Transposons played a major role in the diversification between the closely related almond and peach genomes: results from the almond genome sequence.

We sequenced the genome of the highly heterozygous almond Prunus dulcis cv. Texas combining short- and long-read sequencing. We obtained a genome assembly totaling 227.6 Mb of the estimated almond genome size of 238 Mb, of which 91% is anchored to eight pseudomolecules corresponding to its haploid chromosome complement, and annotated 27 969 protein-coding genes and 6747 non-coding transcripts. By phylogenomic comparison with the genomes of 16 additional close and distant species we estimated that almond and peach (Prunus persica) diverged around 5.88 million years ago. These two genomes are highly syntenic and show a high degree of sequence conservation (20 nucleotide substitutions per kb). However, they also exhibit a high number of presence/absence variants, many attributable to the movement of transposable elements (TEs). Transposable elements have generated an important number of presence/absence variants between almond and peach, and we show that the recent history of TE movement seems markedly different between them. Transposable elements may also be at the origin of important phenotypic differences between both species, and in particular for the sweet kernel phenotype, a key agronomic and domestication character for almond. Here we show that in sweet almond cultivars, highly methylated TE insertions surround a gene involved in the biosynthesis of amygdalin, whose reduced expression has been correlated with the sweet almond phenotype. Altogether, our results suggest a key role of TEs in the recent history and diversification of almond and its close relative peach.

Identification of trans-AT polyketide clusters in two marine bacteria reveals cryptic similarities between distinct symbiosis factors.

Glutarimide-containing polyketides are known as potent antitumoral and antimetastatic agents. The associated gene clusters have only been identified in a few Streptomyces producers and Burkholderia gladioli symbiont. The new glutarimide-family polyketides, denominated sesbanimides D, E and F along with the previously known sesbanimide A and C, were isolated from two marine alphaproteobacteria Stappia indica PHM037 and Labrenzia aggregata PHM038. Structures of the isolated compounds were elucidated based on 1D and 2D homo and heteronuclear NMR analyses and ESI-MS spectrometry. All compounds exhibited strong antitumor activity in lung, breast and colorectal cancer cell lines. Subsequent whole genome sequencing and genome mining revealed the presence of the trans-AT PKS gene cluster responsible for the sesbanimide biosynthesis, described as sbn cluster. Strikingly, the modular architecture of downstream mixed type PKS/NRPS, SbnQ, revealed high similarity to PedH in pederin and Lab13 in labrenzin gene clusters, although those clusters are responsible for the production of structurally completely different molecules. The unexpected presence of SbnQ homologues in unrelated polyketide gene clusters across phylogenetically distant bacteria, raises intriguing questions about the evolutionary relationship between glutarimide-like and pederin-like pathways, as well as the functionality of their synthetic products.

Unravelling a new catabolic pathway of C-19 steroids in Mycobacterium smegmatis.

In this work, we have characterized the C-19+ gene cluster (MSMEG_2851 to MSMEG_2901) of Mycobacterium smegmatis. By in silico analysis, we have identified the genes encoding enzymes involved in the modification of the A/B steroid rings during the catabolism of C-19 steroids in certain M. smegmatis mutants mapped in the PadR-like regulator (MSMEG_2868), that constitutively express the C-19+ gene cluster. By using gene complementation assays, resting-cell biotransformations and deletion mutants, we have characterized the most critical genes of the cluster, that is, kstD2, kstD3, kshA2, kshB2, hsaA2, hsaC2 and hsaD2. These results have allowed us to propose a new catabolic route named C-19+ pathway for the mineralization of C-19 steroids in M. smegmatis. Our data suggest that the deletion of the C-19+ gene cluster may be useful to engineer more robust and efficient M. smegmatis strains to produce C-19 steroids from sterols. Moreover, the new KshA2, KshB2, KstD2 and KstD3 isoenzymes may be useful to design new microbial cell factories for the 9α-hydroxylation and/or Δ1-dehydrogenation of 3-ketosteroids.

Molecular characterization of a new gene cluster for steroid degradation in Mycobacterium smegmatis.

The C-19 steroids 4-androstene-3,17-dione (AD), 1,4-androstadiene-3,17-dione (ADD) or 9α-hydroxy-4-androstene-3,17-dione (9OH-AD), which have been postulated as intermediates of the cholesterol catabolic pathway in Mycobacterium smegmatis, cannot be used as sole carbon and energy sources by this bacterium. Only the ΔkstR mutant which constitutively expresses the genes repressed by the KstR regulator can metabolize AD and ADD with severe difficulties but still cannot metabolize 9OH-AD, suggesting that these compounds are not true intermediates but side products of the cholesterol pathway. However, we have found that some M. smegmatis spontaneous mutants mapped in the PadR-like regulator (MSMEG_2868) can efficiently metabolize all C-19 steroids. We have demonstrated that the PadR mutants allow the expression of a gene cluster named C-19+ (MSMEG_2851 to MSMEG_2901) encoding steroid degrading enzymes, that are not expressed under standard culture conditions. The C-19+ cluster has apparently evolved independently from the upper cholesterol kstR-regulon, but both clusters converge on the lower cholesterol kstR2-regulon responsible for the metabolism of C and D steroid rings. Homologous C-19+ clusters have been found only in other actinobacteria that metabolize steroids, but remarkably it is absent in Mycobacterium tuberculosis.

Molecular and functional analysis of the mce4 operon in Mycobacterium smegmatis.

Mycobacterium smegmatis contains 6 homologous mce (mammalian cell entry) operons which have been proposed to encode ABC-like import systems. The mce operons encode up to 10 different proteins of unknown function that are not present in conventional ABC transporters. We have analysed the consequences of individually deleting each of the genes of the mce4 operon of M. smegmatis, which mediates the transport of cholesterol. None of the mce4 mutants were able to grow in cholesterol suggesting that all these genes are required for its uptake and that none of them can be replaced by the homologous genes of the other mce operons. This result suggests that different mce operons do not provide redundant capabilities and that M. smegmatis, in contrast with Mycobacterium tuberculosis, is not able to use alternative systems to import cholesterol in the analysed culture conditions. Either deletion of the entire mce4 operon or single point mutations that eliminate the transport function cause a phenotype similar to the one observed in a mutant lacking all 6 mce operons suggesting a pleiotropic role for this system.

Unravelling the pleiotropic role of the MceG ATPase in Mycobacterium smegmatis.

The Mce systems are complex ABC transporters that are encoded by different numbers of homologous operons in Actinobacteria. While the four Mce systems of Mycobacterium tuberculosis are all energized by a single ATPase, MceG, each system appears to import different fatty acids or sterols. To explore if this behaviour can be extended to saprophytic mycobacteria, whose more complex genomes encode more Mce systems, we have identified and characterized the MceG orthologue of Mycobacterium smegmatis. This bacterium relies on MceG to energize its six Mce systems that contribute to a variety of cellular functions including sterol uptake and cell envelope maintenance. In the absence of MceG, M. smegmatis was not able to utilize cholesterol or phytosterols as carbon sources implying that this ATPase is necessary to energize the Mce4-sterol transport system. Other phenotypic alterations observed in the ΔMceG mutant, such as cell envelope modifications, suggest a pleiotropic functionality of the Mce systems that are particularly important for stress responses. Several ΔMceG phenotypes were recapitulated in a strain lacking only the unique C-terminal region of MceG, suggesting an important functional or regulatory function for this domain.

Deciphering the transcriptional regulation of cholesterol catabolic pathway in mycobacteria: identification of the inducer of KstR repressor.

Cholesterol degradation plays a prominent role in Mycobacterium tuberculosis infection; therefore, to develop new tools to combat this disease, we need to decipher the components comprising and regulating the corresponding pathway. A TetR-like repressor (KstR) regulates the upper part of this complex catabolic pathway, but the induction mechanism remains unknown. Using a biophysical approach, we have discovered that the inducer molecule of KstR in M. smegmatis mc(2)155 is not cholesterol but 3-oxo-4-cholestenoic acid, one of the first metabolic intermediates. Binding this compound induces dramatic conformational changes in KstR that promote the KstR-DNA interaction to be released from the operator, retaining its dimeric state. Our findings suggest a regulatory model common to all cholesterol degrading bacteria in which the first steps of the pathway are critical to its mineralization and explain the high redundancy of the enzymes involved in these initial steps.

Identification of the aldolase responsible for the production of 22-hydroxy-23,24-bisnorchol-4-ene-3-one from natural sterols in Mycolicibacterium smegmatis.

Mycobacterial mutants blocked in ring degradation constructed to achieve C19 synthons production, also accumulate by-products such as C22 intermediates throughout an alternative pathway reducing the production yields and complicating the downstream purification processing of final products. In this work, we have identified the MSMEG_6561 gene, encoding an aldolase responsible for the transformation of 22-hydroxy-3-oxo-cholest-4-ene-24-carboxyl-CoA (22-OH-BCN-CoA) into the 22-hydroxy-23,24-bisnorchol-4-ene-3-one (4-HBC) precursor (20S)-3-oxopregn-4-ene-20-carboxaldehyde (3-OPA). The deletion of this gene increases the production yield of the C-19 steroidal synthon 4-androstene-3,17-dione (AD) from natural sterols, avoiding the production of 4-HBC as by-product and the drawbacks in the AD purification. The molar yield of AD production using the MS6039-5941-6561 triple mutant strain was checked in flasks and bioreactor improving very significantly compared with the previously described MS6039-5941 strain.

Boosting hydrogen production in Rhodospirillum rubrum by syngas-driven photoheterotrophic adaptive evolution.

Rhodospirillum rubrum is a photosynthetic purple non-sulphur bacterium with great potential to be used for complex waste valorisation in biotechnological applications due to its metabolic versatility. This study investigates the production of hydrogen (H2) and polyhydroxyalkanoates (PHA) by R. rubrum from syngas under photoheterotrophic conditions. An adaptive laboratory evolution strategy (ALE) has been carried out to improve the yield of the process. After 200 generations, two evolved strains were selected that showed reduced lag phase and enhanced poly-3-hydroxybutyrate (PHB) and H2 synthesis compared to the parental strain. Genomic analysis of the photo-adapted (PA) variants showed four genes with single point mutations, including the photosynthesis gene expression regulator PpsR. The proteome of the variants suggested that the adapted variants overproduced H2 due to a more efficient CO oxidation through the CO-dehydrogenase enzyme complex and confirmed that energy acquisition was enhanced through overexpression of the photosynthetic system and metal cofactors essential for pigment biosynthesis.

Tailoring modifications in labrenzin synthesis: a-la-carte production of pathway intermediates.

Pederin-family polyketides today constitute a group of more than 30 molecules being produced as natural products by different microorganisms across multitude of ecological niches. They are mostly known for their extreme cytotoxic activity and the decades of long exploration as potential antitumor drugs. The difference in their potency and biological activity lies in the tailoring modifications of the core molecule. Despite the isolation of many pederin-like molecules until the date, only marine bacterium Labrenzia sp. PHM005 was reported as a cultivable producer and able to be genetically modified. Here, we study the role of tailoring enzymes from the lab gene cluster responsible for methylation and hydroxylation of labrenzin core molecule. We managed to produce a spectrum of differently tailored labrenzin analogs for the development of future drugs. This work constitutes one-step forward in understanding the biosynthesis of pederin-family polyketides and provides the tools to modify and overproduce these anticancer drugs in a-la-carte manner in Labrenzia sp. PHM005, but also in other producers in the future.

Structural characterization of PaaX, the main repressor of the phenylacetate degradation pathway in Escherichia coli W: A novel fold of transcription regulator proteins.

PaaX is a transcriptional repressor of the phenylacetic acid (PAA) catabolic pathway, a central route for bacterial aerobic degradation of aromatic compounds. Induction of the route is achieved through the release of PaaX from its promoter sequences by the first compound of the pathway, phenylacetyl-coenzyme A (PA-CoA). We report the crystal structure of PaaX from Escherichia coli W. PaaX displays a novel type of fold for transcription regulators, showing a dimeric conformation where the monomers present a three-domain structure: an N-terminal winged helix-turn-helix domain, a dimerization domain similar to the Cas2 protein and a C-terminal domain without structural homologs. The domains are separated by a crevice amenable to harbour a PA-CoA molecule. The biophysical characterization of the protein in solution confirmed several hints predicted from the structure, i.e. its dimeric conformation, a modest importance of cysteines and a high dependence of solubility and thermostability on ionic strength. At a moderately acidic pH, the protein formed a stable folding intermediate with remaining α-helical structure, a disrupted tertiary structure and exposed hydrophobic patches. Our results provide valuable information to understand the stability and mechanism of PaaX and pave the way for further analysis of other regulators with similar structural configurations.

Characterization of Limnospira platensis PCC 9108 R-M and CRISPR-Cas systems.

The filamentous cyanobacterium Limnospira platensis, formerly known as Arthrospira platensis or spirulina, is one of the most commercially important species of microalgae. Due to its high nutritional value, pharmacological and industrial applications it is extensively cultivated on a large commercial scale. Despite its widespread use, its precise manipulation is still under development due to the lack of effective genetic protocols. Genetic transformation of Limnospira has been attempted but the methods reported have not been generally reproducible in other laboratories. Knowledge of the transformation defense mechanisms is essential for understanding its physiology and for broadening their applications. With the aim to understand more about the genetic defenses of L. platensis, in this work we have identified the restriction-modification and CRISPR-Cas systems and we have cloned and characterized thirteen methylases. In parallel, we have also characterized the methylome and orphan methyltransferases using genome-wide analysis of DNA methylation patterns and RNA-seq. The identification and characterization of these enzymes will be a valuable resource to know how this strain avoids being genetically manipulated and for further genomics studies.

A highly conserved mycobacterial cholesterol catabolic pathway.

Degradation of the cholesterol side-chain in Mycobacterium tuberculosis is initiated by two cytochromes P450, CYP125A1 and CYP142A1, that sequentially oxidize C26 to the alcohol, aldehyde and acid metabolites. Here we report characterization of the homologous enzymes CYP125A3 and CYP142A2 from Mycobacterium smegmatis mc(2) 155. Heterologously expressed, purified CYP125A3 and CYP142A2 bound cholesterol, 4-cholesten-3-one, and antifungal azole drugs. CYP125A3 or CYP142A2 reconstituted with spinach ferredoxin and ferredoxin reductase efficiently hydroxylated 4-cholesten-3-one to the C-26 alcohol and subsequently to the acid. The X-ray structures of both substrate-free CYP125A3 and CYP142A2 and of cholest-4-en-3-one-bound CYP142A2 reveal significant differences in the substrate binding sites compared with the homologous M. tuberculosis proteins. Deletion only of cyp125A3 causes a reduction of both the alcohol and acid metabolites and a strong induction of cyp142 at the mRNA and protein levels, indicating that CYP142A2 serves as a functionally redundant back up enzyme for CYP125A3. In contrast to M. tuberculosis, the M. smegmatis Δcyp125Δcyp142 double mutant retains its ability to grow on cholesterol albeit with a diminished capacity, indicating an additional level of redundancy within its genome.

Production of 11α-Hydroxysteroid Derivatives by Corynebacterium glutamicum Expressing the Rhizopus oryzae Hydroxylating System.

Hydroxylation of steroids has acquired special relevance for the pharmaceutical industry. Particularly, the 11α-hydroxylation of steroids is a process of biotechnological importance currently carried out at industrial scale for the production of contraceptive drugs and glucocorticoids. This process is performed by several fungal species including Rhizopus nigricans, Aspergillus ochraceus, Aspergillus niger, and Rhizopus oryzae that are used to produce by biotransformation hydroxylated steroids for pharmaceutical purposes (Wang et al., J Steroid Biochem Mol Biol 171:254-261, 2017). However, the development of more efficient biotransformation processes is essential since the steroidal derivatives obtained by the in vivo hydroxylation are often a mixture of hydroxylated compounds in different positions of the steroid molecule. This phenomenon is due to the large number of different CYPs contained in the fungal strains.The genes responsible for the 11α-hydroxylase activity in R. oryzae consisting in the cytochrome CYP509C12 and its redox partner, the reductase RoCPR1, have been chemically synthetized forming a synthetic operon named FUN optimized to be expressed in bacteria. To express this operon, we have selected the strain Corynebacterium glutamicum R31 that is a robust and GRAS bacterial strain widely used for industrial purposes. The synthetic operon has been cloned in the pECXK-99E vector, yielding pXKFUN plasmid, and transformed C. glutamicum R31 to generate C. glutamicum R31 (pXKFUN) strain. This strain is not a steroid degrader and can efficiently transport C19 and C21 steroids across the cytoplasmic membrane (García-Fernandez et al. Catalysts 316:1-12, 2017). C. glutamicum can be used as a clean host for steroid biotransformation, because it does not introduce additional undesired side reactions on the steroids, thus reducing the contamination of the final products (Felpeto-Santero et al., Microbiol Biotechnol 12:856-868, 2019). Here we show a proof of concept that C. glutamicum can be used as a suitable chassis to perform steroid biotransformation expressing eukaryotic cytochromes. The protocol below provides detailed information on steroid 11α-hydroxylations by Corynebacterium recombinant strain.

Genome sequence of the methanotrophic poly-ß-hydroxybutyrate producer Methylocystis parvus OBBP.

Methylocystis parvus OBBP is an obligate methylotroph considered the type species of the genus Methylocystis. Two pmoCAB particulate methane monooxygenase operons and one additional singleton pmoC paralog were identified in the sequence. No evidence of genes encoding soluble methane monooxygenase was found. Comparison of M. parvus OBBP and Methylocystis sp. strain Rockwell (ATCC 49242) suggests that both species should be taxonomically classified in different genera.

Integrating greenhouse gas capture and C1 biotechnology: a key challenge for circular economy.

State of the art on the valorisation of C1 carbon sources obtained either from natural or anthropogenic origins as a key challenge for the circular economy.

Polyhydroxyalkanoate Production by Caenibius tardaugens from Steroidal Endocrine Disruptors.

The α-proteobacterium Caenibius tardaugens can use estrogens and androgens as the sole carbon source. These compounds are steroidal endocrine disruptors that are found contaminating soil and aquatic ecosystems. Here, we show that C. tardaugens, which has been considered as a valuable biocatalyst for aerobic steroidal hormone decontamination, is also able to produce polyhydroxyalkanoates (PHA), biodegradable and biocompatible polyesters of increasing biotechnological interest as a sustainable alternative to classical oil-derived polymers. Steroid catabolism yields a significant amount of propionyl-CoA that is metabolically directed towards PHA production through condensation into 3-ketovaleryl-CoA, rendering a PHA rich in 3-hydroxyvalerate. To the best of our knowledge, this is the first report where PHAs are produced from steroids as carbon sources.

Transcriptional response of the xerotolerant Arthrobacter sp. Helios strain to PEG-induced drought stress.

A new bacterial strain has been isolated from the microbiome of solar panels and classified as Arthrobacter sp. Helios according to its 16S rDNA, positioning it in the "Arthrobacter citreus group." The isolated strain is highly tolerant to desiccation, UV radiation and to the presence of metals and metalloids, while it is motile and capable of growing in a variety of carbon sources. These characteristics, together with observation that Arthrobacter sp. Helios seems to be permanently prepared to handle the desiccation stress, make it very versatile and give it a great potential to use it as a biotechnological chassis. The new strain genome has been sequenced and its analysis revealed that it is extremely well poised to respond to environmental stresses. We have analyzed the transcriptional response of this strain to PEG6000-mediated arid stress to investigate the desiccation resistance mechanism. Most of the induced genes participate in cellular homeostasis such as ion and osmolyte transport and iron scavenging. Moreover, the greatest induction has been found in a gene cluster responsible for biogenic amine catabolism, suggesting their involvement in the desiccation resistance mechanism in this bacterium.

In vivo production of pederin by labrenzin pathway expansion.

Pederin is a potent polyketide toxin that causes severe skin lesions in humans after contact with insects of genus Paederus. Due to its potent anticancer activities, pederin family compounds have raised the interest of pharmaceutical industry. Despite the extensive studies on the cluster of biosynthetic genes responsible for the production of pederin, it has not yet been possible to isolate and cultivate its bacterial endosymbiont producer. However, the marine bacterium Labrenzia sp. PHM005 was recently reported to produce labrenzin, the closest pederin analog. By cloning a synthetic pedO gene encoding one of the three O-methyltraferase of the pederin cluster into Labrenzia sp. PHM005 we have been able to produce pederin for the first time by fermentation in the new recombinant strain.

Characterization of the KstR-dependent promoter of the gene for the first step of the cholesterol degradative pathway in Mycobacterium smegmatis.

The KstR-dependent promoter of the MSMEG_5228 gene of Mycobacterium smegmatis, which encodes the 3-ß-hydroxysteroid dehydrogenase (3-ß HSD(MS)) responsible for the first step in the cholesterol degradative pathway, has been characterized. Primer extension analysis of the P5228 promoter showed that the transcription starts at the ATG codon, thus generating a leaderless mRNA lacking a 5' untranslated region (5'UTR). Footprint analyses demonstrated experimentally that KstR specifically binds to an operator region of 31 nt containing the quasi-palindromic sequence AACTGGAACGTGTTTCAGTT, located between the -5 and -35 positions with respect to the transcription start site. This region overlaps with the -10 and -35 boxes of the P5228 promoter, suggesting that KstR represses MSMEG_5228 transcription by preventing the binding of RNA polymerase. Using a P5228-ß-galactosidase fusion we have demonstrated that KstR is able to work as a repressor in a heterologous system like Escherichia coli. A 3D model of the KstR protein revealed folding typical of TetR-type regulators, with two domains, i.e. a DNA-binding N-terminal domain and a regulator-binding C-terminal domain composed of six helices with a long tunnel-shaped hydrophobic pocket that might interact with a putative highly hydrophobic inducer. The finding that similar P5228 promoter regions have been found in all mycobacterial strains examined, with the sole exception of Mycobacterium tuberculosis, provides new clues about the role of cholesterol in the pathogenicity of this micro-organism.