was slender and curved toward the back slightly. The perineal pattern of female (n=20) was round or elliptical, with high and squared dorsal arch, without obvious lateral lines. Morphological measurements of females (n=20): body length (L)=782.09±54.54 ( 518.52 to 1137.76) µm, body width (W)=439.51±19.23 (336.51 to 551.74 ) µm, stylet length (ST)=15.39±0.67 (12.55 to 18.80) µm, stylet knob height (STKH)=2.02±0.09 (1.88 to 2.46) µm, stylet knob width (STKW)=3.69±0.15 (2.91to 4.58) µm, distance from dorsal esophageal gland orifice to base of stylet (DGO)=2.32±0.17 (1.77 to 3.48) µm, vulval slit length (V)=23.99±0.75 (20.71 to 28.83) µm, and vulval slit to anus distance (V') = 18.62±0.55 (14.95 to 21.20) µm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and had blunt tail that bended slightly towards the abdomen, stylet knobs were prominent, speculum were in pairs and acicular. Measurements of females (n=10) were: L=1377.82±198.09 (1040.66 to 1726.59) µm, W=37.32±4.49 (28.35 to 41.90) µm, ST=21.48±1.23 (19.69 to 23.51) µm, STKH=2.99±0.12 (2.82 to 3.23) µm, STKW=5.34±0.41 (4.64 to 6.06) µm, DGO=2.54±0.13 (2.31 to 2.77) µm. J2s had the following characteristics: L=435.57±40.75 (414.92 to 462.14) µm, W=16.73±2.62 (12.76 to 21.95) µm, ST=12.66±1.02 (10.68 to 14.76) µm, STKH=1.58±0.29 (1.07 to 1.98) µm, STKW=2.22±0.38 (1.63 to 2.70) µm, DGO=2.26±0.18 (2.03 to 2.70) µm, tail length(T)= 87.97±9.71 (72.98 to 92.53) µm, hyaline tail terminus (HT) = 12.44±2.21 (9.59 to 13.90) µm. The nematode had uniform morphological characteristics with Meloidogyne incognita (Orton Williams, 1973). DNA was extracted from ten single females, and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for identification of M. incognita (Kiewnick et al., 2013), and a 300bp fragment was amplified by this pair of primers, confirming the nematode was M. incognita. 18S rDNA gene was amplified using the primer pair 18S/26S (TTTCACTCGCCGTTACTAAGG/TTGATTACGTCCCTGCCCTTT) (Vrain et al.,1992), and the sequence was submitted to GenBank (GenBank Accession No. OR477177). Sequence aligment was conducted and showed 100% identical with the known sequence of M. incognita (GenBank Accession Nos. MH113856 and OQ269709). The result of identification was also confirmed by amplifying the sequence of NADH dehydrogenase subunit 5 (nad5) from mitochondrial DNA region using primers: NAD5-F/R(TATTTTTTGTTTGAGATATATTAG/TCGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A611bp fragment was amplified and the sequence (GenBank Accession No. OR520436) showed 100% identical with other M. incognita sequences (GenBank Accession Nos. OP753345 and MT683461). In order to determine the pathogenicity of the nematode, infestation test was conducted in greenhouse. Ten 20-day-old healthy plants were cultured in pots with sterilized soil respectively and 2000 J2 hatched from egg masses of M. incognita were inoculated to the root of the plant. Five non-inoculated healthy C. dealbatus were used as negative control. After cultured at 25℃ for 60 days, roots were galled as observed in the field, and the symptoms of the root inoculated artificially with M. incognita were the same as those in the field. The nematodes were collected from inoculated roots, and identified as M. incognita with the species-specific primers Mi2F4/Mi1R1. An average of 7362 J2 was recovered and the reproduction factor value was 3.68. No galls were observed in control plants. These results suggested that C. dealbatus is a host for M. incognita. To our knowledge, this is the first report of M. incognita parasitizing C. dealbatus. This finding may be important to C. dealbatus industry and appropriate strategies should be taken to deal with the spreading of M. incognita.

First report of Root-Knot Nematode Meloidogyne hapla infecting Siegesbeckia orientalis L. in Shaanxi, China.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) µm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) µm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) µm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) µm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) µm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) µm, BW = 28.24 ± 2.38 (25.93-30.55) µm, ST = 20.23 ± 0.78 (19.42-21.04) µm, DGO = 4.89 ± 0.44 (4.56-5.22) µm, spicule length = 28.98 ± 1.68 (26.94-31.02) µm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) µm, BW = 15.09 ± 1.47 (12.02-16.82) µm, ST = 12.74 ± 0.61(11.46-13.84) µm, DGO = 2.58 ± 0.59 (1.61-3.7) µm, tail length= 74.15 ± 13.73 (50.92-95.09) µm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) µm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

First report of Root-Knot Nematode Meloidogyne enterolobii infecting coriander in Shaanxi, Northern China.

Coriander (Coriandrum sativum), which can be used for its root, stem, and leaf as both food and medicine (Prachayasittikul et al. 2018), is widely cultivated in China. The coriander cultivation area of Guanzhong region, including Xi' an, Xianyang, and Weinan, is 20 million m2, which accounts for 85.7% of the total cultivation area in Shaanxi. In September 2022, obvious galls were observed on the roots of coriander plants (cv. Xiaoye) growing in a field in Huyi District, Xi' an City (34°1'26.4"N, 108°31'58.8"E). The diseased plants did not show obvious above-ground symptoms. To identify the species, second-stage juveniles (J2s) and males were collected from soil in the root zone, and adult females were isolated from galls of diseased roots. The perineal patterns of adult females (n = 20) were round to oval, with high dorsal arches and no obvious lateral lines were observed. Morphological measurements of females (n = 20) included body length (L) = 682 ± 56 (554 to 780) µm, body width (BW) = 522 ± 45 (420 to 597) µm, stylet = 14.9 ± 0.9 (13.4 to 16.3) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 5.3 ± 0.5 (4.3 to 6.3) µm, vulval slit length = 26 ± 2.8 (20 to 32) µm, vulval slit to anus distance = 21 ± 1.7 (18.5 to 26) µm. Measurements of males (n = 8) were L = 1398 ± 57 (1308 to 1450) µm, BW = 28 ± 2.9 (23 to 32) µm, stylet = 16.1 ± 0.8 (15.3 to 17.3) µm, DGO = 4.5 ± 0.5 (3.5 to 4.9) µm, spicules = 27 ± 1.1 (26 to 29) µm. Measurements of J2s (n = 20) were as follows: L = 434 ± 16.8 (391 to 477) µm, BW = 15.6 ± 0.9 (13.7 to 17.3) µm, stylet = 12.6 ± 0.6 (11.3 to 13.6) µm, DGO = 3.9 ± 0.3 (3.4 to 4.5) µm, tail = 52 ± 4.0 (47 to 60) µm, hyaline tail length = 15.6 ± 1.3 (13.6 to 18.6) µm. These morphological characteristics were consistent with those described for Meloidogyne enterolobii (Yang and Eisenback 1983). Ten females were put in 10 tubes for DNA extraction following Htay et al. (2016). The ITS-rDNA sequence was amplified using the primers 18S/26S (Vrain et al. 1992). A 765 bp fragment was obtained and the sequence (GenBank OR789453) was 99.87% identical to sequences of M. enterolobii (MT406251 and MT067559). The mtDNA CoxII-16S sequence was amplified using primers C2F3/1108 (Powers and Harris, 1993). The sequence was 705 bp (OR795028) and 100% identical to sequences of M. enterolobii (MK455870 and MZ643270). A single 236 bp fragment was amplified using species-specific primers Me-F/Me-R, confirming the species as M. enterolobii (Long et al. 2006). The infection test was conducted in a greenhouse at 27 ± 2℃. Eight 2-week-old coriander plants (cv. Xiaoye) were individually grown in pots filled with sterilizer soil and inoculated with 800 J2s hatched from collected M. enterolobii egg masses. Forty-five days after nematode inoculation, the inoculated plants had galled roots like those observed in the field. The reproduction factor (final population density/initial population density) was 11.9 ± 2.0, indicating coriander was a suitable host for M. enterolobii. No symptoms were observed in controls. To our knowledge, this is the first known natural infection of coriander with M. enterolobii in China. M. enterolobii has been reported on various crops in southern provinces of China (EPPO, 2023). Considering the high level of agricultural trade between different regions, there is a high risk of M. enterolobii transmission to Guanzhong region through infested soil and susceptible plant materials. Further monitoring and research on effective control strategies are needed to prevent the spread of this nematode.

A simple and efficient method for selective recovery of copper from nitric acid leaching solution of printed circuit boards containing nickel, zinc, lead, aluminum, and iron.

The Cu content in discarded printed circuit boards (PCBs) is a crucial aspect, and employing suitable methods for the recovery of Cu holds significance in resource recovery. However, the selective recovery of Cu from an acidic leaching solution containing multiple metals such as Ni, Zn, and Pb poses challenges. L-cys contains the thiol (-SH), the amino (-NH2) and the carboxyl (-COOH) groups, which may complex with metal ions. In particular, the reaction between thiol groups and metal ions makes it possible to recover Cu. In this study, we propose an innovative method using L-cysteine (L-cys) to recover Cu from the acidic leaching solution of discarded PCBs. The effects of Ni2+, Zn2+, Pb2+, Al3+, and Fe3+ irons on the recovery of Cu were studied based on the concentration of these metal ions in PCBs. Adding 120 mL of 2 g/L solution of L-cys to 100 mL of 500 mg/L solution of Cu(NO3)2 achieved the complete recovery of Cu by forming precipitates. The Ni2+, Zn2+, Pb2+, and Al3+ ions did not affect the recovery of Cu within the studied metal concentration range in the acidic leaching solution. However, approximately 20% of the Fe3+ is coprecipitated during the recovery of Cu. This is mainly affected by the amount of colloid formed when copper precipitates in the solution. The interference of Fe3+ on copper recovery can be effectively reduced by controlling the volume of L-cys to reduce the formation of colloid. Fourier transform infrared and X-ray photoelectron spectroscopy analyses demonstrates the chemical action between the functional groups in L-cys and Cu2+. Compared with nickel, zinc and lead ions, copper ions have the strongest binding ability with (-SH), amino (-NH2) and carboxyl (-COOH) groups. This result explains why L-cys can selectively recover copper from leaching solution. This method offers advantages such as fast reaction rates, convenient operating conditions, and enhanced selectivity, which is a promising avenue for the clean and efficient recovery of Cu from discarded PCBs.

Reticular Chemistry for Highly Porous Metal-Organic Frameworks: The Chemistry and Applications.

Current global crises related to clean energy and the environment entail the development of materials that are capable of addressing these challenges. Metal-organic frameworks (MOFs), a class of functional materials assembled from metal-containing nodes and organic ligands via coordination bonds, have been successfully developed for various applications, including catalysis, toxic chemical removal, and gas storage and separation, as a result of their highly tailorable nature and precisely engineered pore structures. In particular, the exceptionally high surface areas and porosities of MOFs are two of their most attractive characteristics and place them among the best porous materials for the storage of clean energy gases, such as hydrogen and methane. Reticular chemistry stands out as a prominent approach to the design of MOFs as this strategy allows for the rational top-down design of frameworks guided by topological nets to afford extended framework structures with precise architectural arrangements at the molecular level. Bridging the gap between reticular chemistry design strategies and highly porous MOFs can facilitate the development of next-generation high-performance materials through state-of-the-art chemical design.In this Account, we summarize our group's efforts over the past few years toward the synthesis and applications of highly porous MOFs inspired by reticular chemistry. First, we describe how we leveraged reticular chemistry to synthesize NU-1500, which is based on the 6-connected edge-transitive acs net, from the assembly of triptycene-based ligands and high-valent metal trimers. This delicate design is amenable to isoreticular expansion, and including an additional phenyl group in the rigid triptycene-based ligand of NU-1500 yields NU-1501. Importantly, NU-1501-Al exhibits both a high gravimetric Brunauer-Emmett-Teller (BET) area of 7310 m2 g-1, which is the current record after satisfying the four BET consistency criteria, and a volumetric BET area of 2060 m2 cm-3. The high porosity and surface area place NU-1501 among the most promising adsorbents for the storage of methane and hydrogen. Second, we illustrate the rational synthesis of highly porous and stable Zr-MOFs based on edge-transitive nets: (1) the successful isoreticular expansions of NU-1000 (a 4,8-connected csq net) form hierarchical mesoporous MOFs with pore sizes of up to 6.7 nm; (2) the assembly of Zr6 clusters and tetracarboxylates yields the NU-1100 series (4,12-connected ftw net) with BET areas of 4300-6500 m2 g-1; and (3) the use of hexacarboxylates in combination with Zr6 clusters results in the formation of the NU-1600 series (a 6,12-connected alb net) with BET areas of 2000-4500 m2 g-1. Third, we leveraged a reticular exploration strategy to access mesoporous uranium-based MOFs, NU-1300 (a 3,4-connected tbo net, 2100 m2 g-1) and NU-1301 (a 3-connected nun net, 4750 m2 g-1). In particular, we investigated the structurally complex NU-1301, which formed serendipitously from the combination of uranyl clusters and triangular carboxylates to afford a structure with the largest unit cell among all reported MOFs.Finally, we provide an overview of potential applications of these highly porous MOFs, including water capture, catalysis, methane storage, hydrogen storage, and the separation of organic dyes and biological macromolecules. We hope that this Account may serve as a blueprint and stimulate researchers to develop the next generation of highly porous materials for energy- and environment-related applications and beyond.

Single-Cell Analysis of the In Vivo Dynamics of Host Circulating Immune Cells Highlights the Importance of Myeloid Cells in Avian Flaviviral Infection.

Ducks are an economically important waterfowl but a natural reservoir for some zoonotic pathogens, such as influenza virus and flaviviruses. Our understanding of the duck immune system and its interaction with viruses remains incomplete. In this study, we constructed the transcriptomic landscape of duck circulating immune cells, the first line of defense in the arthropod-borne transmission of arboviruses, using high-throughput single-cell transcriptome sequencing, which defined 14 populations of peripheral blood leukocytes (PBLks) based on distinct molecular signatures and revealed differences in the clustering of PBLks between ducks and humans. Taking advantage of in vivo sex differences in the susceptibility of duck PBLks to avian tembusu virus (TMUV) infection, a mosquito-borne flavivirus newly emerged from ducks with a broad host range from mosquitos to mammals, a comprehensive comparison of the in vivo dynamics of duck PBLks upon TMUV infection between sexes was performed at the single-cell level. Using this in vivo model, we discovered that TMUV infection reprogrammed duck PBLks differently between sexes, driving the expansion of granulocytes and priming granulocytes and monocytes for antiviral immune activation in males but decreasing the antiviral immune activity of granulocytes and monocytes by restricting their dynamic transitions from steady states to antiviral states with a decrease in the abundance of circulating monocytes in females. This study provides insights into the initial immune responses of ducks to arthropod-borne flaviviral infection and provides a framework for studying duck antiviral immunity.

Denitrification shifted autotroph-heterotroph interactions in Microcystis aggregates.

Denitrification is the most important process for nitrogen removal in eutrophic lakes and was mostly investigated in lake sediment. Denitrification could also be mediated by cyanobacterial aggregates, yet how this process impacts nitrogen (N) availability and the associated autotroph-heterotroph relationships within cyanobacterial aggregates has not been investigated. In this study, incubation experiments with nitrate amendment were conducted with Microcystis aggregates (MAs). Measurement of nitrogen contents, 16S rRNA-based microbial community profiling and metatranscriptomic sequencing were used to jointly assess nitrogen turnover dynamics, as well as changes in microbial composition and gene expression. Strong denitrification potential was revealed, and maximal N removal was achieved within two days, after which the communities entered a state of severe N limitation. Changes of active microbial communities were further promoted both with regard to taxonomic composition and transcriptive activities. Expression of transportation-related genes confirmed competition for N sources by Microcystis and phycospheric communities. Strong stress response to reactive oxygen species by Microcystis was revealed. Notably, interspecific relationships among Microcystis and phycospheric communities exhibited a shift toward antagonistic interactions, particularly evidenced by overall increased expression of genes related to cell lysis and utilization of cellular materials. Patterns of fatty acid and starch metabolism also suggested changes in carbon metabolism and cross-feeding patterns within MAs. Taken together, this study demonstrated substantial denitrification potential of MAs, which, importantly, further induced changes in both metabolic activities and autotroph-heterotroph interactions. These findings also highlight the key role of nutrient condition in shaping autotroph-heterotroph relationships.

Single-molecule diffusometry reveals no catalysis-induced diffusion enhancement of alkaline phosphatase as proposed by FCS experiments.

Theoretical and experimental observations that catalysis enhances the diffusion of enzymes have generated exciting implications about nanoscale energy flow, molecular chemotaxis, and self-powered nanomachines. However, contradictory claims on the origin, magnitude, and consequence of this phenomenon continue to arise. To date, experimental observations of catalysis-enhanced enzyme diffusion have relied almost exclusively on fluorescence correlation spectroscopy (FCS), a technique that provides only indirect, ensemble-averaged measurements of diffusion behavior. Here, using an anti-Brownian electrokinetic (ABEL) trap and in-solution single-particle tracking, we show that catalysis does not increase the diffusion of alkaline phosphatase (ALP) at the single-molecule level, in sharp contrast to the ∼20% enhancement seen in parallel FCS experiments using p-nitrophenyl phosphate (pNPP) as substrate. Combining comprehensive FCS controls, ABEL trap, surface-based single-molecule fluorescence, and Monte Carlo simulations, we establish that pNPP-induced dye blinking at the ∼10-ms timescale is responsible for the apparent diffusion enhancement seen in FCS. Our observations urge a crucial revisit of various experimental findings and theoretical models--including those of our own--in the field, and indicate that in-solution single-particle tracking and ABEL trap are more reliable means to investigate diffusion phenomena at the nanoscale.

Spectroscopic fingerprint of chiral Majorana modes at the edge of a quantum anomalous Hall insulator/superconductor heterostructure.

With the recent discovery of the quantum anomalous Hall insulator (QAHI), which exhibits the conductive quantum Hall edge states without external magnetic field, it becomes possible to create a topological superconductor (SC) by introducing superconductivity into these edge states. In this case, 2 distinct topological superconducting phases with 1 or 2 chiral Majorana edge modes were theoretically predicted, characterized by Chern numbers (N) of 1 and 2, respectively. We present spectroscopic evidence from Andreev reflection experiments for the presence of chiral Majorana modes in an Nb/(Cr0.12Bi0.26Sb0.62)2Te3 heterostructure with distinct signatures attributed to 2 different topological superconducting phases. The results are in qualitatively good agreement with the theoretical predictions.

First Report of Meloidogyne incognita on Daylily (Hemerocallis citrina) in Shaanxi, China.

Daylilies (Hemerocallis citrina Baroni) are herbaceous perennials grown extensively as ornamental plants worldwide. In China, daylilies are important cash crops, which are used for their roots, leaves, and flowers as both food and medicine (Guo et al., 2022). Dali County, Shaanxi Province, is an important production region for the commercial cultivation of daylily in China. The daylily cultivation area of Dali County was 43.33 million m2 and the output reached 227 thousand kg, which worth more than 109.12 million dollars. In July 2021, numerous daylily plants (cv. Shayuan) showed chlorotic leaves and stunted growth in a field in Dali County. The area of daylily field we investigated was about 2000 m2, and the incidence of root-knot nematode disease was more than 90%. The inflorescences of diseased plants decreased by nearly 30%, which affected the yield seriously. The diseased plants exhibited obvious galling on the roots which were typical symptoms of infection by root-knot nematodes (RKNs). Population densities of second-stage juveniles (J2s) ranged from 300 to 350 in 100g soil layer of 10-20 cm. Nematodes were collected from root samples (n = 15) and were found in all of the diseased plant samples. Morphological and molecular analysis were conducted using females, males, and J2s. The perineal patterns of females (n = 20) showed a high dorsal arch, and with wavy striae, which mostly lacking obvious lateral lines. Morphological measurements of adult females (n = 20) include body length (BL) = 668.99 ± 24.56 (487.57-897.84) µm, body width (BW) = 433.73 ±12.84 (343.71-551.61) µm, stylet length = 15.64 ± 1.45 (10.86-28.26) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 2.57 ± 0.20 (1.41-3.68) µm, vulval slit length = 20.44 ± 0.91 (16.00-24.22) µm, and vulval slit to anus distance = 18.05 ± 1.06 (14.58-24.90) µm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and the stylet knobs were prominent, usually demarcated from the shaft. The morphological characters of males (n = 7) were as follows: BL = 1124.56 ± 53.97 (998.37-1336.52) µm, BW = 33.60 ± 0.79 (30.21-36.52) µm, stylet length = 23.63 ± 0.78 (20.14-26.37) µm, DGO = 3.04 ± 0.09 (2.69-3.38) µm, spicule length = 25.72 ± 0.57 (23.97-28.33) µm. The key morphometrics of J2s: BL = 439.13 ± 6.52 (398.32-481.33) µm, BW = 15.14 ± 0.26 (13.91-16.66) µm, stylet length = 13.44 ± 0.29 (10.96-14.60) µm, DGO = 2.13 ± 0.18 (1.22-3.10) µm, tail length = 57.46 ± 4.89 (38.85-101.33) µm, hyaline tail terminus = 16.93 ± 0.97 (11.45-22.54) µm. The morphological features of the females, males, and J2s match the original description of Meloidogyne incognita (Eisenback and Hirschmann, 1981). Eleven individual females were transferred to eleven different tubes for DNA extraction and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for the identification of M. incognita (Kiewnick et al. 2013). A 300 bp target fragment was amplified by the primer pairs, confirming the RKNs collected from daylily plants were M. incognita. To confirm the result of species identification, the NADH dehydrogenase subunit 5 (nad5) from the mitochondrial DNA region was amplified using primers NAD5-F/R (TATTTTTTGTTTGAGATATATTAG/CGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A fragment of 611 bp was obtained and the sequence (GenBank Accession No.OP115729) was 100% identical to the known sequence of M. incognita (GenBank Accession No. MT683461). The ITS region was amplified using the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992). The sequences from the ITS region were 768 bp (GenBank Accession No. OP095037) and showed 100% identical to the known sequence of M. incognita (GenBank Accession No. MH113856). An infection test was conducted in greenhouse conditions. Eighteen 5-weeks-old healthy daylily seedlings (cv. Shayuan) were individually cultured in 9 L pots filled with autoclaved-soil and each plant was inoculated with 3,000 J2s. Six non-inoculated daylily plants served as negative controls. After 60 days, all of the inoculated plant roots showed galling symptoms which were similar to those observed in the field, the nematodes were extracted from roots and were identified as M. incognita with the sequence-specificprimers Mi2F4/Mi1R1. No obvious symptoms were observed on control plants. An average of 9635 J2s were recovered from inoculated plants, (reproductive factor = 3.21), which confirmed the pathogenicity of M. incognita on daylily. Although it was reported that daylily was a host of M. incognita in Florida (Inserra et al. 1995), to our knowledge, this is the first evidence that M. incognita naturally infecting daylily in China. This root-knot disease leads to the yield reduction of daylily and may cause serious economic losses, so further studies should focus on the occurrence and effective control of this disease.

Identification of Meloidogyne species on traditional Chinese medicine plants in the Qinling mountain area of China and their aggressiveness to different medicinal herbs.

Root-knot nematodes (Meloidogyne spp.) are plant-parasitic nematodes that cause serious damage on a worldwide basis. There are many species of traditional Chinese medicine (TCM) plants, but only a few have been reported to be infected by Meloidogyne species. From 2020 to 2022, a survey was conducted in the Qinling mountain area, which is the main producing region of TCM plants in China. Obvious galling symptoms were observed on the root systems of fifteen species of TCM plants. Females were collected from diverse diseased TCM plants and subsequently identified at morphological and molecular level. Among the twenty diseased root samples collected, Meloidogyne hapla populations were identified in twelve samples (60%) and Meloidogyne incognita populations were identified in eight samples (40%). Among the fifteen species of diseased TCM plants, eight of them, namely Scutellaria baicalensis, Leonurus japonicus, Dioscorea zingiberensis, Cornus officinalis, Viola philippica, Achyranthes bidentata, Senecio scandens, and Plantago depressa were reported to be infected by Meloidogyne species for the first time. The host status of five species of TCM plants for two M. hapla isolates and one M. incognita isolate from TCM plants in this study was then evaluated. Differences in TCM plants' response to nematode infection were apparent when susceptibility was evaluated by the egg counts per gram fresh weight of root and the reproduction factor of the nematodes. Among the five species of TCM plants tested, Salvia miltiorrhiza and Gynostemma pentaphyllum were the most susceptible, while S. baicalensis and V. philippica were not considered suitable hosts for M. hapla or M. incognita.

3D Interconnected Magnetic Nanowire Networks as Potential Integrated Multistate Memristors.

Interconnected magnetic nanowire (NW) networks offer a promising platform for three-dimensional (3D) information storage and integrated neuromorphic computing. Here we report discrete propagation of magnetic states in interconnected Co nanowire networks driven by magnetic field and current, manifested in distinct magnetoresistance (MR) features. In these networks, when only a few interconnected NWs were measured, multiple MR kinks and local minima were observed, including a significant minimum at a positive field during the descending field sweep. Micromagnetic simulations showed that this unusual feature was due to domain wall (DW) pinning at the NW intersections, which was confirmed by off-axis electron holography imaging. In a complex network with many intersections, sequential switching of nanowire sections separated by interconnects was observed, along with stochastic characteristics. The pinning/depinning of the DWs can be further controlled by the driving current density. These results illustrate the promise of such interconnected networks as integrated multistate memristors.

Combination of coagulation and adsorption technologies for advanced wastewater treatment for potable water reuse: By ANN, NSGA-II, and RSM.

To reuse water and reduce water pollution, such as chemical oxygen demand (COD), total suspended solids (TSS), PO4, NTU, and NO3, advanced wastewater treatment technologies (a combination of coagulation (FeCl3) and adsorption (Activated Carbon (AC))) are attractive. Considering that water reclamation can help provide an irrigation system for crops and domestic purified water, removing organic matter and nutrients prior to wastewater reuse is fundamental. In order to remove contaminants like organic matter and nutrients from wastewater, advanced wastewater treatment processes are recommended. The purpose of this paper is to investigate various doses of AC and FeCl3 in wastewater treatment and study the optimum conditions for the removal of COD, TSS, PO4, NTU, and NO3. Furthermore, the evaluated FeCl3'/AC's optimum functioning pH ranges from 6.5 to 8.0, and their optimum working times range from 2.5 to 5.5 h. The optimum concentrations of AC were 0.1-25 g/L and 0.1-5 g/L of FeCl3. The most significant COD elimination rate (98%), the highest TSS elimination efficiency (94%), NTU elimination performance (99%), PO4 elimination (99%), and NO3 elimination (67%), among the investigated FeCl3 and AC. Secondly, the effects of operational variables such as AC, FeCl3, time, and solution pH were modeled, optimized, and evaluated using response surface techniques based on the D-Optimal design. Input from the response surface approach findings was used to develop an artificial neural network-based prediction model and Non-dominated Sorting Genetic Algorithm II (NSGA-II).

Green valorization of PET waste into functionalized Cu-MOF tailored to catalytic reduction of 4-nitrophenol.

Metal-organic frameworks (MOFs) are attractive functional materials due to their high surface area, high porosity, and flexible compositions. However, the high precursor cost and complex synthetic processes hinder their large-scale applications. Herein, a novel green approach has been developed toward the synthesis of Cu-based MOF by a solvent-free mechano-synthesis method and utilizing consumed polyethylene terephthalate (PET)-derived benzenedicarboxylate (BDC) as the linker. The as-prepared CuBDC and aminated CuBDC (CuBDC-NH2) act as green catalysts for the reduction of deleterious 4-nitrophenol (4-NP) into the value-added 4-aminophenol (4-AP). Compared with CuBDC, CuBDC-NH2 shows increased adsorption capability and reduction efficiency. The mechanism and thermodynamic studies suggest that the adsorption of 4-NP on CuBDC-NH2 is an endothermic, spontaneous, favorable, and physical adsorption process. Furthermore, CuBDC-NH2 can expedite the reduction of 4-NP by participating in an adsorptive catalytic process. With the CuBDC-NH2 catalyst, the catalytic normalized kinetic rate of 4-NP was achieved 11.28 mol/min. mg, outperforming state-of-the-art catalysts, and a complete reduction occur in 5 min for a concentrated effluent (200-ppm 4-NP). The plastic waste-derived MOF-mediated catalytic valorization of organic pollutants demonstrated here opens an avenue for the green recycling/utilization of plastic waste, providing meaningful insights into the sustainable management of organic pollutants in wastewater.

Sulfur-decorated Fe/C composite synthesized from MIL-88A(Fe) for peroxymonosulfate activation towards tetracycline degradation: Multiple active sites and non-radical pathway dominated mechanism.

Peroxymonosulfate (PMS)-mediated advanced oxidation processes gain growing attention in degrading antibiotics (e.g., tetracycline (TC)) in wastewater for their high capacity and relatively low cost, while designing efficient catalysts for PMS activation remains a challenge. In this study, a sulfur-doped Fe/C catalyst (Fe@C-S) synthesized from iron metal-organic frameworks (Fe-MOFs) was developed for PMS activation towards TC removal. Under optimal conditions, the TC removal efficiency of Fe@C-S150/PMS system within 40 min was 91.2%. Meanwhile, the k value for Fe@C-S150/PMS system (0.2038 min-1) was 3.36-fold as high as the S-free Fe@C-based PMS system. Also, Fe@C-S150/PMS system showed high robustness in different water matrices. Further studies found that the TC degradation mechanism was mainly ascribed to the non-radical pathway (1O2 and electron transfer). Fe nanoparticles, S and CO groups on the catalyst all participated in the generation of reactive oxygen species (ROS). Besides, S species could enhance the Fe2+/Fe3+ redox cycle and accelerate the electron transfer process. This work highlights the critical role of S in enhancing the catalytic performance of Fe/C-based catalysts for PMS activation, which would provide meaningful insights into the design of high-performance PMS activators for the sustainable remediation of emerging contaminants-polluted water bodies.

Water Sorption Evolution Enabled by Reticular Construction of Zirconium Metal-Organic Frameworks Based on a Unique [2.2]Paracyclophane Scaffold.

Water vapor sorption by metal-organic frameworks (MOFs) has gathered significant interest because of its prominent potential in many applications such as moisture harvesting, dehumidification, heat pump regulation, and hydrolysis catalysis. However, the reticular design and exploration of robust and high-performing Zr-MOFs for such purposes remains a sought-after endeavor. In this work, we present the deployment of reticular chemistry to target a series of robust Zr-MOFs based on a unique [2.2]paracyclophane (PCP) scaffold. The ease of functionalization of PCP enables the desired synthesis of three carboxylate linkers, one ditopic and two tetratopic, which further assemble into a total of five Zr-MOFs with distinct topological structures, i.e., a new 2D net (NU-700), fcu (NU-405), flu (NU-1800), she (NU-602), scu (NU-913). Notably, the water vapor sorption performances of all the Zr-MOFs are highly dependent on their framework topology and pore metric, in which NU-602 and NU-913 with uniform 1D channels exhibit S-shaped water sorption isotherms with a steep pore-filling step and high uptake capacities of 0.72 g g-1 at 70% relative humidity (RH) and 0.88 g g-1 at 60% RH, respectively. Moreover, NU-913 displays exceptionally high working capacity of 0.72 g g-1 in the range of 40-60% RH. Additionally, we demonstrate that the hydrolytic stability and water adsorption-desorption recyclability of NU-913 can be remarkably improved by capping the Zr6 nodes with the more hydrophobic agent, trifluoroacetic acid, making it a potential candidate for water sorption-based applications.