Recreating the natural evolutionary trend in key microdomains provides an effective strategy for engineering of a thermomicrobial N-demethylase.

N-demethylases have been reported to remove the methyl groups on primary or secondary amines, which could further affect the properties and functions of biomacromolecules or chemical compounds; however, the substrate scope and the robustness of N-demethylases have not been systematically investigated. Here we report the recreation of natural evolution in key microdomains of the Thermomicrobium roseum sarcosine oxidase (TrSOX), an N-demethylase with marked stability (melting temperature over 100 °C) and enantioselectivity, for enhanced substrate scope and catalytic efficiency on -C-N- bonds. We obtained the structure of TrSOX by crystallization and X-ray diffraction (XRD) for the initial framework. The natural evolution in the nonconserved residues of key microdomains-including the catalytic loop, coenzyme pocket, substrate pocket, and entrance site-was then identified using ancestral sequence reconstruction (ASR), and the substitutions that accrued during natural evolution were recreated by site-directed mutagenesis. The single and double substitution variants catalyzed the N-demethylation of N-methyl-L-amino acids up to 1800- and 6000-fold faster than the wild type, respectively. Additionally, these single substitution variants catalyzed the terminal N-demethylation of non-amino-acid compounds and the oxidation of the main chain -C-N- bond to a -C=N- bond in the nitrogen-containing heterocycle. Notably, these variants retained the enantioselectivity and stability of the initial framework. We conclude that the variants of TrSOX are of great potential use in N-methyl enantiomer resolution, main-chain Schiff base synthesis, and alkaloid modification or degradation.

Insight into the Cold Adaptation Mechanism of an Aerobic Denitrifying Bacterium: Bacillus simplex H-b.

Psychrophilic bacteria with aerobic denitrification ability have promising potential for application in nitrogen-contaminated wastewater treatment, especially under cold conditions. A better understanding of the cold adaptation mechanism during aerobic denitrification would be beneficial for the practical application of this type of functional bacterium. In this study, Bacillus simplex H-b with good denitrification performance at 5°C was used to investigate the corresponding cold tolerance mechanism. Transcriptomics and nitrogen removal characterization experiments were conducted at different temperatures (5°C, 20°C, and 30°C). At low temperatures, more nitrogen was utilized for assimilation, accompanied by the accumulation of ATP and extracellular polymeric substances (EPS), rather than transforming inorganic nitrogen in the dissimilation pathway. In addition, the proportion of unsaturated fatty acids was higher in strains cultured at low temperatures. At the molecular level, the adjustment of membrane transport, synthesis of cofactors and vitamins, and transcriptional regulators might contribute to the survival of the strain under cold conditions. Moreover, nucleotide precursor synthesis, translation, and oxidative and temperature stress response mechanisms also enhanced the resistance of strain H-b to low temperatures. The results suggest that combining multiple regulatory mechanisms and synergistic adaptation to cold stress enabled the growth and relatively high nitrogen removal rate (27.22%) of strain H-b at 5°C. By clarifying the mechanism of regulation and cold resistance of strain H-b, a theoretical foundation for enhancing the application potential of this functional bacterium for nitrogen-contaminated wastewater treatment was provided. IMPORTANCE The newly isolated aerobic denitrifying bacterium Bacillus simplex H-b removed various forms of inorganic nitrogen (nitrate, nitrite, and ammonium) from wastewater, even when the temperature was as low as 5°C. Although this environmentally functional bacterium has been suggested as a promising candidate for nitrogen-contaminated water treatment at low temperatures, understanding its cold adaptation mechanism during aerobic denitrification is limited. In this study, the cold tolerance mechanism of this strain was comprehensively explained. Furthermore, a theoretical basis for the practical application of this type of functional bacterium for nitrogen removal in cold regions is provided. The study expands our understanding of the survival strategy of psychrophilic bacteria and hence supports their further utilization in wastewater treatment applications.

Integrated metabolomics and network pharmacology to reveal the mechanism of areca nut addiction.

As a chewing hobby, areca nut (Areca catechu L.) has become the most common psychoactive substance in the world, besides tobacco, alcohol and caffeinated beverages. Moreover, as a first-class carcinogen designated by International Agency for Research on Cancer, long-term chewing areca nut can result in oral mucosal diseases and even oral cancer. To clarify the potential mechanism of areca nut addiction, an integrated strategy of metabolomics and network pharmacology was adopted in this study. Network pharmacology study indicated that all the key targets related to areca nut addiction could be regulated by arecoline and pointed out the importance of G-protein coupled receptor signalling pathway. Analysis results of mice plasma metabolome and faeces metabolome intervened by arecoline suggested that the component may affect the dopamine system and 5-HT system by regulating phenylalanine, tyrosine and tryptophan biosynthesis, phenylalanine metabolism, primary bile acid biosynthesis, glycerophospholipid metabolism and intestinal flora structure. Moreover, the potential importance of bile acids in formation of addictive behaviour of chewing areca nut was investigated by integrative analysis of the relationships between metabolites and intestinal flora. The study can provide scientific basis for the addiction intervention and treatment of areca nut chewers.

Trehalose metabolism targeting as a novel strategy to modulate acid tolerance of yeasts and its application in food industry.

Some spoilage yeasts are able to develop resistance to commonly used weak-acid preservatives. We studied the trehalose metabolism and its regulation in Saccharomyces cerevisiae in response to propionic acid stress. We show interruption of trehalose synthetic pathway caused the mutant hypersensitive to the acid stress, while its overexpression conferred acid-tolerance to yeast. Interestingly, this acid-tolerance phenotype was largely independent of trehalose but relied on the trehalose synthetic pathway. We demonstrate trehalose metabolism played a vital role in regulation of glycolysis flux and Pi/ATP homeostasis in yeast during acid-adaptation, and the PKA and TOR signaling pathways were involved in regulating trehalose synthesis at transcriptional level. This work confirmed the regulatory function of trehalose metabolism and improved our understanding of molecular mechanism of acid-adaptation of yeast. By exemplifying trehalose metabolism interruption limited the growth of S. cerevisiae exposed to weak acids, and trehalose pathway overexpression conferring acid-resistance to Yarrowia lipolytica enhanced citric acid production, this work provides new insights into the development of efficient preservation strategies and robust organic acid producers.

Up Front Unfolded Protein Response Combined with Early Protein Secretion Pathway Engineering in Yarrowia lipolytica to Attenuate ER Stress Caused by Enzyme Overproduction.

Engineering the yeast Yarrowia lipolytica as an efficient host to produce recombinant proteins remains a longstanding goal for applied biocatalysis. During the protein overproduction, the accumulation of unfolded and misfolded proteins causes ER stress and cell dysfunction in Y. lipolytica. In this study, we evaluated the effects of several potential ER chaperones and translocation components on relieving ER stress by debottlenecking the protein synthetic machinery during the production of the endogenous lipase 2 and the E. coli ß-galactosidase. Our results showed that improving the activities of the non-dominant translocation pathway (SRP-independent) boosted the production of the two proteins. While the impact of ER chaperones is protein dependent, the nucleotide exchange factor Sls1p for protein folding catalyst Kar2p is recognized as a common contributor enhancing the secretion of the two enzymes. With the identified protein translocation components and ER chaperones, we then exemplified how these components can act synergistically with Hac1p to enhance recombinant protein production and relieve the ER stress on cell growth. Specifically, the yeast overexpressing Sls1p and cytosolic heat shock protein Ssa8p and Ssb1p yielded a two-fold increase in Lip2p secretion compared with the control, while co-overexpressing Ssa6p, Ssb1p, Sls1p and Hac1p resulted in a 90% increase in extracellular ß-galp activity. More importantly, the cells sustained a maximum specific growth rate (µmax) of 0.38 h-1 and a biomass yield of 0.95 g-DCW/g-glucose, only slightly lower than that was obtained by the wild type strain. This work demonstrated engineering ER chaperones and translocation as useful strategies to facilitate the development of Y. lipolytica as an efficient protein-manufacturing platform.

Engineering of Bacillus Promoters Based on Interacting Motifs between UP Elements and RNA Polymerase (RNAP) α-Subunit.

Bacillus genetics need more versatile promoters for gene circuit engineering. UP elements are widely distributed in noncoding regions and interact with the α-subunit of RNA polymerase (RNAP). They can be applied as a standard element for synthetic biology. Characterization of the binding motif between UP elements and RNAP may assist with rational and effective engineering. In this study, 11 Bacillus constitutive promoters were screened for strength in Bacillus licheniformis. The motif in UP elements from a strong native promoter, PLan, was characterized. The influence of specific sequences on RNAP binding and expression strength was investigated both in vitro and in vivo. It was found that sequences up to 50 base pairs upstream of the consensus motif significantly contributed to α-CTD (the alpha subunit carboxy-terminal domain) association. Meanwhile, two repeats of a proximal subsite were able to more strongly activate the expression (by 8.2-fold) through strengthening interactions between UP elements and RNAP. Based the above molecular basis, a synthetic UP element, UP5-2P, was constructed and applied to nine wild-type promoters. Fluorescence polarization results demonstrated that it had an apparent effect on promoter-α-CTD interactions, and elevated expression strength was observed for all the engineered promoters. The highest improved core promoter, Pacpp, was more strongly activated by 7.4-fold. This work thus develops a novel strategy for Bacillus promoter engineering.

Analysis of Xylose Operon from Paenibacillus polymyxa ATCC842 and Development of Tools for Gene Expression.

With numerous industrial applications, Paenibacillus polymyxa has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in P. polymyxa have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was "ACTTAGTTTAAGCAATAGACAAAGT", and this can be degenerated to "ACTTWGTTTAWSSNATAVACAAAGT" in Paenibacillus spp., which differs from that in the Bacillus spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter Pshuttle-09. The eGFP fluorescence intensity assay indicated that both the modified and original Pshuttle-09 had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in Paenibacillus spp. that can dynamically regulate its gene circuit strength through xylose.

Recombinant Human Arresten and Canstatin Inhibit Angiogenic Behaviors of HUVECs via Inhibiting the PI3K/Akt Signaling Pathway.

Angiogenetic inhibitors are crucial in tumor therapy, and endogenous angiogenesis inhibitors have attracted considerable attention due to their effectiveness, safety, and multi-targeting ability. Arresten and canstatin, which have anti-angiogenesis effects, are the c-terminal fragments of the α1 and α2 chains of type IV collagen, respectively. In this study, human arresten and canstatin were recombinantly expressed in Escherichia coli (E. coli), and their effects on the proliferation, migration and tube formation of human umbilical vein endothelial cells (HUVECs) were evaluated. Regarding the cell cycle distribution test and 5-ethynyl-2'-deoxyuridine (EdU) assays, arresten and canstatin could repress the proliferation of HUVECs at a range of concentrations. Transwell assay indicated that the migration of HUVECs was significantly decreased in the presence of arresten and canstatin, while tube formation assays suggested that the total tube length and junction number of HUVECs were significantly inhibited by these two proteins; moreover, they could also reduce the expression of vascular endothelial growth factor (VEGF) and the phosphorylation levels of PI3K and Akt, which indicated that the activation of the 3-kinase/serine/threonine-kinase (PI3K/Akt) signaling pathway was inhibited. These findings may have important implications for the soluble recombinant expression of human arresten and canstatin, and for the related therapy of cancer.

Preparation and Characterization of an Ancient Aminopeptidase Obtained from Ancestral Sequence Reconstruction for L-Carnosine Synthesis.

As a biologically active peptide, L-carnosine has been widely used in the pharmaceutical, cosmetic and health care industries due to its various physiological properties. However, relatively little research is available regarding L-carnosine's enzymatic synthesis function. In this study, a potential enzyme sequence with the function of carnosine synthesizing was screened out using the ancestral sequence reconstruction (ASR) technique. Identified with L-carnosine synthesis activity, this enzyme was further confirmed using autoproteolytic phenomenon via Western blot and N-terminal sequencing. After purification, the enzymatic properties of LUCA-DmpA were characterized. The melting temperature (Tm) and denaturation enthalpy (ΔH) of LUCA-DmpA were 60.27 ± 1.24 °C and 1306.00 ± 26.73 kJ·mol-1, respectively. Circular dichroism (CD) spectroscopy results showed that this ancestral enzyme was composed of α-helix (35.23 ± 0.06%), ß-sheet (11.06 ± 0.06%), ß-turn (23.67 ± 0.06%) and random coil (32.03 ± 0.06%). The enzyme was characterized with the optimal temperature and pH of 45 °C and 9.0, respectively. Notably, LUCA-DmpA was also characterized with remarkable pH tolerance based on the observation of more than 85% remaining enzymatic activity after incubation at different pH buffers (pH = 6-11) for 12 h. Additionally, rather than being improved or inhibited by metal ions, its enzymatic activity was found to be promoted by introducing organic solvent with a larger log P value. Based on these homology modeling results, the screened LUCA-DmpA is suggested to have further optimization potential, and thereafter to be offered as a promising candidate for real industrial applications.

A Novel Regulator Participating in Nitrogen Removal Process of Bacillus subtilis JD-014.

Aerobic denitrification is considered as a promising biological method to eliminate the nitrate contaminants in waterbodies. However, the molecular mechanism of this process varies in different functional bacteria. In this study, the nitrogen removal characteristics for a newly isolated aerobic denitrifier Bacillus subtilis JD-014 were investigated, and the potential functional genes involved in the aerobic denitrification process were further screened through transcriptome analysis. JD-014 exhibited efficient denitrification performance when having sodium succinate as the carbon source with the range of nitrate concentration between 50 and 300 mg/L. Following the transcriptome data, most of the up-regulated differentially expressed genes (DEGs) were associated with cell motility, carbohydrate metabolism, and energy metabolism. Moreover, gene nirsir annotated as sulfite reductase was screened out and further identified as a regulator participating in the nitrogen removal process within JD-014. The findings in present study provide meaningful information in terms of a comprehensive understanding of genetic regulation of nitrogen metabolism, especially for Bacillus strains.

Construction of a novel sugar alcohol-inducible expression system in Bacillus licheniformis.

Bacillus licheniformis is an important industrial microorganism that can utilize a wide range of biomass. However, the lack of expression elements in B. licheniformis, especially regulated promoters, significantly restricts its applications. In this study, two promoters involved in the sugar alcohol uptake pathway, PmtlA and PmtlR, were characterized and developed as regulated promoters for expression. The results showed that mannitol, mannose, sorbitol, sorbose, and arabinose can act as inducers to activate expression from PmtlA at different levels. The induction by sorbitol was the strongest, and the optimal induction conditions were 15 g/L sorbitol during mid-logarithmic growth at 28 °C. In this work, the palindrome-like sequence 'TTGTCA-cacggctcc-TGCCAA' in PmtlA was identified as the binding site of the MtlR protein. This study helps to enrich the known inducible expression systems in B. licheniformis.

Unraveling the specific regulation of the shikimate pathway for tyrosine accumulation in Bacillus licheniformis.

L-Tyrosine serves as a common precursor for multiple valuable secondary metabolites. Synthesis of this aromatic amino acid in Bacillus licheniformis occurs via the shikimate pathway, but the underlying mechanisms involving metabolic regulation remain unclear. In this work, improved L-tyrosine accumulation was achieved in B. licheniformis via co-overexpression of aroGfbr and tyrAfbr from Escherichia coli to yield strain 45A12, and the L-tyrosine titer increased to 1005 mg/L with controlled glucose feeding. Quantitative RT-PCR results indicated that aroA, encoding DAHP synthase, and aroK, encoding shikimate kinase, were feedback-repressed by the end product L-tyrosine in the modified strain. Therefore, the native aroK was first expressed with multiple copies to yield strain 45A13, which could accumulate 1201 mg/L L-tyrosine. Compared with strain 45A12, the expression of aroB and aroF in strain 45A13 was upregulated by 21% and 27%, respectively, which may also have resulted in the improvement of L-tyrosine production. Furthermore, supplementation with 5 g/L shikimate enhanced the L-tyrosine titers of 45A12 and 45A13 by 29.1% and 24.0%, respectively. However, the yield of L-tyrosine per unit of shikimate decreased from 0.365 to 0.198 mol/mol after aroK overexpression in strain 45A12, which suggested that the gene product was also involved in uncharacterized pathways. This study provides a good starting point for further modification to achieve industrial-scale production of L-tyrosine using B. licheniformis, a generally recognized as safe workhorse.

Transcriptional Changes in the Xylose Operon in Bacillus licheniformis and Their Use in Fermentation Optimization.

The xylose operon is an efficient biological element used for the regulation of gene expression in Bacillus licheniformis. Although the mechanism underlying the xylose-mediated regulation of this operon has been elucidated, the transcriptional changes that occur under various fermentation conditions remain unclear. In this study, the effects of different conditions on xylose operon expression were investigated. Significant upregulation was observed during the transition from the logarithmic phase to the stationary phase (2.5-fold, n = 3, p < 0.01). Glucose suppressed transcription over 168-fold (n = 3, p < 0.01). Meanwhile, the inhibitory effect of glucose hardly strengthened at concentrations from 20 to 180 g/L. Furthermore, the transcription of the xylose operon increased at elevated temperatures (25-42 °C) and was optimal at a neutral pH (pH 6.5-7.0). Based on these findings, relevant fermentation strategies (delaying the induction time, using dextrin as a carbon source, increasing the fermentation temperature, and maintaining a neutral pH) were proposed. Subsequently, these strategies were validated through the use of maltogenic amylase as a reporter protein, as an 8-fold (n = 3, p < 0.01) increase in recombinant enzyme activity compared to that under unoptimized conditions was observed. This work contributes to the development of fermentation optimization and furthers the use of the xylose operon as an efficient expression element.

Inducible expression of trehalose synthase in Bacillus licheniformis.

Trehalose synthase (TreS) could transform maltose into trehalose via isomerization. It is a crucial enzyme in the process of trehalose enzymatical transformation. In this study, plasmid-based inducible expression systems were constructed to produce Thermomonospora curvata TreS in B. licheniformis. Xylose operons from B. subtilis, B. licheniformis and B. megaterium were introduced to regulate the expression of the gene encoding TreS. It was functionally expressed, and the BlsTs construct yielded the highest enzyme activity (12.1 U/mL). Furthermore, the effect of different cultural conditions on the inducible expression of BlsTs was investigated, and the optimal condition was as follows: 4% maltodextrin, 0.4% soybean powder, 1% xylose added after 10 h of growth and an induction time of 12 h at 37 °C. As a result, the maximal yield reached 24.7 U/mL. This study contributes to the industrial application of B. licheniformis, a GRAS workhorse for enzyme production.

Engineering of isoamylase: improvement of protein stability and catalytic efficiency through semi-rational design.

Isoamylase catalyzes the hydrolysis of α-1,6-glycosidic linkages in glycogen, amylopectin and α/ß-limit dextrins. A semi-rational design strategy was performed to improve catalytic properties of isoamylase from Bacillus lentus. Three residues in vicinity of the essential residues, Arg505, Asn513, and Gly608, were chosen as the mutation sites and were substituted by Ala, Pro, Glu, and Lys, respectively. Thermal stability of the mutant R505P and acidic stability of the mutant R505E were enhanced. The k cat /K m values of the mutant G608V have been promoted by 49%, and the specific activity increased by 33%. This work provides an effective strategy for improving the catalytic activity and stability of isoamylase, and the results obtained here may be useful for the improvement of catalytic properties of other α/ß barrel enzymes.

[Physiological and metabolic characteristics of five xylose utilizing yeasts].

OBJECTIVE: It is of great significance to improve the utilization of lignocellulosic material, the most abundant renewable resource on earth. METHODS: We studied the stress tolerance (temperature, ethanol and osmotic tolerance) of five xylose utilizing yeasts, Scheffersomyces stipitis, Candida tenuis, Spathaspora passalidarum, Candida amazonensis and Candida jeffriesii. We also tested their utilization ability of multiple carbon and nitrogen sources. RESULTS: S. passalidarum could tolerate at 44 degrees C and utilize various carbon and nitrogen sources effectively. S. passalidarum could metabolism xylose rapidly to produce ethanol, with an ethanol yield of 0.43 g/g under oxygen limiting condition. C. amazonensis could also torelate at 42 degrees C. Moreover, C. amazonensis could converse xylose to xylitol with ethanol as the main by-product. CONCLUSION: S. passalidarum is a potentially valuable workhorse in industrial utilization of lignocellulosic for its excellent characteristics. In addition, C. amazonensis may be a promising xylitol producer.

[Overexpression, purification and characterization of phospholipase C from Acinetobacter calcoaceticus].

OBJECTIVE: In this study, we constructed two recombinant Escherichia coli strains to produce phospholipase C (PLC) from Acinetobacter calcoaceticus. The recombinant enzymes were purified to homogeneity and characterized. [Methods] We cloned the PLC encoding gene plc1, plc2 from genome DNA of A. calcoaceticus ATCC17902. The amplified fragments were inserted into pET28a(+ to obtain expression plasmids. E. coli BL21 (DE3) harboring the above plasmids were cultivated and induced with isopropyl-beta-D-thiogalactopyranoside to express PLCs. The recombinant PLCs were purified by affinity chromatography and their catalytic properties were characterized. RESULTS: Two PLCs from A. calcoaceticus were cloned and functional expressed in E. coli. The recombinant enzymes have activities of 31,160 +/- 418 U/mg for PLC1 and 13640 +/- 354 U/mg for PLC2, when using p-nitrophenyl phosphorycholine as substrate. The purified PLC1 and PLC2 exhibited optimum temperature at 65 degrees C and 50 degrees C, respectively. Their optimal pH were 8 and 7.5, respectively. PLC2 was stable under 40 degrees C and pH at 8, whereas the residual activity of PLC1 was less than 25% in the same condition. Mg2+ and Ca2+ stimulated two enzymes activity, whereas Zn2. stimulated PLC1 and inhibited PLC2. PLC1 and PLC2 hydrolyzed phosphatidylinositol. CONCLUSION: It is the first time to express and characterize the PLC gene from A. calcoaceticus ATCC17902. These research results provide reference for the study of food-safety microbiological PLC.

Enhanced degradation of phenolic pollutants by a novel cold-adapted laccase from Peribacillus simplex.

Laccase (EC 1.10.3.2), as eco-friendly biocatalysts, holds immense potential for sustainable applications across various environmental and industrial sectors. Despite the growing interest, the exploration of cold-adapted laccases, especially their unique properties and applicability, remains limited. In this study, we have isolated, cloned, expressed, and purified a novel laccase from Peribacillus simplex (GenBank: PP430751), which was derived from permafrost layer. The recombinant laccase (PsLac) exhibited optimal activity at 30 °C and a pH optimum of 3.5. Remarkably, PsLac exhibited remarkable stability in the presence of organic solvents, with its enzyme activity increasing by 20 % after being incubated in a 30 % trichloromethane solution for 12 h, compared to its initial activity. Furthermore, the enzyme preserved 100 % of its activity after undergoing eight freeze-thaw cycles. Notably, the catalytic center of PsLac contains Zn2+ instead of the typically observed Cu2+ found in other laccases, and metal-ion substitution experiments raised the catalytic efficiency to 3-fold when Zn2+ was replaced with Fe2+. Additionally, PsLac has demonstrated a proficient ability to degrade phenolic pollutants, such as hydroquinone, even at a low temperature of 16 °C, positioning it as a promising candidate for environmental bioremediation and contributing to cleaner production processes.

A novel phosphotriesterase hybrid nanoflower-hydrogel sensor equipped with a smartphone detector for real-time on-site monitoring of organophosphorus pesticides.

Designing efficient and rapid methods for the detection of organophosphorus pesticides (OPs) residue is a prerequisite to mitigate their negative health impacts. In this study, we propose the concept of an enzyme catalysis system-based hydrogel kit integrated with a smartphone detector for in-field screening of OPs. Here, we rapidly prepared phosphotriesterase hybrid nanoflowers (PTE-HNFs) using a self-assembly strategy by adding external energy and embedded the nanocomposite in sodium alginate (SA) hydrogel to construct a target-responsive hydrogel kit. The color response of the kit is induced by catalyzing methyl parathion (MP) to produce p-nitrophenol. For on-site quantification, the color variations of the portable kit are converted into digital information through a smartphone, which exhibits an applicable linear range towards OPs. The hydrogel sensing platform demonstrates a wide linear range (1-150 µM) and low detection limit (0.15 µM) for MP while maintaining high reliability, excellent long-term stability, and ease of operation. Overall, the PTE-HNFs-based SA hydrogel kit provides a useful strategy for simple and sensitive detection of MP and holds great potential for applications in detecting OPs in food and environmental water.

Catalytic Cleavage of the C-O Bonds in Lignin and Lignin Model Compounds by Metal Triflate Catalysts.

The effective cleavage of C-O bonds in linkages of lignin was one of the significant strategies promoting lignin valorization. Herein, the strategy of C-O bonds cleavage of lignin using metal triflate as the catalyst was developed. The carboxylic acid or alcohol could be used as the nucleophile to stabilize the reactive intermediates formed during the depolymerization of lignin, and the corresponding ester/ether compounds could be obtained. This catalytic system was suitable for the C-O bond cleavage in α-O-4 and ß-O-4 linkages with excellent efficiency. Additionally, reaction conditions were optimized. The reaction mixture was detected by 1 H NMR, and no other byproducts were found. As for treated lignin samples, the cleavage of C-O bonds in linkages was determined by 2D HSQC NMR, the increased content of the phenol hydroxyl group was proved by FT-IR, and the reduced molecular weight was investigated by GPC. Furthermore, multiple phenolic compounds were detected by GC-MS in the reaction mixtures.