Identification and complete genome sequence of a novel sadwavirus discovered in chrysanthemum (Chrysanthemum morifolium Ramat.).

The complete genome sequence of a putative novel member of the genus Sadwavirus was determined by high-throughput sequencing of a chrysanthemum from an orchard of the Tongxiang Agricultural Science Institute in Tongxiang, Zhejiang province. The complete genome sequence was confirmed using RT-PCR and the rapid amplification of cDNA ends (RACE) method. The predicted genome of the putative virus is composed of two RNA molecules, 7016 and 6772 nucleotides in length, excluding their poly-A tails. The new virus was tentatively named "chrysanthemum sadwavirus" (ChSV). The Pro-Pol region of RNA1 and the CP region of RNA2 of ChSV shared the highest amino acid sequence identity (53.01% and 36.40%, respectively) with the corresponding sequences of lettuce secovirus 1 (LSV-1). Phylogenetic analysis showed that ChSV clustered with members of the subgenus Stramovirus (genus Sadwavirus). Taken together, these results suggest that ChSV is a new member of the genus Sadwavirus.

First report of grapevine asteroid mosaic-associated virus in grapevines in China.

Grapevine asteroid mosaic-associated virus (GAMaV), a member of the genus Marafivirus of the family Tymoviridae, was first described to infect grapevines in California (Abou Ghanem-Sabanadzovic et al. 2003). Since then, GAMaV has been reported from Greece, Japan, Canada, Uruguay, France, Hungary, Italy, Spain, Switzerland and Russia, and also in some free-living grapevines in North America (Kyriakopoulou, 1991; Morán et al., 2021; Reynard et al., 2022; Shvets et al., 2022; Thompson et al., 2021). GAMaV may be associated with grapevine asteroid mosaic disease (Martelli 2014). In August 2022, a grapevine cv. Cabernet Sauvignon exhibiting chlorotic mottling was collected in Ningxia, China. Total RNAs were extracted using RNAprep Pure Plant Plus Kit (DP441, TIANGEN BIOTECH, Beijing), and the ribosomal RNA were removed by the Epicentre Ribo-Zero rRNA Removal Kit (Epicentre, Madison, WI, USA). The ribosomal RNA-depleted RNAs were then used to construct a cDNA library using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA), which was sequenced on an Illumina NovaSeq 6000 platform (Biomarker Biology Technology), resulting in 39,297,567 paired-end clean reads (150 nt × 2). Reads mapping to the grapevine genome (GenBank accession no PN40024) were removed using hisat2 2.1.0 software. The 15,003,158 unmapped reads were de novo assembled into 70,512 contigs using the rnaviralSPAdes method in the SPAdes v3.15.3 software with default parameters and analyzed through BLASTn and BLASTx analysis. Five viruses and two viroids were identified: GAMaV (5 contigs), grapevine Pinot gris virus (3 contigs), grapevine berry inner necrosis virus (3 contigs) , grapevine rupestris stem pitting-associated virus (4 contigs), grapevine red globe virus (2 contigs), grapevine yellow speckle 1 viroid (4 contigs) and hop stunt viroid (3 contigs). The five contigs of GAMaV were 352 nt~2, 224 nt in length, which were assembled from 3, 308 reads and shared 85.56%~91.81% nt identity with the genome of the GAMaV isolate GV30 (KX354202) with 93.3% coverage. To further confirm the infection of GAMaV, we designed two pairs of primers, GAMaV-mel1a/1b (5'-CACCTCGCCCCCTACCTTGAC-3'/5'-AAGAGGACGCCTTTGCGGGAG-3') and GAMaV-cp1a/1b (5'-CTAGCGACGACCGCACTGATC-3'/5'-GTCGGTGTACGAGATTTGGTC-3'), which were used to amplify the 329-bp and 440-bp fragments in the helicase (Hel) domain and coat protein (CP) gene of GAMaV genome in RT-PCR, respectively. The amplified PCR products were cloned and sequenced and the two sequences (OQ676951 and OQ676958) showed 91.2% and 93.4% nt identity with the isolate GV30, respectively. Furthermore, 429 grapevine samples of 71 cultivars were collected from 21 provinces and tested by RT-PCR using the above primer pairs. The results showed that 1.4% (6/429) of the samples tested positive, including one 'Autumn seedless' grapevine (Liaoning province), two 'Dawuhezi' (Liaoning), one 'Cabernet Gernischt' (Liaoning) and two 'Cabernet Sauvignon' (Tianjing and Shandong respectively). The partial sequences of the Hel domain (OQ676952-57) and CP gene (OQ676959-61) obtained from the positive samples by sequencing showed 89.1% to 84.5% and 93.6% to 93.9% nt identity with the isolate GV30, respectively. Because these GAMaV-positive grapevines did not show distinct symptoms, GAMaV pathogenicity remains challenging to confirm. This is the first report of GAMaV in grapevines in China, extending the information on its geographical distribution.

Integrated Transcriptome and Metabolome Dissecting Interaction between Vitis vinifera L. and Grapevine Fabavirus.

Grapevine fabavirus (GFabV) is a novel member of the Fabavirus genus associated with chlorotic mottling and deformation symptoms in grapevines. To gain insights into the interaction between GFabV and grapevines, V. vinifera cv. 'Summer Black' infected with GFabV was investigated under field conditions through physiological, agronomic, and multi-omics approaches. GFabV induced significant symptoms on 'Summer Black', and caused a moderate decrease in physiological efficiency. In GFabV-infected plants, alterations in carbohydrate- and photosynthesis-related genes might trigger some defense responses. In addition, secondary metabolism involved in plant defense was progressively induced by GFabV. Jasmonic acid and ethylene signaling were down-regulated in GFabV-infected leaves and berries along with the expression of proteins related to LRR and protein kinases, suggesting that GFabV can block the defense in healthy leaves and berries. Furthermore, this study provided biomarkers for early monitoring of GFabV infection in grapevines, and contributed to a better understanding of the complex grapevine-virus interaction.

First report of Vitis cryptic virus from grapevines in China.

Vitis cryptic virus (VCV) was recently identified on wild Vitis coignetiae in Japan in 2021, and was tentatively classified as a new member of the genus Deltapartitivirus, which is consistent with the two-segmented genome encoding RdRp and CP (Nabeshima et al., 2021). In June 2020, a grapevine cv. Jinhuanghou in a vineyard exhibiting chlorotic mottling (Figure S1) was collected in Xingcheng, Liaoning province of China. Total RNAs were extracted using RNAprep Pure Plant Plus Kit (DP441, TIANGEN BIOTECH, Beijing), and the ribosomal RNA were removed by the Epicentre Ribo-Zero rRNA Removal Kit (Epicentre, Madison, WI, USA). The ribosomal RNA-depleted RNA was then used to construct a cDNA library using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA), which was sequenced on an Illumina NovaSeq 6000 platform (Biomarker Biology Technology), resulting 60,208,348 paired-end clean reads (150 nt × 2). Reads mapping to the grapevine genome (PN40024 assembly 12X) were removed by hierarchical indexing using hisat2 2.1.0 software (Kim et al., 2019). The unmapped reads were de novo assembled into 116,809 contigs using the rnaviralSPAdes method in the SPAdes v3.15.3 software with default parameters (Prjibelski et al., 2020) and analyzed through BLAST analysis. Two viruses and two viroids were identified: VCV (2 contigs), grapevine emaravirus A (GEVA; 5 contigs), grapevine yellow speckle viroid 1 (GYSVd1; 1 contig) and hop stunt viroid (HSVd; 1 contig). The two contigs of VCV had lengths of 1575 nt and 1563 nt, and shared 95% and 90% nt identity with RNA1 and RNA2 genomes of the VCV isolate H1 (GenBank accession nos. LC602838-39) with 99% and 96% coverage respectively. To further confirm the infection of VCV, we designed two pairs of primers VCV-RP1a/1b (5'- TGGTCGAGAAGTTACTATACTCG -3'/5'- AGACCACAATATTGCTTTGGCTC -3') and VCV-CP1a/1b (5'-TTACGAAGTCCGCACTATTGC-3'/5'- AGCATACGGATAGCTCCTGAC-3'), which were to amplify the 297-bp and 279-bp fragments in the RdRp and CP gene encoded by RNA1 and RNA2 genomes of VCV respectively. The amplified PCR products were cloned and sequenced and the two sequences (OM460075-76) showed 93% and 91% nt identity with the genomic segments of the VCV isolate H1 respectively. The graft transmissibility of VCV was assessed in July 2021 by grafting the VCV-infected grapevine buds onto 2-year-old VCV-free 'Beta'grapevine seedlings with four replicates, the leaves of the first bud below the grafting site behaved chlorotic mottling symptoms (Figure S2) and tested positive for VCV two months after grafting. To further determine the incidence and distribution of VCV in China, 470 grapevine samples of 71 cultivars were collected from 21 provinces and tested by RT-PCR using primers VCV-RP1a/1b and VCV-CP1a/1b. The results showed that 2.6% (12/470) of the samples tested positive with both primers, including 10 'Jinhuanghou' grapevines (Jilin province), 1 'Zuoyouhong' (Jilin province) and 1 'Куртсет' grapevine (Liaoning province). This is the second report of VCV in the world, and confirm the graft transmissibility of VCV for the first time. Given the VCV infectivity in the two important cultivars in Jilin province and strong graft transmissibility, it is necessary to further study its pathogenicity and its effect on grapes. Unveiling the presence of VCV in China contributes to understanding the occurrence of the virus and developing management measures should they become necessary.

Genetic diversity analysis of grapevine rupestris stem pitting-associated virus from grapevine by colony PCR-SSCP and -RFLP.

We have developed methods for detecting the genetic diversity of grapevine rupestris stem pitting-associated virus (GRSPaV) based on restriction fragment length polymorphism (RFLP) and single stranded conformational polymorphism (SSCP) in the 905 nt 3' sequence. The amplicons were cloned from six grapevine cultivars, and colony polymerase chain reaction (colony PCR) using recombination bacteria was subsequently analyzed by RFLP and SSCP. Four haplotypes of SSCP and six haplotypes of Sac I RFLPs were defined. The two methods had a 40% discrepancy rate in showing the degree of diversity. All clones were sequenced and were used to construct a phylogenetic tree with seven previously reported GRSPaV sequences. In the tree, all the newly acquired sequences were divided into three clusters, I, II, and III, which corresponded to haplotypes I, II, and III of SSCP, respectively. Haplotype IV of SSCP was grouped into cluster II. A recombination analysis showed that haplotype IV has undergone a recombination event. Together, these results indicate that the SSCP assay is useful for the rapid identification of genetic diversity of GRSPaV. This is the first report of an analysis of the large fragment of GRSPaV by colony PCR-SSCP. Keywords: grapevine; grapevine rupestris stem pitting-associated virus (GRSPaV); RFLP; SSCP; genetic diversity analysis.

First Report of Grapevine Kizil Sapak Virus in Grapevine in China.

Grapevine Kizil Sapak virus (GKSV) is a novel member of the family Betaflexiviridae classified into the proposed genus Fivivirus within the subfamily Trivirinae. It was first discovered in USA from a grapevine originating from Turkmenistan (Al Rwahnih et al. 2019) and later in France from a grapevine accession from Iran (Marais et al. 2020). In October 2019, an asymptomatic grapevine cv. 'Crimson Seedless' (native to USA) was collected from Xinjiang province in China and analyzed by high-throughput sequencing (HTS). Ribosome-depleted RNA preparations were used for library synthesis followed by HTS on an Illumina HiSeq X-ten platform. A total of 29,141,024 cleaned reads were obtained, and 7,878 contigs were generated using CLC Genomics Workbench 9.5 (QIAGEN). One long contig (7,328 bp) showed 88.2% nucleotide (nt) identity with the sequence of GKSV-127 (MN172165) via Blastx, with an average coverage of 284-X. Bioinformatic analysis of the remaining contigs showed the presence of Grapevine leafroll-associated virus 4, Grapevine rupestris vein feathering virus, Grapevine fabavirus, grapevine yellow speckle viroid-1 (GYSVd-1), GYSVd-2 and Hop stunt viroid in the sample. The presence of GKSV was checked by RT-PCR using the primer GKSV-F/R (Al Rwahnih et al. 2019); the 1,240 bp PCR product was cloned using a pTOPO-T vector (Aidlab, China) and sequenced. In pairwise comparison, the obtained nt sequences shared 92.6 to 95.2% identity to the corresponding HTS sequence, confirming the presence of GKSV in the sample. The complete GKSV genome sequence was obtained as two pieces of overlapping DNA sequence using primers GKSV-20A/20B (5'-TAGTCTGGATTTCCCTACCT/5'-CTCCCTAAACTGATTTGATG) and GKSV-25A/25B (5'-GCCACTGGTGAATGAAAAGA/5'-CTAAATGAATGGGCAGGTAT) designed based on the HTS-generated sequence. The 5' and 3' termini were determined by rapid amplification of cDNA ends using SMARTer RACE 5'/3' Kit (Takara, Dalian, China). The complete genome of GKSV isolate CS (MW582898) comprised 7,604 nt (without the polyA tail) and shared 77.8 to 89.2% identities with the other nine reported GKSV isolates, among which it shared the highest nt identity (89.2%) with GKSV-127. In phylogenetic analysis based on complete or nearly complete genome sequences of representative members of Betaflexiviridae, GKSV-CS clustered with the nine known GKSV isolates, forming a subclade with GKSV-127 (Supplementary Fig. 1). To determine the incidence and distribution of GKSV in China, 476 grapevine samples of 75 cultivars were collected from 20 provinces and tested by RT-PCR using primers GKSV-F/R (Al Rwahnih et al. 2019) and Vini-F1/R1 (Marais et al. 2020). The results showed that 0.42% (2 of 476) of the samples tested positive with both primers, including samples GKSV-CS and a 'Black Monukka' grape (native to India) also sampled from Xinjiang. Both PCR products of 'Black Monukka' were cloned and sequenced (MZ311588 to MZ311602) and they showed 85.1 to 88.9% nt identities to the GKSV-CS sequence. This is the first report of GKSV infecting grapevine in China. Although the pathogenicity of GKSV is yet to be determined, it has been found in several countries such as USA (Al Rwahnih et al. 2019), France (Marais et al. 2020) and China (this study). Both positive samples in this study were collected from Nanjiang region in Xinjiang province, indicating the sporadic occurrence of GKSV in this area.

First report of apple rubbery wood virus 1 in apple in China.

More than 30 viral and subviral pathogens infect apple (Malus domestica, an important fruit crop in China) trees and rootstocks, posing a threat to its production. With advances in diagnostic technologies, new viruses including apple rubbery wood virus 1 (ARWV-1), apple rubbery wood virus 2 (ARWV-2), apple luteovirus 1 (ALV), and citrus virus A (CiVA) have been detected (Beatriz et al. 2018; Rott et al. 2018; Hu et al. 2021). ARWV-1 (family Phenuiviridae) is a negative-sense single-stranded RNA virus with three RNA segments (large [L], medium [M], and small [S]). It causes apple rubbery wood disease (Rott et al. 2018) and is found in apple rootstocks, causing leaf yellowing and mottle symptoms in Korea (Lim et al. 2018). To determine virus prevalence in apple trees in China, 200 apple leaf and shoot samples were collected from orchards in Hebei (n = 26), Liaoning (n = 40), Shandong (n = 100), Yunnan (n = 25), Shanxi (n = 4) and Inner Mongolia (5) in 2020. Total RNA was extracted from the shoot phloem or leaf tissues (Hu et al., 2015) and subjected to reverse transcription (RT)-PCR to detect apple chlorotic leaf spot virus (ACLSV), apple stem pitting virus (ASPV), apple stem grooving virus (ASGV), apple necrotic mosaic virus (ApNMV), apple scar skin viroid (ASSVd), ARWV-2, ARWV-1, ALVand CiVA using primers specific to respective viruses (Supplementary Table 1). The prevalence of ACLSV, ASPV, ASGV, ApNMV, ASSVd, ARWV-2, ARWV-1, ALV and CiVA was found to be 75.5%, 85.5%, 86.0%, 43.0%, 4.0%, 48.5%, 10.5%, 0% and 0%, respectively (Supplementary Table 2). Among the 21 positive samples for ARWV-1, three, five and 13 samples were from Hebei, Liaoning and Shandong, respectively. Five ARWV-1-positive samples (cultivars Xinhongjiangjun, Xiangfu-1, Xiangfu-2 and Tianhong) showed leaf mosaic symptoms. To confirm the RT-PCR assay, the projected ARWV-1 amplicons from cvs. Xiangfu-1 and Tianhong were cloned into the pMD18-T vector (Takara, Dalian, China), and three clones of each sample were sequenced. BLASTn analyses demonstrated that the sequences (accession nos. MW507810-MW507811) shared 96.9%-98.9% identity withARWV-1 sequences (MH714536, MF062127, and MF062138) in GenBank. An lncRNA library was prepared for high-throughput sequencing (HTS) with the Illumina HiSeq platform using Xiangfu-1 RNA. A total of 71,613,294 reads were obtained. De novo assembly of the reads revealed 135 viral sequence contigs of ACLSV, ASGV, ASPV, ApNMV, ARWV-1, and ARWV-2. The sequences of contig-100_88981 (302 nt) and contig-100_25701 (834 nt) (accession nos. MW507821 and MW507820) matched those of segment S from ARWV-1, whereas the sequences of contig-100_6542 (1,660 nt) and contig-100_27 (7,364 nt) (accession nos. MW507819 and MW507818) matched those of segments M and L, respectively. To confirm the HTS results, fragments of segments L (744 bp), M (747 bp), and S (554 bp) from Xiangfu-1 and Tianhong were amplified (Supplementary Table 1) and sequenced. The sequences (accession nos. MW507812-MW507817) showed 94.8%-99.9% nucleotide identity with the corresponding segments of ARWV-1. Co-infection of ARWV-1 with ApNMV and/or ARWV-2 was confirmed in 17/21 ARWV-1-positive samples. The prevalence of ARWV-1/ApNMV, ARWV-1/ARWV-2, and ARWV-1/ApNMV/ARWV-2 infections was 61.9%, 71.4%, and 52.4%, respectively. To our knowledge, this is the first report of ARWV-1 infecting apple trees in China. Further research is needed to determine whether and how ARWV-1 affects apple yield and quality.

First report of apple rubbery wood virus 2 infection of apples in China.

Apple (Malus) is one of the most widely grown fruit trees worldwide, and viral diseases can severely inhibit its growth and development. Apple rubbery wood virus 2 (ARWV-2, family Phenuiviridae) is a negative-sense single-stranded RNA virus whose genome comprises three RNA segments (large: L, medium: M, and small: S) (Rott et al. 2018). This virus is associated with apple rubbery wood disease (Rott et al. 2018) and has previously been found in pear (Pyrus spp.) in China (Wang et al. 2019). In autumn 2019, six trees (one each of cvs. Honglu, Hongzhengzhu, Jinxiuhaitang, Liquanduanfu, Huahong-1, and Huahong-2) showing mosaic disease-like symptoms in the leaves and two trees (one each of cvs. Qingming-1 and Qingming-2) showing rusty skin symptoms (i.e., a large number of irregular rust spots on the peel's surface) in the fruits were found in Xingcheng, Liaoning province, China. Shoots of the diseased plants were collected, and total RNA was extracted from the phloem of the samples as described by Hu et al. (2015). Reverse transcription (RT)-PCR was used to detect various viruses including apple chlorotic leaf spot virus (ACLSV), apple stem pitting virus (ASPV), apple stem grooving virus (ASGV), apple necrotic mosaic virus (ApNMV), and ARWV-2 as well as apple scar skin viroid (ASSVd) using their respective primers (Supplementary Table 1). ACLSV, ASPV and ASGV were detected in all samples. ApNMV was detected in the six trees with leaf mosaic symptoms and ASSVd was detected in the two trees with apple rusty skin symptoms. Moreover, five trees (cvs. Honglu, Hongzhengzhu, Jinxiuhaitang, Qingming-1, and Qingming-2) tested positive for ARWV-2 in the RT-PCR assay. The PCR products of ARWV-2 from Honglu and Qingming-2 were cloned into the pMD18-T vector (Takara, Dalian, China), and one clone of each of the samples was sequenced. BLASTn analyses showed that they shared 98.2%-99.2% nt identity with ARWV-2 sequences (MT901298-MT901299) deposited in the GenBank database. A small RNAs (sRNAs) library was prepared for high-throughput sequencing (HTS) with the Solexa-Illumina platform using phloem tissue collected from a Qingming-2 tree in which apples with rusty skin symptoms were observed. A total of 3,7746,671 reads were obtained from the library. De novo assembly of the reads yielded 1,378 viral sequence contigs. Of those, 20 contigs with lengths ranging from 82 to 387 nt were mapped to the reference genome of ARWV-2 (accession nos. MT733339-MT733344, MT901300-MT901313). In addition, contigs of ACLSV, ASPV, ASGV, ApNMV and ASSVd were detected. To further confirm the HTS results, partial length fragments of segments L (717 bp), M (645 bp), and S (657 bp) of the ARWV-2 genome were amplified from Qingming-2 using primers (Supplementary Table 1) and sequenced. The resulting sequences, which have been deposited in GenBank under the accession numbers MT364372-MT364374, showed 97.2%, 97.8%, and 98.0% nt identity, respectively, with the corresponding segments of ARWV-2 isolate R7 (accession nos. MF062144-MF062146). To understand the infection status of apple trees in China with regard to ARWV-2, 116 apple shoot samples were randomly collected from commercial orchards in Liaoning, Shanxi, and Shandong provinces and subjected to RT-PCR to detect ARWV-2, ACLSV, ASGV, ASPV, ASSVd and ApNMV. In total, 49 (42.2%) of the 116 samples tested positive for ARWV-2, suggesting that this virus is wide spread in apple trees in China (Supplementary Table 2). The mixed-infection rates of ARWV-2/ApNMV and ARWV-2/ASSVd were 18.1% (21/116) and 3.4% (4/116), respectively. Among the 46 ARWV-2-positive samples, seven had mosaic disease-like symptoms in the leaves and three had rusty skin symptoms in the fruits. To our knowledge, this is the first report of ARWV-2 infection in apples showing rusty skin symptoms, as well as the first report of ARWV-2 infection in domestic apples in China. Further research is needed to understand the distribution of ARWV-2 in apple orchards throughout China, to confirm the relationship of ARWV-2 with different symptoms and to evaluate how ARWV-2 affects the performance and quality of apple.

Accuracy of 3-T MRI for Preoperative T Staging of Esophageal Cancer After Neoadjuvant Chemotherapy, With Histopathologic Correlation.

OBJECTIVE: The purpose of this study was to explore the value of 3-T MRI for evaluating the preoperative T staging of esophageal cancer (EC) treated with neoadjuvant chemotherapy (NAC), with histopathologic confirmation. SUBJECTS AND METHODS: This prospective study enrolled patients for whom endoscopic biopsy showed EC and pretreatment CT showed stage cT1N+M0 or cT2-T4aN0-N3M0. All patients received two cycles of NAC (paclitaxel and nedaplatin protocol) followed by 3-T MRI and surgical resection. Readers assigned a T category on MRI, and postoperative pathologic confirmation was considered the reference standard. Interreader agreement, the diagnostic accuracy of T staging on T2-weighted turbo spin-echo (TSE) BLADE (Siemens Healthcare), contrast-enhanced StarVIBE (Siemens Healthcare), high-resolution delayed phase StarVIBE, and the combination of the three sequences were analyzed and compared with postoperative pathologic T staging. RESULTS: The study included 79 patients. Mean time between NAC and MRI was 23 days. Interreader agreements of T category assignment were excellent for T2-weighted TSE BLADE (κ = 0.810, p < 0.0001), contrast-enhanced StarVIBE (κ = 0.845, p < 0.0001), high-resolution delayed phase StarVIBE (κ = 0.897, p < 0.0001), and the combination of the three sequences (κ = 0.880, p < 0.0001). The highest accuracy for T0, T1, T2, and T4a lesions was on high-resolution delayed phase StarVIBE (96.2%, 92.4%, 91.1%, and 91.1% for reader 1; 94.9%, 89.9%, 91.1%, and 94.9% for reader 2), and the highest accuracy for T3 lesions was on T2-weighted TSE BLADE (92.4% and 94.9% for reader 1 and reader 2, respectively). Diagnostic accuracy of the combination of the three sequences was not improved compared with individual sequences. CONCLUSION: High-resolution delayed phase StarVIBE had the highest diagnostic accuracy in staging EC after NAC for all T categories except T3, for which T2-weighted TSE BLADE had the highest accuracy. Combining all three sequences did not improve diagnostic accuracy.

Comparison between free-breathing radial VIBE on 3-T MRI and endoscopic ultrasound for preoperative T staging of resectable oesophageal cancer, with histopathological correlation.

OBJECTIVES: To compare the T staging of resectable oesophageal cancer (OC) using radial VIBE (r-VIBE) and endoscopic ultrasound (EUS) with pathological confirmation of the T stage. METHODS: Forty-three patients with endoscopically proven OC and indeterminate T1/T2/T3/T4a stage by computed tomography (CT) and EUS were imaged on a 3-T magnetic resonance imaging (MRI) scanner. T stage was scored on MRI and EUS by two independent radiologists and one endoscopist, respectively, and compared with postoperative pathological findings. T staging agreement between r-VIBE and EUS with postoperative pathological T staging was analysed by a kappa test. RESULTS: EUS and pathological T staging showed agreement of 69.8% (30/43). Radial VIBE and pathological T staging agreement was 86.0% (37/43) and 90.7% (39/43) for readers 1 and 2, respectively. High accuracy for T1/T2 stage was obtained for both r-VIBE readers (90.5% and 100% for reader 1 and reader 2, respectively) and EUS reader (100%). For T3/T4, r-VIBE showed accuracy of 81.8% and 90.9% for reader 1 and reader 2, respectively, while for EUS, accuracy was only 68.2% compared with pathological T staging. CONCLUSIONS: Contrast-enhanced r-VIBE is comparable to EUS in T staging of resectable OC with stage of T1/T2, and is superior to EUS in staging of T3/T4 lesions. KEY POINTS: • Radial VIBE may be useful in preoperative T staging of OC • Accuracy of staging on r-VIBE is higher in T1/2 than in T3/4 • Accuracy of EUS was 100% and 68.2% for T1/T2 and T3/T4 stage • Inter-reader agreement of T staging for r-VIBE was good.

Complete nucleotide sequence of a new variant of grapevine fanleaf virus from northeastern China.

The complete RNA1 and RNA2 sequences of a new grapevine fanleaf virus isolate (GFLV-SDHN) from northeastern China were determined. The two RNAs are 7,367 and 3,788 nucleotides (nt) in length, respectively, excluding the poly(A) tails. Compared to other GFLV isolates, GFLV-SDHN has a 22- to 24-nt insertion in the RNA1 5' untranslated region, and there was 19.1-20.1 % and 11.7 %-13.0 % sequence divergence in RNA1, and 15.5 %-20.5 % and 8.5-13.5 % in RNA2, at the nt and amino acid level, respectively. Phylogenetic analysis revealed that the origins of GFLV-SDHN are distinct from those of other GFLV isolates. One recombination event was identified in the 2AHP region of RNA2 in GFLV-SDHN.

Occurrence and genetic diversity analysis of apple stem pitting virus isolated from apples in China.

Two primer pairs were used to detect apple stem pitting virus (ASPV) using a reverse transcription (RT)-PCR test. 82 out of the 141 randomly collected samples, from ten orchards in five provinces and regions of China, tested positive. In the positive samples forty-five (55%) were infected by ASPV and two other viruses. The full coat protein (CP) and the triple gene block (TGB) gene 1, 2 and 3 of partial ASPV isolates were subsequently cloned. The nucleotide and amino acid identities of 39 CP sequence variants from 31 Chinese apple samples were compared with that of previously reported ASPV isolates and were 67.4-96.0% and 68.4-97.7%, respectively. All ASPV sequence variants from Chinese apples separated into two clades with CP- and TGB-based phylogenetic trees, whilst the grouping of TGB2 and TGB3 trees was the same. Three recombinants (FS06-2, X5-2, and XLF-C-2) for CP and six (TH2-5, X8-2, FS05-2, X6-2 and XLF-A-1) recombinants for TGB were identified from the Chinese apple isolates. Two recombinants were found in the TGB sequence of isolate XLF-A-1. The results presented here may assist in the development of a more comprehensive screening tool for apple viruses.

Occurrence and Genetic Diversity of Grapevine berry inner necrosis virus from Grapevines in China.

To investigate the prevalence and genetic diversity of Grapevine berry inner necrosis virus (GINV) in China, 195 grapevine samples from 15 Chinese provinces and regions were tested using reverse-transcription polymerase chain reaction. The samples included symptomatic and asymptomatic cultivars, with 35.9% (70 of 195) of samples testing positive for GINV. Seventeen samples had obvious ring spot symptoms, and 94.1% (16 of 17) tested positive for GINV, suggesting that GINV may be highly associated with the ring spot symptom. The genetic diversity of GINV isolates was analyzed based on the partial nucleotide and amino acid sequences of the coat protein (CP) and movement protein (MP) genes. Phylogenetic analyses of the MP and CP gene sequences divided the GINV isolates into three groups. The majority of the Chinese isolates were in groups 1 and 2, and only one Chinese isolate, along with a previously reported Japanese isolate, was in group 3. This is the first report on the genetic diversity of GINV isolates and their prevalence and distribution in China.

In Vivo Neurochemical Characterization of Developing Guinea Pigs and the Effect of Chronic Fetal Hypoxia.

The guinea pig is a frequently used animal model for human pregnancy complications, such as oxygen deprivation or hypoxia, which result in altered brain development. To investigate the impact of in utero chronic hypoxia on brain development, pregnant guinea pigs underwent either normoxic or hypoxic conditions at about 70 % of 65-day term gestation. After delivery, neurochemical profiles consisting of 19 metabolites and macromolecules were obtained from the neonatal cortex, hippocampus, and striatum from birth to 12 weeks postpartum using in vivo (1)H MR spectroscopy at 9.4 T. The effects of chronic fetal hypoxia on the neurochemical profiles were particularly significant at birth. However, the overall developmental trends of neurochemical concentration changes were similar between normoxic and hypoxic animals. Alterations of neurochemicals including N-acetylaspartate (NAA), phosphorylethanolamine, creatine, phosphocreatine, and myo-inositol indicate neuronal loss, delayed myelination, and altered brain energetics due to chronic fetal hypoxia. These observed neurochemical alterations in the developing brain may provide insights into hypoxia-induced brain pathology, neurodevelopmental compromise, and potential neuroprotective measures.

Identification of a divergent variant of grapevine berry inner necrosis virus in grapevines showing chlorotic mottling and ring spot symptoms.

A new variant of grapevine berry inner necrosis virus (GINV) was identified by sequencing of small RNA extracted from 'Beta' and Thompson seedless grapevines showing leaf mottle and ring spot symptoms. However, GINV was not found in symptomless samples used as a control. The complete genome sequences of two GINV isolates (KU234316-17) were determined, and these showed 75.76-89.74% sequence identity to the genome of a previously reported Japanese GINV isolate. The new variants appear to be evolutionarily distinct from the original GINV isolate. This is the first report of GINV outside of Japan.

Chronic fetal hypoxia affects axonal maturation in guinea pigs during development: A longitudinal diffusion tensor imaging and T2 mapping study.

PURPOSE: To investigate the impact of chronic hypoxia on neonatal brains, and follow developmental alterations and adaptations noninvasively in a guinea pig model. Chronic hypoxemia is the prime cause of fetal brain injury and long-term sequelae such as neurodevelopmental compromise, seizures, and cerebral palsy. MATERIALS AND METHODS: Thirty guinea pigs underwent either normoxic and hypoxemic conditions during the critical stage of brain development (0.7 gestation) and studied prenatally (n = 16) or perinatally (n = 14). Fourteen newborns (7 hypoxia and 7 normoxia group) were scanned longitudinally to characterize physiological and morphological alterations, and axonal myelination and injury using in vivo diffusion tensor imaging (DTI), T2 mapping, and T2 -weighted magnetic resonance imaging (MRI). Sixteen fetuses (8 hypoxia and 8 normoxia) were studied ex vivo to assess hypoxia-induced neuronal injury/loss using Nissl staining and quantitative reverse transcriptase polymerase chain reaction methods. RESULTS: Developmental brains in the hypoxia group showed lower fractional anisotropy in the corpus callosum (-12%, P = 0.02) and lower T2 values in the hippocampus (-16%, P = 0.003) compared with the normoxia group with no differences in the cortex (P > 0.07), indicating vulnerability of the hippocampus and cerebral white matter during early development. Fetal guinea pig brains with chronic hypoxia demonstrated an over 10-fold increase in expression levels of hypoxia index genes such as erythropoietin and HIF-1α, and an over 40% reduction in neuronal density, confirming prenatal brain damage. CONCLUSION: In vivo MRI measurement, such as DTI and T2 mapping, provides quantitative parameters to characterize neurodevelopmental abnormalities and to monitor the impact of prenatal insult on the postnatal brain maturation of guinea pigs.

Detection and genetic variation analysis of grapevine fanleaf virus (GFLV) isolates in China.

To investigate the prevalence and genetic variation of grapevine fanleaf virus (GFLV) in China, 142 grapevine samples from 13 provinces and regions were tested using DAS-ELISA, RT-PCR, and nested RT-PCR. Of the samples, 38% tested positive for GFLV by DAS-ELISA, and 26.8% tested positive by RT-PCR and nested RT-PCR. Movement protein (MP) and coat protein (CP) gene PCR products were cloned and sequenced. The MP or CP nucleotide and protein sequences shared identities that ranged from 94.9% to 100%. Phylogenetic analysis revealed that Chinese GFLV isolates obtained in this study were distinct from the isolates reported in GenBank.

Molecular characterizations of two grapevine rupestris stem pitting-associated virus isolates from China.

The complete nucleotide sequences of two isolates of grapevine rupestris stem pitting-associated virus (LSL and JF) collected from grapevine of Xingcheng in Liaoning Province, China, were determined. The genomes of both LSL and JF were found to contain five open reading frames (ORFs). Sequence alignments showed that the genomic sequences of JF were 76.1 %-83.5 % identical to the other ten GRSPaV isolates that have been reported previously and that the nucleotide sequence identity of isolate LSL to other isolates was no more than 78 %. Phylogenetic analysis based on the complete genome sequence indicated that JF belongs to group III and that LSL belongs to a new group (group IV). The average genetic distances of the new genetic lineage from groups I, II and III were 0.34, 0.32 and 0.33, respectively.

Genetic diversity and recombination analysis of grapevine leafroll-associated virus 1 from China.

Grapevine leafroll-associated virus 1 (GLRaV-1) is one of the causal agents of grapevine leafroll disease (GLD). To investigate the prevalence and genetic variation of GLRaV-1 in China, 132 grapevine samples from 14 Chinese provinces and regions were tested using reverse transcription PCR (RT-PCR) and reverse transcription nested PCR (RT-nPCR). The samples included symptomatic and asymptomatic cultivars, and 36.4% of them tested positive for GLRaV-1. 'Beida' samples, previously identified as virus-free rootstocks, were also found to be infected with GLRaV-1 with an incidence of 40 . GLRaV-1 coat protein (CP) genes and heat-shock protein 70 (HSP70) genes from 43 GLRaV-1 isolates were selected and sequenced. Phylogenetic analysis of global CP and HSP70 gene sequences showed that all variants belonged to eight and seven groups, respectively. For CP gene sequence variants, group 4 was a new group that included only Chinese isolates. The results also showed that natural selection, rather than random processes, led to the evolution of variants belonging to CP gene sequence variants in group 2 and group 8. Furthermore, three new recombination events were identified in the GLRaV-1 CP gene population. This is the first report on the genetic variation of GLRaV-1 isolates in China, and this study will benefit grape clean-plant programs in China.

The prognostic values of 12 cirrhosis-relative noninvasive models in patients with hepatocellular carcinoma.

BACKGROUND: Hepatocellular carcinogenesis is associated with the progression of cirrhosis, and the latter further aggravates tumor development and prognosis. The aim of the study was to investigate the prognostic values of 12 cirrhosis-relative noninvasive models in hepatocellular carcinoma (HCC). METHODS: We retrospectively analyzed 363 HCC patients who either underwent partial hepatectomy (PH) or received transcatheter arterial chemoembolization (TCAE). Preoperative data were collected to calculate these indices using the original formulas. Diagnostic accuracy of these models in detection of cirrhosis was evaluated by area under receiver operating characteristic curve (AUC) analysis. Multivariate analyses were performed to assess the independent prognostic significance of the 12 indicators. RESULTS: Aspartate aminotransferase-platelet ratio index (APRI) and Goteborg University Cirrhosis Index (GUCI) were found to be significant in discriminating cirrhotic patients from non-cirrhotic individuals. When the indices were expressed as continuous variables, multivariate analyses indicated that APRI and GUCI were independent indices to predict overall survival in patients underwent PH, with a hazard ratio (HR) value 1.04 (p = 0.005) and 1.07 (p = 0.001), respectively. In the cohort of TACE, APRI and GUCI were independently associated with survival as well. CONCLUSION: Of the 12 indices, APRI and GUCI were relatively accurate predictors of cirrhosis status as well as outcome of HCC. As only a limited study population was enrolled in the current study, larger cohorts are needed to validate our results.