Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 17 de 17
Filtrar
Mais filtros

Base de dados
Tipo de documento
Intervalo de ano de publicação
1.
Cell ; 132(5): 860-74, 2008 Mar 07.
Artigo em Inglês | MEDLINE | ID: mdl-18329371

RESUMO

To explore the role of Dicer-dependent control mechanisms in B lymphocyte development, we ablated this enzyme in early B cell progenitors. This resulted in a developmental block at the pro- to pre-B cell transition. Gene-expression profiling revealed a miR-17 approximately 92 signature in the 3'UTRs of genes upregulated in Dicer-deficient pro-B cells; a top miR-17 approximately 92 target, the proapoptotic molecule Bim, was highly upregulated. Accordingly, B cell development could be partially rescued by ablation of Bim or transgenic expression of the prosurvival protein Bcl-2. This allowed us to assess the impact of Dicer deficiency on the V(D)J recombination program in developing B cells. We found intact Ig gene rearrangements in immunoglobulin heavy (IgH) and kappa chain loci, but increased sterile transcription and usage of D(H) elements of the DSP family in IgH, and increased N sequence addition in Igkappa due to deregulated transcription of the terminal deoxynucleotidyl transferase gene.


Assuntos
Diversidade de Anticorpos , Linfócitos B/citologia , Sobrevivência Celular , RNA Helicases DEAD-box/genética , RNA Helicases DEAD-box/metabolismo , Endorribonucleases/genética , Endorribonucleases/metabolismo , Regiões 3' não Traduzidas/química , Regiões 3' não Traduzidas/metabolismo , Animais , Northern Blotting , Perfilação da Expressão Gênica , Rearranjo Gênico do Linfócito B , Imunoglobulinas/genética , Camundongos , Camundongos Knockout , MicroRNAs/metabolismo , Análise de Sequência com Séries de Oligonucleotídeos , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Ribonuclease III , Organismos Livres de Patógenos Específicos
2.
J Clin Nurs ; 30(19-20): 2854-2862, 2021 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-33934413

RESUMO

AIMS AND OBJECTIVES: This study aims to shed light on patients with late-stage COPD and their experiences of shame. BACKGROUND: Patients with COPD often experience shame for bringing the disease into their lives due to smoking. Knowledge about patients with COPD and their feelings of shame is crucial, but limited, however. DESIGN: The study has a qualitative and explorative design. We interviewed twelve patients with late-stage COPD. The data were analysed using Kvale and Brinkmann's three interpretative contexts. The COREQ checklist was used. RESULTS: Three main themes were defined; the body as a mirror of shame; a sense of being unworthy, invisible and powerless; and that sharing the burden is too difficult. The participants experienced that the disease defined their value as human beings and that made them feel vulnerable, ashamed and more socially isolated. CONCLUSIONS: The participants experienced feelings of shame, guilt and self-blame due to their own perceptions of themselves. They were in doubt about whether they were worthy to receive care and comfort from both health professionals and, their family and friends. The participants seemed to have internalised the moral norms of contemporary society and the understanding that the disease, and especially a 'self-inflicted' disease, is a personal weakness. RELEVANCE FOR CLINICAL PRACTICE: Findings from this study show that patients struggle with feelings such as shame and misery. The nurses who work bedside are in continuous contact with the patients and have an opportunity to gain knowledge of these feelings in order to meet the patients' needs for comfort and care. They have an obligation to ask patients about their feelings and meet them with empathy and respect. Moreover, it is necessary to have interdisciplinary fora in clinical practice where health professionals reflect, discuss and challenge themselves according to attitudes towards patients with so-called 'self-inflicted' diseases.


Assuntos
Doença Pulmonar Obstrutiva Crônica , Vergonha , Emoções , Culpa , Humanos , Pesquisa Qualitativa
3.
Proc Natl Acad Sci U S A ; 112(5): E458-66, 2015 Feb 03.
Artigo em Inglês | MEDLINE | ID: mdl-25609670

RESUMO

The genes encoding the variable (V) region of the B-cell antigen receptor (BCR) are assembled from V, D (diversity), and J (joining) elements through a RAG-mediated recombination process that relies on the recognition of recombination signal sequences (RSSs) flanking the individual elements. Secondary V(D)J rearrangement modifies the original Ig rearrangement if a nonproductive original joint is formed, as a response to inappropriate signaling from a self-reactive BCR, or as part of a stochastic mechanism to further diversify the Ig repertoire. VH replacement represents a RAG-mediated secondary rearrangement in which an upstream VH element recombines with a rearranged VHDHJH joint to generate a new BCR specificity. The rearrangement occurs between the cryptic RSS of the original VH element and the conventional RSS of the invading VH gene, leaving behind a footprint of up to five base pairs (bps) of the original VH gene that is often further obscured by exonuclease activity and N-nucleotide addition. We have previously demonstrated that VH replacement can efficiently rescue the development of B cells that have acquired two nonproductive heavy chain (IgH) rearrangements. Here we describe a novel knock-in mouse model in which the prerearranged IgH locus resembles an endogenously rearranged productive VHDHJH allele. Using this mouse model, we characterized the role of VH replacement in the diversification of the primary Ig repertoire through the modification of productive VHDHJH rearrangements. Our results indicate that VH replacement occurs before Ig light chain rearrangement and thus is not involved in the editing of self-reactive antibodies.


Assuntos
Região Variável de Imunoglobulina/genética , Animais , Linfócitos B/imunologia , Compartimento Celular , Camundongos , Camundongos Transgênicos , Processos Estocásticos
4.
J Clin Nurs ; 27(9-10): 1793-1802, 2018 May.
Artigo em Inglês | MEDLINE | ID: mdl-29575462

RESUMO

AIMS AND OBJECTIVES: To review relevant literature that addresses the challenges of the biosciences in nurse education. More precisely, the review aims to explore the literature, concerning students' learning, learning contexts and methodological issues and identify any significant gaps. BACKGROUND: Knowledge of anatomy, physiology and biochemistry is essential for the understanding of human beings and for full appreciation of the concepts of illness and disease. The current status would seem to be that the required competencies within bioscience subjects are difficult to acquire and students have high rates of failure. DESIGN: Integrative review. METHODS: The research was performed on CINAHL, ERIC, Medline and British Nursing Index databases in a period from 2013-2017. Descriptive analytical methods were used for the initial research trawl. FINDINGS: The search strategy resulted in 23 papers. The results of this review shed light on certain deficiencies in the research field looking at the biosciences in nurse education. There is a distinct lack of intervention studies and, thereby, knowledge of how best to support students' learning in effective ways. Of note is that there are no field study approaches identified in the review sample. CONCLUSION: Many of the papers are single studies and course evaluations which may be seen as too narrow and inadequate as perspective. Students appear satisfied with the courses in the biosciences, but there seems to be no correlation between satisfaction and achievement. RELEVANCE TO CLINICAL PRACTICE: Understanding and being able to give coherent rationales for the bioscience content in the nursing curricula are crucial and must be established in relation to its relevance to the dynamic nature of patient care, technological advances and demographic realities. Only on that basis can the primacy of this content be seen as relevant to the aspiring student nurse.


Assuntos
Disciplinas das Ciências Biológicas/educação , Currículo , Bacharelado em Enfermagem/organização & administração , Humanos
5.
J Immunol ; 191(6): 3100-11, 2013 Sep 15.
Artigo em Inglês | MEDLINE | ID: mdl-23966625

RESUMO

Th17 cells are a proinflammatory subset of effector T cells that have been implicated in the pathogenesis of asthma. Their production of the cytokine IL-17 is known to induce local recruitment of neutrophils, but the direct impact of IL-17 on the lung epithelium is poorly understood. In this study, we describe a novel mouse model of spontaneous IL-17-driven lung inflammation that exhibits many similarities to asthma in humans. We have found that STAT3 hyperactivity in T lymphocytes causes an expansion of Th17 cells, which home preferentially to the lungs. IL-17 secretion then leads to neutrophil infiltration and lung epithelial changes, in turn leading to a chronic inflammatory state with increased mucus production and decreased lung function. We used this model to investigate the effects of IL-17 activity on airway epithelium and identified CXCL5 and MIP-2 as important factors in neutrophil recruitment. The neutralization of IL-17 greatly reduces pulmonary neutrophilia, underscoring a key role for IL-17 in promoting chronic airway inflammation. These findings emphasize the role of IL-17 in mediating neutrophil-driven pulmonary inflammation and highlight a new mouse model that may be used for the development of novel therapies targeting Th17 cells in asthma and other chronic pulmonary diseases.


Assuntos
Asma/imunologia , Doenças do Sistema Imunitário/imunologia , Interleucina-17/imunologia , Transtornos Leucocíticos/imunologia , Neutrófilos/imunologia , Mucosa Respiratória/imunologia , Animais , Asma/metabolismo , Separação Celular , Modelos Animais de Doenças , Ensaio de Imunoadsorção Enzimática , Citometria de Fluxo , Interleucina-17/metabolismo , Camundongos , Camundongos Endogâmicos C57BL , Pneumonia/imunologia , Pneumonia/metabolismo , Reação em Cadeia da Polimerase em Tempo Real , Mucosa Respiratória/metabolismo , Células Th17/imunologia , Células Th17/metabolismo , Transfecção
6.
Nurse Educ Today ; 137: 106158, 2024 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-38493586

RESUMO

OBJECTIVES: There is a lack of synthesized knowledge on nursing students self-directed learning in bioscience and how to best support students' learning in this subject. The purpose of this integrative review is to synthesize current literature on perspectives on self-directed learning among nursing students studying bioscience to guide further research aiming to support students' learning more effectively. METHODS: An integrative review in line with Whittemore & Knafl's modified framework containing five stages: problem identification, literature search, data evaluation, data analysis and presentation. A structured literature search was undertaken in the Web of Science, ERIC, Medline and CINAHL databases from November 2022 to January 2023. The inclusion criteria were nursing students enrolled in a bachelor programme, research addressing activities intended for learning bioscience, in addition to formal taught lectures and perspectives on self-directed learning in natural science subjects within nurse education such as views, actions, activities, habits and attitudes. Exclusion criteria were students in other education programs, research in formal learning contexts, and self-directed learning in other subjects than natural science subjects. Rigour of each included source was assessed using Whittemore & Knafl's suggested 2-point scale (high or low). A constant comparison method was used to synthesize results. RESULTS: Of the initial 1143 sources, 12 articles were included after abstract and full-text screening: one pilot study for randomized controlled trial, one qualitative study, two mixed methods studies and eight quantitative studies. The sample size was from 23 to 563 participants. DISCUSSION: This review identifies self-directed learning in bioscience understood as a continuum of teacher-directedness and self-directedness rather than as distinguished orientations. There seem to be no consistent definition of self-directed learning in bioscience, yet descriptions commonly imply metacognitive learning approaches. Nursing students value digital learning resources, yet technology might be secondary to the skill of self-directed learning.


Assuntos
Bacharelado em Enfermagem , Estudantes de Enfermagem , Humanos , Bacharelado em Enfermagem/métodos , Projetos Piloto , Aprendizagem , Escolaridade , Estudantes de Enfermagem/psicologia
7.
Nurs Open ; 10(10): 7058-7065, 2023 10.
Artigo em Inglês | MEDLINE | ID: mdl-37563783

RESUMO

AIM: To explore nursing students' perception of nursing knowledge. DESIGN: Qualitative interview study. METHODS: Semistructured individual interviews with nine nursing students in their third year were conducted via a cloud-based video communication app. Transcriptions were analysed based on Braun and Clarke's thematic analysis. The Consolidated Criteria for Reporting Qualitative Research checklist for qualitative research was used. RESULTS: The findings show that the participants emphasised that values are the prerequisites of and basis for performing professional nursing. The students found it difficult to define nursing knowledge and to distinguish nursing knowledge from other subjects. The thematic analysis resulted in two themes: values-a prerequisite of nursing knowledge, and nursing knowledge-an umbrella of knowledge. CONCLUSION: Nursing knowledge seems to be difficult both to clarify and to demarcate for the students. However, the participants considered values to be important and vital to becoming a professional nurse. IMPLICATIONS FOR THE PROFESSION: This study addresses students' perceptions of values, nursing knowledge and what it consists of, and how this is experienced. An understanding of the nursing students' perceptions of what they consider to be important values and how they understand nursing knowledge is important in making the profession clearer and more distinguishable. IMPACT: The impact of this study means that nurse education needs to emphasise a more argumentative and visible education where nursing knowledge and values are more prominent than today. REPORTING METHOD: COREQ. PUBLIC CONTRIBUTION: No patient or public contribution.


Assuntos
Bacharelado em Enfermagem , Estudantes de Enfermagem , Humanos , Bacharelado em Enfermagem/métodos , Pesquisa Qualitativa , Comunicação , Percepção
8.
Nurs Open ; 10(4): 2406-2413, 2023 04.
Artigo em Inglês | MEDLINE | ID: mdl-36448599

RESUMO

AIM: This study is to gain insight into how nursing leaders perceive their contribution to research-based knowledge in hospital settings. DESIGN: The study has a qualitative descriptive design. METHODS: Nine nursing leaders were interviewed. Data were analysed based on Braun and Clarke's thematic analysis. RESULTS: Three themes were developed: the primacy of management and practicalities, delegated responsibility and lack of research competence. Even though the nurse leaders wish to be professional leaders, they seem to prioritize the day-to-day management. The nurse facilitators have been delegated, by the nurse leaders, the responsibility for the departments and the employees' professional development. The participants reported that neither their own leaders, the nurses, nor they themselves had the necessary knowledge or the interest in engaging in research. CONCLUSION: There seems to be a lack of awareness, knowledge and priority of nursing research in nursing leadership and absence of a culture of research.


Assuntos
Pesquisa em Enfermagem , Humanos , Serviços de Saúde , Hospitais
9.
Nurs Open ; 9(6): 2847-2857, 2022 11.
Artigo em Inglês | MEDLINE | ID: mdl-34278733

RESUMO

AIM: Nursing students report emotional distress and feelings of inadequacy to the complexity of palliative care. This study aimed to examine nursing students' attainment of learning outcomes in palliative care through simulation and hospital placement. DESIGN: A longitudinal, intervention study. METHODS: Fifty-five second-year bachelor nursing students participated. Three waves of assessments were performed: (1) pretest; (2) postsimulation test and (3) postplacement test after the completion of the placement. Non-parametric Wilcoxon's signed-rank test for paired samples was used to test for differences between assessments of knowledge, skills and competence before and after simulation, and between postsimulation and post hospital placement. RESULTS: The results showed positive differences between pre- and postsimulation, indicating that learning outcomes were attained through simulation. However, negative differences between the postplacement test and postsimulation test scores indicated that the participants had practiced learning outcome from the simulation to a small degree during placement.


Assuntos
Bacharelado em Enfermagem , Enfermagem de Cuidados Paliativos na Terminalidade da Vida , Estudantes de Enfermagem , Humanos , Estudantes de Enfermagem/psicologia , Cuidados Paliativos/métodos , Bacharelado em Enfermagem/métodos , Hospitais
10.
Nurs Open ; 8(2): 990-996, 2021 03.
Artigo em Inglês | MEDLINE | ID: mdl-33570309

RESUMO

AIM: To compare the effects of flipped classroom and traditional auditorium lectures, on nursing students' examination results in bioscience. DESIGN: An educational intervention study. METHODS: All the first-year students in the bachelor programme (N = 493) were entered into a database and randomly assigned to the intervention or the control group in a course in bioscience. The outcome measures are the proportion of students who passed the examination, and the distribution of grades from A to E. Chi-square tests and Mann-Whitney Wilcoxon test were used. The odds to pass versus fail were modelled using binary logistic regression. RESULTS: The proportion of students who did not pass the final examination was very similar in the intervention and the control groups, 21.4% and 23.6% (p = .574). Our data did not reveal any statistically significant differences concerning the distribution of grades (p = .691). Students with biology and/or natural science had higher odds for passing.


Assuntos
Estudantes de Enfermagem , Currículo , Humanos , Aprendizagem Baseada em Problemas
11.
J Hosp Palliat Nurs ; 22(3): 204-212, 2020 06.
Artigo em Inglês | MEDLINE | ID: mdl-32282556

RESUMO

It is an international consensus that health care workers should be well trained to promote care for seriously ill and dying patients. Nursing students have reported that they feel inadequately prepared for palliative care. Simulation exercises have been described as increasing knowledge, skills, and competence, and participants have reported that they are more confident and prepared for palliative care with this learning approach than without. So far, there has not been much reported on how simulation contributes to learning in clinical practice. Therefore, this study explored whether learning outcomes from palliative care simulation further developed in practice. Second-year bachelor's-prepared nursing students voluntarily participated in a simulation activity as part of their hospital practice. Eleven students were interviewed about their learning experiences. The findings indicate that a prerequisite for further learning was to actively choose palliative care. Relationships with nurses, patients, and relatives and factors in themselves served as gatekeepers for attending learning situations. Becoming a nurse who can provide palliative care was described as an emotionally challenging experience. Elements that promoted learning outcomes in palliative care were simulation experience, clarified expectations, support, and a good dialog with the nurse before and after the learning situation.


Assuntos
Enfermagem de Cuidados Paliativos na Terminalidade da Vida , Cuidados Paliativos , Estudantes de Enfermagem , Humanos , Aprendizagem
12.
Nurs Open ; 6(3): 1205-1217, 2019 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-31367447

RESUMO

AIM: The aim is to examine PhD theses in nursing science, their purpose or aim and the theoretical approaches and methods employed. The study seeks to examine how such theses may be categorized, what they study, what theoretical approaches they employ and, in particular, to what degree nursing theory is employed as a current theoretical approach. DESIGN: This study has a descriptive qualitative design. METHOD: This study complied with the Standard for Reporting Qualitative Research (SRQR). Data were collected from 61 PhD theses in nursing science published from 1994-2015, at University of Edinburgh. RESULTS: Twenty of the PhD theses used theoretical approaches with a sociological perspective and 12 used a psychological perspective. Eighteen of the PhD theses were based on theoretical approaches from philosophy, ethics, pedagogy, medicine or biology as a primary perspective. Nursing theories, in their conventional definition, have a limited presence in the theses examined.

13.
Nurse Educ Today ; 77: 53-58, 2019 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-30954856

RESUMO

BACKGROUND: Learning palliative care is challenging for nursing students. Simulation is recommended as a learning approach. Whether experiences from simulation transfer into clinical practice must be investigated. OBJECTIVE: The aim of this study was to explore nursing students' experiences of participating in palliative care simulation and examine how they describe the perceived transfer of knowledge, skills, and competence into clinical practise. METHOD: This prospective, qualitative study was comprised of 11 in-depth interviews with second-year bachelor nursing students. Content analysis was performed to analyse the answers to open-ended questions. RESULTS: From this sample, simulation is a preferred method to gather knowledge, skills, and attitudes towards palliative care. Realistic cases stimulated senses and feelings. Courage grew through active participation and debriefing and influenced the students' self-confidence. Debriefing seemed to alter the situation from one of chaos to control. CONCLUSIONS: Experiences from the simulation were perceived to transfer to practice, serve as a sound basis for clinical judgement, and enable communication with patients and their relatives. Continuity in learning through simulation combined with practice is highlighted.


Assuntos
Percepção , Estudantes de Enfermagem/psicologia , Adulto , Feminino , Humanos , Entrevistas como Assunto/métodos , Masculino , Cuidados Paliativos/métodos , Estudos Prospectivos , Pesquisa Qualitativa , Treinamento por Simulação/métodos
14.
Cell Rep ; 17(9): 2271-2285, 2016 11 22.
Artigo em Inglês | MEDLINE | ID: mdl-27880903

RESUMO

B cell development is a tightly regulated process dependent on sequential rearrangements of immunoglobulin loci that encode the antigen receptor. To elucidate the role of microRNAs (miRNAs) in the orchestration of B cell development, we ablated all miRNAs at the earliest stage of B cell development by conditionally targeting the enzymes critical for RNAi in early B cell precursors. Absence of any one of these enzymes led to a block at the pro- to pre-B cell transition due to increased apoptosis and a failure of pre-B cells to proliferate. Expression of a Bcl2 transgene allowed for partial rescue of B cell development, however, the majority of the rescued B cells had low surface immunoglobulin expression with evidence of ongoing light chain editing. Our analysis revealed that miRNAs are critical for the regulation of the PTEN-AKT-FOXO1 pathway that in turn controls Rag expression during B cell development.


Assuntos
Linfócitos B/citologia , Linfócitos B/metabolismo , Diferenciação Celular/genética , Regulação da Expressão Gênica , MicroRNAs/metabolismo , Edição de RNA/genética , Receptores de Antígenos de Linfócitos B/metabolismo , Transdução de Sinais/genética , Animais , Regulação para Baixo , Fatores de Transcrição Forkhead/metabolismo , Cadeias Leves de Imunoglobulina/genética , Camundongos , Fosfatidilinositol 3-Quinases/metabolismo , Proteínas Proto-Oncogênicas c-akt/metabolismo , Proteínas Proto-Oncogênicas c-bcl-2/metabolismo , Interferência de RNA , Proteínas de Ligação a RNA/metabolismo , Ribonuclease III/metabolismo , Baço/citologia , Transgenes
15.
West J Nurs Res ; 37(7): 877-98, 2015 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-25819699

RESUMO

Computerized clinical guidelines are frequently used to translate research into evidence-based behavioral practices and to improve patient outcomes. The purpose of this integrative review is to summarize the factors influencing nurses' use of computerized clinical guidelines and the effects of nurses' use of computerized clinical guidelines on patient safety improvements in hospitals. The Embase, Medline Complete, and Cochrane databases were searched for relevant literature published from 2000 to January 2013. The matrix method was used, and a total of 16 papers were included in the final review. The studies were assessed for quality with the Critical Appraisal Skills Program. The studies focused on nurses' adherence to guidelines and on improved patient care and patient outcomes as benefits of using computerized clinical guidelines. The nurses' use of computerized clinical guidelines demonstrated improvements in care processes; however, the evidence for an effect of computerized clinical guidelines on patient safety remains limited.


Assuntos
Fidelidade a Diretrizes/normas , Hospitais , Enfermeiras e Enfermeiros/psicologia , Segurança do Paciente/normas , Guias de Prática Clínica como Assunto , Humanos
16.
Nucleic Acids Symp Ser (Oxf) ; (50): 95-6, 2006.
Artigo em Inglês | MEDLINE | ID: mdl-17150834

RESUMO

In the presence of an endonuclease that digests double-stranded DNA, DNA polymerase efficiently synthesizes and amplifies DNA from dNTPs in the absence of any added template and primer nucleic acid. This cut-polymerization DNA synthesis (Cut-grow) can be carried out under a wide range of temperature (4-85 degrees C) by many endonucleases and DNA polymerases. The high efficiency of Cut-grow results from an efficient exponential amplification involving digestion-elongation cycles. Our findings suggest that digestion of nucleic acids may play an important role during the evolution of genetic material for procreating the diversification of genetic information on the early earth.


Assuntos
DNA/biossíntese , Endodesoxirribonucleases/metabolismo , DNA/metabolismo , DNA Polimerase Dirigida por DNA/metabolismo , Desoxirribonuclease EcoRI/metabolismo , Evolução Molecular , Modelos Genéticos , Sequências de Repetição em Tandem
17.
Biochemistry ; 43(42): 13459-66, 2004 Oct 26.
Artigo em Inglês | MEDLINE | ID: mdl-15491153

RESUMO

We have found that, in the presence of a thermophilic restriction endonuclease, thermophilic DNA polymerase efficiently synthesizes and amplifies DNA in the absence of any added template and primer nucleic acid under isothermal conditions. More than 10 microg of DNA can be synthesized by 1 unit of DNA polymerase in 1 h, and the reaction proceeds until available dNTPs are consumed. We used mostly the Tsp509I restriction endonuclease (recognition sequence: decreasing AATT), the TspRI restriction endonuclease (recognition sequence: NNCA(G/C)TGNN decreasing), and Vent (exo(-)) and Vent DNA polymerase. The synthesized double-stranded DNA has a highly repetitive palindromic sequence, e.g. (AAAAATTTTT)(n) and (ATACACTGTATATACAGTGTAT)(n). In every repeating unit, there are one or two recognition sites for the restriction enzyme. Our data show that the high efficiency of the restriction-endonuclease-DNA-polymerase (RE-pol) DNA synthesis results from an efficient exponential amplification involving digestion-elongation cycles: a longer DNA with numerous recognition sites for the restriction enzyme is digested to short fragments, and the short fragments are used as seeds for elongation to synthesize longer DNA. A possible role of RE-pol DNA synthesis in the evolutionary development of genetic materials is briefly discussed.


Assuntos
Proteínas Arqueais/metabolismo , Primers do DNA/metabolismo , Replicação do DNA , DNA Polimerase Dirigida por DNA/metabolismo , DNA/biossíntese , Desoxirribonucleases de Sítio Específico do Tipo II/metabolismo , Moldes Genéticos , Thermococcus/enzimologia , Clonagem Molecular , DNA/química , DNA Polimerase I/metabolismo , Elongação Traducional da Cadeia Peptídica/genética , Análise de Sequência de DNA , Sequências de Repetição em Tandem
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA