Induction of Krüppel-like factor 2 reduces K/BxN serum-induced arthritis.

Krüppel-like factor 2 (KLF2) critically regulates activation and function of monocyte, which plays important pathogenic role in progressive joint destruction in rheumatoid arthritis (RA). It is yet to be established the molecular basis of KLF2-mediated regulation of monocytes in RA pathogenesis. Herein, we show that a class of compound, HDAC inhibitors (HDACi) induced KLF2 expression in monocytes both in vitro and in vivo. KLF2 level was also elevated in tissues, such as bone marrow, spleen and thymus in mice after infusion of HDACi. Importantly, HDACi significantly reduced osteoclastic differentiation of monocytes with the up-regulation of KLF2 and concomitant down-regulation of matrixmetalloproteinases both in the expression level as well as in the protein level. In addition, HDACi reduced K/BxN serum-induced arthritic inflammation and joint destruction in mice in a dose-dependent manner. Finally, co-immunoprecipitation and overexpression studies confirmed that KLF2 directly interacts with HDAC4 molecule in cells. These findings provide mechanistic evidence of KLF2-mediated regulation of K/BxN serum-induced arthritic inflammation.

Patterns of major wound complications following multidisciplinary therapy for lower extremity soft tissue sarcoma.

BACKGROUND AND OBJECTIVES: The purpose of this study was to determine the pattern and timing of major wound complications (MWCs) in patients at our institution who received multimodality treatment for lower extremity soft tissue sarcoma (LE-STS) and to evaluate the impact of MWCs on tumor control and patient outcomes. METHODS: The medical records of 102 LE-STS patients treated with limb-sparing surgery and radiation therapy were reviewed. MWCs were defined as secondary operations with anesthesia, seroma/hematoma aspiration, admission for IV antibiotics, or persistent deep packing. RESULTS: MWCs occurred in 22% of patients, with 45% of events occurring >120 days after resection. On multivariate analysis, preoperative external beam radiation therapy (EBRT) (OR 4.29, 95% CI 1.06-17.40, P = 0.042) and skin graft placement (OR 6.39, 95% CI 1.37-29.84, P = 0.018) were found to be independent predictors of MWCs. MWC occurrence did not predict for chronic toxicity and did not impact tumor control or survival. CONCLUSIONS: A considerable proportion of MWCs occur >120 days from surgical resection with preoperative EBRT and skin graft placement independent predictors for MWCs. While an additional source of morbidity, MWC occurrence did not impact tumor control, nor did it predict for chronic toxicity. J. Surg. Oncol. 2016;114:385-391. © 2016 Wiley Periodicals, Inc.

Human sarcomas are mosaic for telomerase-dependent and telomerase-independent telomere maintenance mechanisms: implications for telomere-based therapies.

Telomere shortening necessitates that tumor cells activate a telomere maintenance mechanism (TMM) to support immortalization. Although most tumor cells activate expression of the enzyme telomerase, some cells elongate telomeres in a telomerase-independent manner, termed alternative lengthening of telomeres (ALT). Previous studies have evaluated the presence of telomerase or ALT mechanisms or both in a variety of tumor types. Our studies also show that TMMs are not mutually exclusive in some tumors. In contrast, our IHC analyses of human sarcomas identified a subset of tumors with some cells containing ALT-associated PML bodies, a hallmark of ALT, and separate cells expressing telomerase in the same tumor. By using a second set of human osteosarcomas, we merged IHC and biochemical analyses to characterize more fully the tumor TMM. The IHC data reveal the presence of both telomerase- and ALT-positive tumor cells in samples that demonstrate characteristics of both telomerase and ALT in biochemical assays. These assays, which measure telomere length and telomerase activity of tumor extracts, are conventionally used to classify tumor TMM. Our results suggest that TMM is not a single or perhaps static characteristic of some tumors and that TMM heterogeneity should be considered in tumor stratification. Furthermore, clinical interest in telomere-based therapies may necessitate accurate characterization of tumor TMM before treatment to maximize therapeutic efficacy.

Fulminant and accelerated presentation of dermatomyositis in two previously healthy young adult males: a potential role for endotheliotropic viral infection.

BACKGROUND: Dermatomyositis (DM) is a prototypic autoimmune syndrome, whereby immune-based microvascular injury is critical in the pathogenesis of skin lesions and the myopathy. Although not widely recognized or accepted as a pathogenetic trigger, endotheliotropic viral triggers including parvovirus B19 and cytomegalovirus have been linked to DM. At times, the clinical manifestations in DM can be fulminant with acute renal failure because of rhabdomyolysis, respiratory failure and gastrointestinal infarcts. METHODS: Skin and lung tissues were processed for hematoxylin and eosin, immunohistochemical, immunofluorescent and reverse transcriptase in situ polymerase chain reaction studies. CASE PRESENTATION: We present two cases of fatal DM in previously healthy immunocompetent males. One case had fatal catastrophic respiratory failure from diffuse alveolar damage; herpes simplex virus-2 RNA was uncovered in lung and skin biopsies during autopsy in the absence of classic cytopathic changes of herpes virus infection. The other case showed a Degos-like syndrome; parvovirus B19 RNA transcripts were found in cutaneous endothelium of affected skin. CONCLUSION: An accelerated clinical course can occur in the setting of DM in previously healthy patients. A viral-based etiology should be explored because antiviral therapy may define a critical and potentially lifesaving therapeutic endeavor.

Idiosyncrasies of scalp melanoma.

OBJECTIVES/HYPOTHESIS: Examine the accuracy of sentinel lymph node biopsy (SNB) in scalp melanoma (SM), patterns of nodal metastases, patient outcomes, and the utility of immunohistochemistry (IHC) in SNB evaluation. STUDY DESIGN: Retrospective. METHODS: There were 22 patients, 4 females and 18 males. Sentinel lymph nodes (SLN) were localized via preoperative lymphoscintigraphy, intraoperative gamma probe, and Lymphazurin injection. SLNs were stained with hematoxylin-eosin, S-100, HMB-45, Melan-A, micropthalmia transcription factor, and tyrosinase. SLNs were grouped into cervical (levels 1-5) and extracervical (parotid, suboccipital, retroauricular) regions. RESULTS: There were 13 posterior and 9 anterior SMs. The first SNB were mapped to the extracervical regions in 77% of posterior and 78% of anterior lesions. SLN number ranged from 1 to 5. Ten patients had positive SLNs (PSLN). Forty percent of the PSLN group had SLNs mapped in both cervical and extracervical sites. Six underwent completion lymphadenectomy, with no additional positive nodes identified. No significant difference between PSLN and negative sentinel node (NSLN) patients was seen when compared by SLN number, Breslow's thickness, tumor ulceration, and clinical outcomes. Mean follow-up was 35 months. One patient died of disease. One isolated regional recurrence occurred. Sixty percent of PSLN and 92% of NSLN patients were recurrence free at last follow-up. One distant metastasis occurred in the NSLN group, and one local, one regional, and two patients with distant metastases were in the PSLN group at the time of last follow-up. Additional IHC did not detect other metastases in the NSLN group. CONCLUSIONS: SM is aggressive, as demonstrated by the high rate of SLN metastases, and there were no significant histopathologic factors in the primary tumor that predicted the presence of SLN metastases. SNB was accurate. The majority of first SLNs were localized in extracervical basins.

Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma.

Alveolar soft part sarcoma (ASPS) is an exquisitely rare sarcoma of unknown histogenesis, with a predilection for adolescents and young adults, characterized by slow progressive clinical course and high frequency of metastases. They are traditionally chemoresistant with very limited treatment options in the metastatic setting. Human cytomegalovirus (HCMV) is a DNA ß-herpes virus and it is characterized by persistent lifelong and latent infection. There is growing evidence to indicate the presence of HCMV proteins and nucleic acids in glioblastoma, medulloblastoma, rhabdomyosarcoma, and a variety of solid organ malignancies of the breast, prostate, lung, and colon at very high prevalence. Immunotherapy-based clinical trials targeting specific cytomegalovirus proteins are currently in progress in the treatment of glioblastoma. Herein, we evaluated for the presence of HCMV proteins (IE1 and pp65), genes (US28 and UL96), and RNA in a cohort of ASPS. Six confirmed cases of ASPS were retrieved and full thickness sections of formalin-fixed paraffin-embedded material were stained for anti-HMCV-IE1 and anti-HCMV-pp65. Any nuclear and/or cytoplasmic staining was considered positive. DNA was purified from 50 µm of formalin-fixed paraffin-embedded material. One hundred nanogram of DNA was amplified using polymerase chain reaction for primers specific to HCMV-US28 (forward: AGCGTGCCGTGTACGTTAC and reverse: ATAAAGACAAGCACGACC) and HCMV-UL96 (forward: ACAGCTCTTAAAGGACGTGATGCG and reverse: ACCGTGTCCTTCAGCTCGGTTAAA) using Promega Taq polymerase. HCMV in situ hybridization was performed. All 6 cases of ASPS were positive for both HCMV-IE1 and HCMV-pp65. Usable DNA was available in 4 of the 6 cases. HCMV-US28 gene was found in 75% (3/4) of cases and HCMV-UL96 gene was detected in 50% (2/4) of cases. Importantly, all cases tested positive for at least 1 gene. HCMV-encoded RNA was identified in 80% (4/5) of cases. The presence of HCMV DNA, RNA along with HCMV protein indicates that HCMV is present in ASPS and may contribute to its pathogenesis.

TGF-ß and CTGF are Mitogenic Output Mediators of Wnt/ß-Catenin Signaling in Desmoid Fibromatosis.

Desmoid fibromatosis is a locally aggressive clonal fibroblastic proliferation with high recurrence rates and no metastatic potential. Implicated molecular aberrations occur within the Wnt/ß-catenin pathway (APC and ß-catenin gene mutations). Transforming growth factor-ß (TGF-ß) and connective tissue growth factor (CTGF) are profibrotic growth factors, downstream from nuclear translocation of ß-catenin, that lead to increased fibrogenesis. CTGF (a downstream effector of TGF-ß) is a matricellular protein that modulates the activity of growth factors, adhesion molecules, integrins, and extracellular matrix thus playing a central role in tissue remodeling and fibrosis. Recently there has been growing interest in use of extracellular matrix inhibitors for treatment of various fibrogenic diseases. Desmoid fibromatosis samples (n=15) were evaluated for expression of ß-catenin, TGF-ß, and CTGF using immunohistochemistry on formalin paraffin-embedded material. A control group comprising scar tissue and adjacent normal skin (n=10) were simultaneously immunostained with above mentioned markers. Real-time polymerase chain reaction was performed on frozen specimens of desmoid fibromatosis (n=6) and normal skin (n=2). All 15 desmoid tumors were positive for ß-catenin (surrogate marker of Wnt/ß-catenin pathway dysregulation) which was negative in control normal skin and scar samples. TGF-ß and CTGF were negative in 9 of 10 normal skin controls. TGF-ß and CTGF were positive in all cases of scar tissue. All 15 cases of desmoid tumors were positive for TGF-ß and CTGF. The real-time polymerase chain reaction showed higher expression levels of TGF-ß and CTGF in desmoid fibromatosis compared with normal skin. The high constitutive expression of ß-catenin downstream effectors; TGF-ß, CTGF has the potential for enabling targeted therapy.

Novel Clonal der(9)t(5;9)(q31;q34) Cytogenetic Translocation in a Giant Cell Tumor of Bone.

Giant cell tumor of the bone (GCTB) is a benign but locally aggressive neoplasm of long bones with higher chances of local recurrence. Many cytogenetic studies have reported clonal telomeric associations with GCTB. Here, we report for the first time a novel clonal translocation, der(9)t(5;9)(q31;q34), in a 25-year-old male patient with GCTB in the left distal femur. The biological significance of this translocation remains to be determined.

Novel Clonal t(2;4) (q23;p14) Secondary Cytogenetic Abnormality in a Primary Myxoid Liposarcoma.

Myxoid liposarcomas are malignant lipomatous tumors with a predilection for young adults. They are characterized by the presence of reciprocal translocation between the CHOP (DDIT3) gene on chromosome 12 and the FUS gene on chromosome 16, t(12;16)(q13;p11.2) in >95% of cases, or less commonly, a translocation between the DDIT3 and EWSR1 genes, t(12;22)(q13;q12). Secondary aberrations involving trisomy 8 and chromosomes 1 and 16 have been reported. Herein, we report for the first time a novel secondary clonal translocation, t(2;4) (q23;p14) in addition to t(12;16)(q13; p11.2) in a 30-year-old woman with myxoid liposarcoma on the left posterior thigh region without any prior chemoradiation therapy. The significance of this translocation remains to be established.

Clinicopathologic predictors of recurrence and overall survival in adenoid cystic carcinoma of the head and neck: a single institutional experience at a tertiary care center.

BACKGROUND: The purpose of this study was to determine factors that impact recurrence and long-term survival of head and neck adenoid cystic carcinoma (ACC). METHODS: We conducted a retrospective review of 87 patients with head and neck ACC who were evaluated between 1992 and 2009. Staining for Ki-67, p53, α-estrogen receptor (αER), and progesterone receptor (PR) was performed. RESULTS: Forty men (46%) and 47 women (54%) were included in this study. Median follow-up for patients was 98 months. Five-year recurrence-free and overall survival (OS) rates were 56% and 81%, respectively. Ki-67 and p53 expression was observed in 5 (6%) and 2 (2%) patients, respectively. αER and PR were all negative. The most important determinants of disease-free survival (DFS) were perineural invasion (PNI; p = .001) and female sex (p = .027). Disease site (major vs minor salivary gland) was the only predictor of worse OS on multivariate analysis. CONCLUSION: Perineural invasion, female sex, and disease site were the most consistent predictors of poor outcome in head and neck ACC.

Aggressive osteoblastoma of the maxilla: a case report and review of the literature.

Aggressive osteoblastoma is a rare primary bone neoplasm with the potential for local invasion and recurrence. While the vertebrae or long bones are most commonly affected, few well-documented cases have been reported in the jaws. A 25-year-old man presented with a palatal mass of several months' duration. He reported the lesion had undergone gradual enlargement and, while generally asymptomatic, had recently become increasingly painful. An incisional biopsy was interpreted as "osteoblastic neoplasm" most suggestive of osteoblastoma. However, final diagnosis was deferred until the resection specimen could be evaluated. Following partial maxillectomy, histopathologic examination revealed a proliferation of large epithelioid cells with eccentric nuclei and prominent nucleoli associated with broad, irregular deposits of osteoid and trabeculae of bone. The lesional cells exhibited minimal pleomorphism with infrequent, normal-appearing mitotic figures and numerous osteoclast-like giant cells were observed within an associated loose fibrovascular stroma. Transformation of "blue bone" to more organized eosinophilic trabeculae of woven bone was noted at the periphery of the lesion and there was no evidence of invasion. A diagnosis of aggressive osteoblastoma was made. Previous reports of gnathic aggressive osteoblastoma are reviewed and the features that distinguish this process from conventional osteoblastoma or osteoblastoma-like osteosarcoma are presented.