Chemoproteomics Reveals USP5 (Ubiquitin Carboxyl-Terminal Hydrolase 5) as Promising Target of the Marine Polyketide Gracilioether A.

Mass spectrometry-based chemical proteomic approaches using limited proteolysis have become a powerful tool for the identification and analysis of the interactions between a small molecule (SM) and its protein target(s). Gracilioether A (GeA) is a polyketide isolated from a marine sponge, for which we aimed to trace the interactome using this strategy. DARTS (Drug Affinity Responsive Target Stability) and t-LiP-MS (targeted-Limited Proteolysis-Mass Spectrometry) represented the main techniques used in this study. DARTS was applied on HeLa cell lysate for the identification of the GeA target proteins, and t-LiP-MS was employed to investigate the protein's regions involved in the binding with GeA. The results were complemented through the use of binding studies using Surface Plasmon Resonance (SPR) and in silico molecular docking experiments. Ubiquitin carboxyl-terminal hydrolase 5 (USP5) was identified as a promising target of GeA, and the interaction profile of the USP5-GeA complex was explained. USP5 is an enzyme involved in the pathway of protein metabolism through the disassembly of the polyubiquitin chains on degraded proteins into ubiquitin monomers. This activity is connected to different cellular functions concerning the maintenance of chromatin structure and receptors and the degradation of abnormal proteins and cancerogenic progression. On this basis, this structural information opens the way to following studies focused on the definition of the biological potential of Gracilioether A and the rational development of novel USP5 inhibitors based on a new structural skeleton.

Theonella: A Treasure Trove of Structurally Unique and Biologically Active Sterols.

The marine environment is considered a vast source in the discovery of structurally unique bioactive secondary metabolites. Among marine invertebrates, the sponge Theonella spp. represents an arsenal of novel compounds ranging from peptides, alkaloids, terpenes, macrolides, and sterols. In this review, we summarize the recent reports on sterols isolated from this amazing sponge, describing their structural features and peculiar biological activities. We also discuss the total syntheses of solomonsterols A and B and the medicinal chemistry modifications on theonellasterol and conicasterol, focusing on the effect of chemical transformations on the biological activity of this class of metabolites. The promising compounds identified from Theonella spp. possess pronounced biological activity on nuclear receptors or cytotoxicity and result in promising candidates for extended preclinical evaluations. The identification of naturally occurring and semisynthetic marine bioactive sterols reaffirms the utility of examining natural product libraries for the discovery of new therapeutical approach to human diseases.

Expanding the Library of 1,2,4-Oxadiazole Derivatives: Discovery of New Farnesoid X Receptor (FXR) Antagonists/Pregnane X Receptor (PXR) Agonists.

Compounds featuring a 1,2,4-oxadiazole core have been recently identified as a new chemotype of farnesoid X receptor (FXR) antagonists. With the aim to expand this class of compounds and to understand the building blocks necessary to maintain the antagonistic activity, we describe herein the synthesis, the pharmacological evaluation, and the in vitro pharmacokinetic properties of a novel series of 1,2,4-oxadiazole derivatives decorated on the nitrogen of the piperidine ring with different N-alkyl and N-aryl side chains. In vitro pharmacological evaluation showed compounds 5 and 11 as the first examples of nonsteroidal dual FXR/Pregnane X receptor (PXR) modulators. In HepG2 cells, these compounds modulated PXR- and FXR-regulated genes, resulting in interesting leads in the treatment of inflammatory disorders. Moreover, molecular docking studies supported the experimental results, disclosing the ligand binding mode and allowing rationalization of the activities of compounds 5 and 11.

Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction.

The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (ABr), 8-oxo-2'-deoxyadenosine (Aoxo) or ß-L-2'-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.

Genomics-Metabolomics Profiling Disclosed Marine Vibrio spartinae 3.6 as a Producer of a New Branched Side Chain Prodigiosin.

A wide range of prescreening tests for antimicrobial activity of 59 bacterial isolates from sediments of Ria Formosa Lagoon (Algarve, Portugal) disclosed Vibrio spartinae 3.6 as the most active antibacterial producing strain. This bacterial strain, which has not previously been submitted for chemical profiling, was subjected to de novo whole genome sequencing, which aided in the discovery and elucidation of a prodigiosin biosynthetic gene cluster that was predicted by the bioinformatic tool KEGG BlastKoala. Comparative genomics led to the identification of a new membrane di-iron oxygenase-like enzyme, annotated as Vspart_02107, which is likely to be involved in the biosynthesis of cycloprodigiosin and analogues. The combined genomics-metabolomics profiling of the strain led to the isolation and identification of one new branched-chain prodigiosin (5) and to the detection of two new cyclic forms. Furthermore, the evaluation of the minimum inhibitory concentrations disclosed the major prodigiosin as very effective against multi-drug-resistant pathogens including Stenotrophomonas maltophilia, a clinical isolate of Listeria monocytogenes, as well as some human pathogens reported by the World Health Organization as prioritized targets.

Molecular Network and Culture Media Variation Reveal a Complex Metabolic Profile in Pantoea cf. eucrina D2 Associated with an Acidified Marine Sponge.

The Gram-negative Pantoea eucrina D2 was isolated from the marine sponge Chondrosia reniformis. Sponges were collected in a shallow volcanic vents system in Ischia island (South Italy), influenced by CO2 emissions and lowered pH. The chemical diversity of the secondary metabolites produced by this strain, under different culture conditions, was explored by a combined approach including molecular networking, pure compound isolation and NMR spectroscopy. The metabolome of Pantoea cf. eucrina D2 yielded a very complex molecular network, allowing the annotation of several metabolites, among them two biosurfactant clusters: lipoamino acids and surfactins. The production of each class of metabolites was highly dependent on the culture conditions, in particular, the production of unusual surfactins derivatives was reported for the first time from this genus; interestingly the production of these metabolites only arises by utilizing inorganic nitrogen as a sole nitrogen source. Major components of the extract obtained under standard medium culture conditions were isolated and identified as N-lipoamino acids by a combination of 1D and 2D NMR spectroscopy and HRESI-MS analysis. Assessment of the antimicrobial activity of the pure compounds towards some human pathogens, indicated a moderate activity of leucine containing N-lipoamino acids towards Staphylococcus aureus, Staphylococcus epidermidis and a clinical isolate of the emerging food pathogen Listeria monocytogenes.

Chemistry and Pharmacology of GPBAR1 and FXR Selective Agonists, Dual Agonists, and Antagonists.

In the recent years, bile acid receptors FXR and GPBAR1 have attracted the interest of scientific community and companies, as they proved promising targets for the treatment of several diseases, ranging from liver cholestatic disorders to metabolic syndrome, inflammatory states, nonalcoholic steatohepatitis (NASH), and diabetes.Consequently, the development of dual FXR/GPBAR1 agonists, as well as selective targeting of one of these receptors, is considered a hopeful possibility in the treatment of these disorders. Because endogenous bile acids and steroidal ligands, which cover the same chemical space of bile acids, often target both receptor families, speculation on nonsteroidal ligands represents a promising and innovative strategy to selectively target GPBAR1 or FXR.In this review, we summarize the most recent acquisition on natural, semisynthetic, and synthetic steroidal and nonsteroidal ligands, able to interact with FXR and GPBAR1.

Wound healing activity and phytochemical screening of purified fractions of Sempervivum tectorum L. leaves on HCT 116.

INTRODUCTION: Sempervivum tectorum L. (Crassulaceae), is a succulent perennial plant widespread in Mediterranean countries and commonly used in traditional medicine for ear inflammation, ulcers and skin rashes as a refrigerant and astringent. OBJECTIVE: To demonstrate the therapeutic effects of the plant, various fractions were purified and characterised. The potential wound healing activity, proliferation rate and intracellular signalling cascades were investigated by using human epithelial colorectal carcinoma (HCT 116) cells. METHODOLOGY: An extraction method without organic solvents was applied for the first time. The purification was carried out by droplet counter current chromatography (DCCC) coupled with high-performance liquid chromatography (HPLC) and electrospray ionisation mass spectrometry (ESI-MS) data. By nuclear magnetic resonance (NMR) [1 H, 13 C and two-dimensional (2D) experiments] pure components were identified. Wound healing and cell proliferation assays were utilised to determine the role of the isolated S. tectorum (SVT) fraction on cellular migration and proliferation. The signalling pathways elicited from the SVT fractions, were analysed by Western blot analysis. RESULTS: In this study two rare natural components were identified, namely monosaccharide sedoheptulose and polyalcohol 2-C-methyl-D-erythritol, along with known organic acids and flavonoids. The fractions with high level of sedoheptulose enhance the proliferation and the cellular migration of epithelial HCT 116 cells. The intracellular signalling cascades elicited from the purified fractions induce the c-Src-mediated transactivation of EGFR and the activation of the STAT3 pathway which, in turn, are crucially involved in the cellular proliferation and migration. CONCLUSIONS: Our study demonstrates the efficacy of purified fractions of S. tectorum L. in enhancing cellular proliferation and migration, suggesting their potential role as topical therapeutic treatments for wound healing.

Phytochemical and Biological Studies of Nepeta asterotricha Rech. f. (Lamiaceae): Isolation of Nepetamoside.

The n-butanolic extract, from an Iranian specimen of Nepeta asterotricha Rech. f. (NABE), displayed anti-inflammatory effects on lipopolysaccharide (LPS)-stimulated J774A.1 macrophages, which reduced nitrites and cytokines production. Bioassay guided fractionation of the extract led to the isolation of four iridoid glycosides, including a new one known as nepetamoside (1), one hexenyl-diglycoside, and some polyphenol and flavonoid components. None of the isolated iridoid components displayed significant effects on nitrites formation in an in vitro LPS-induced model of inflammation, thus suggesting that the plant anti-inflammatory effect is probably due to a synergistic action among its constituents.

Determination of Gymnemic Acid I as a Protein Biosynthesis Inhibitor Using Chemical Proteomics.

The plant Gymnema sylvestre has been used widely in traditional medicine as a remedy for several diseases, and its leaf extract is known to contain a group of bioactive triterpene saponins belonging to the gymnemic acid class. Gymnemic acid I (1) is one of the main components among this group of secondary metabolites and is endowed with an interesting bioactivity profile. Since there is a lack of information about its specific biological targets, the full interactome of 1 was investigated through a quantitative chemical proteomic approach, based on stable-isotope dimethyl labeling. The ribosome complex was found to be the main partner of compound 1, and a full validation of the proteomics results was achieved by orthogonal approaches. Further biochemical and biological investigations revealed an inhibitory effect of 1 on the ribosome machinery.

Discovering the Biological Target of 5-epi-Sinuleptolide Using a Combination of Proteomic Approaches.

Sinuleptolide and its congeners are diterpenes with a norcembranoid skeleton isolated from the soft coral genus Sinularia. These marine metabolites are endowed with relevant biological activities, mainly associated with cancer development. 5-epi-sinuleptolide has been selected as a candidate for target discovery studies through the application of complementary proteomic approaches. Specifically, a combination of conventional chemical proteomics based on affinity chromatography, coupled with high-resolution mass spectrometry and bioinformatics, as well as drug affinity responsive target stability (DARTS), led to a clear identification of actins as main targets for 5-epi-sinuleptolide. Subsequent in-cell assays, performed with cytochalasin D as reference compound, gave information on the ability of 5-epi-sinuleptolide to disrupt the actin cytoskeleton by loss of actin fibers and formation of F-actin amorphous aggregates. These results suggest the potential application of 5-epi-sinuleptolide as a useful tool in the study of the molecular processes impaired in several disorders in which actin is thought to play an essential role.

Scalarane sesterterpenes from Thorectidae sponges as inhibitors of TDP-43 nuclear factor.

The analysis of two Thorectidae sponge samples, Hyrtios sp. and Petrosaspongia sp., collected at Fiji Islands, led to the isolation of five new scalarane derivatives along with fifteen known compounds. Their structures were elucidated on the basis of NMR and MS spectroscopic data. The small library of natural scalarane derivatives was investigated for their ability to modulate the activity of trans-activation response DNA-binding protein of 43 kDa (TDP-43), a key factor in several neurodegenerative conditions and the study resulted in the identification of potent inhibitors of TDP-43 protein.

Marine and semi-synthetic hydroxysteroids as new scaffolds for pregnane X receptor modulation.

In recent years many sterols with unusual structures and promising biological profiles have been identified from marine sources. Here we report the isolation of a series of 24-alkylated-hydroxysteroids from the soft coral Sinularia kavarattiensis, acting as pregnane X receptor (PXR) modulators. Starting from this scaffold a number of derivatives were prepared and evaluated for their ability to activate the PXR by assessing transactivation and quantifying gene expression. Our study reveals that ergost-5-en-3ß-ol (4) induces PXR transactivation in HepG2 cells and stimulates the expression of the PXR target gene CYP3A4. To shed light on the molecular basis of the interaction between these ligands and PXR, we investigated, through docking simulations, the binding mechanism of the most potent compound of the series, 4, to the PXR. Our findings provide useful functional and structural information to guide further investigations and drug design.

Bioactive cembrane derivatives from the Indian Ocean soft coral, Sinularia kavarattiensis.

Marine organisms and their metabolites represent a unique source of potential pharmaceutical substances. In this study, we examined marine-derived substances for their bioactive properties in a cell-based Chikungunya virus (CHIKV) replicon model and for in vitro anti-inflammatory activity. In the screening of a marine sample library, crude extracts from the Indian soft coral, Sinularia kavarattiensis, showed promising activity against the CHIKV replicon. Bioassay-guided chemical fractionation of S. kavarattiensis resulted in the isolation of six known norcembranoids (1-6) and one new compound, named kavaranolide (7). The structures were elucidated on the basis of NMR and MS spectroscopic data. Compounds 1-3 and 5-7 were evaluated for their replicon-inhibiting potential in the CHIKV model by using a luminescence-based detection technique and live cell imaging. Compounds 1 and 2 showed moderate inhibition of the CHIKV replicon, but imaging studies also revealed cytotoxic properties. Moreover, the effects of the isolated compounds on primary microglial cells, an experimental model for neuroinflammation, were evaluated. Compound 2 was shown to modulate the immune response in microglial cells and to possess potential anti-inflammatory properties by dose-dependently reducing the release of pro- and anti-inflammatory cytokines.

BAR502/fibrate conjugates: synthesis, biological evaluation and metabolic profile.

BAR502, a bile acid analogue, is active as dual FXR/GPBAR1 agonist and represents a promising lead for the treatment of cholestasis and NASH. In this paper we report the synthesis and the biological evaluation of a library of hybrid compounds prepared by combining, through high-yield condensation reaction, some fibrates with BAR502.The activity of the new conjugates was evaluated towards FXR, GPBAR1 and PPARα receptors, employing transactivation or cofactor recruitment assays. Compound 1 resulted as the most promising of the series and was subjected to further pharmacological investigation, together with stability evaluation and cell permeation assessment. We have proved by LCMS analysis that compound 1 is hydrolyzed in mice releasing clofibric acid and BAR505, the oxidized metabolite of BAR502, endowed with retained dual FXR/GPBAR1 activity.

Oxygenated polyketides from Plakinastrella mamillaris as a new chemotype of PXR agonists.

Further purification of the apolar extracts of the sponge Plakinastrella mamillaris, afforded a new oxygenated polyketide named gracilioether K, together with the previously isolated gracilioethers E-G and gracilioethers I and J. The structure of the new compound has been elucidated by extensive NMR (1H and 13C, COSY, HSQC, HMBC, and ROESY) and ESI-MS analysis. With the exception of gracilioether F, all compounds are endowed with potent pregnane-X-receptor (PXR) agonistic activity and therefore represent a new chemotype of potential anti-inflammatory leads. Docking calculations suggested theoretical binding modes of the identified compounds, compatible with an agonistic activity on hPXR, and clarified the molecular basis of their biological activities.

Plakilactones G and H from a marine sponge. Stereochemical determination of highly flexible systems by quantitative NMR-derived interproton distances combined with quantum mechanical calculations of (13)C chemical shifts.

In this paper the stereostructural investigation of two new oxygenated polyketides, plakilactones G and H, isolated from the marine sponge Plakinastrella mamillaris collected at Fiji Islands, is reported. The stereostructural studies began on plakilactone H by applying an integrated approach of the NOE-based protocol and quantum mechanical calculations of (13)C chemical shifts. In particular, plakilactone H was used as a template to extend the application of NMR-derived interproton distances to a highly flexible molecular system with simultaneous assignment of four non-contiguous stereocenters. Chemical derivatization and quantum mechanical calculations of (13)C on plakilactone G along with a plausible biogenetic interconversion between plakilactone G and plakilactone H allowed us to determine the absolute configuration in this two new oxygenated polyketides.

Chemical proteomics reveals heat shock protein 60 to be the main cellular target of the marine bioactive sesterterpene suvanine.

Marine bioactive compounds are potential drug leads because of their diverse pharmacological effects against human diseases. The identification of their cellular targets is crucial for a rational approach to their application in medicinal chemistry. Thus, we have analyzed the cell interactome of suvanine, a sulfated tricyclic terpenoid of marine origin endowed with an interesting anti-inflammatory activity, by application of a chemical proteomic approach. Heat Shock Protein 60, a chaperone involved in the inflammatory response, is the main cellular target of suvanine, which is also able to interfere with protein chaperone activity, giving evidence for its anti-inflammatory properties.

Novel steroidal components from the underground parts of Ruscus aculeatus L.

Two new furostanol saponins 1–2 and three new sulphated glycosides 3a,b and 4 were isolated from the underground parts of Ruscus aculeatus L., along with four known furostanol and one spirostanol saponins 5–9 and three free sterols. All of the structures have been elucidated on the basis of spectroscopic data 1D and 2D NMR experiments, MS spectra and GC analyses.

Lauroside B, a megastigmane glycoside from Laurus nobilis (bay laurel) leaves, induces apoptosis in human melanoma cell lines by inhibiting NF-κB activation.

Malignant melanoma is a highly aggressive tumor that frequently resists chemotherapy, so the search for new agents for its treatment is of great importance. In the present study, the antiproliferative propensity against human melanoma cell lines of lauroside B (1), a megastigmane glycoside isolated from Laurus nobilis (bay laurel) leaves, was investigated. This compound suppressed the proliferation of three human melanoma cell lines, namely, A375, WM115, and SK-Mel-28. The 1-induced inhibition of human melanoma cell proliferation was due to the induction of apoptosis, as demonstrated by FACS analysis with annexin V/PI staining and confirmed by activation of caspase-3 and by the cleavage of poly(ADP-ribose) polymerase (PARP). Growing evidence implicates NF-κB as an important contributor to metastasis and increased chemoresistance of melanoma. Thus, it was hypothesized that 1-induced apoptosis could be associated with suppression of NF-κB activation. The results showed that exposure of human melanoma cells to 1 inhibited IκB-α degradation and constitutive NF-κB DNA-binding activity as well as the expression, regulated by NF-κB, of two antiapoptotic genes, XIAP and c-FLIP. Induction of apoptosis by 1 in human aggressive melanoma cell lines has a potential high biological value.