The orphan receptor GPR55 is a novel cannabinoid receptor.

BACKGROUND: The endocannabinoid system functions through two well characterized receptor systems, the CB1 and CB2 receptors. Work by a number of groups in recent years has provided evidence that the system is more complicated and additional receptor types should exist to explain ligand activity in a number of physiological processes. EXPERIMENTAL APPROACH: Cells transfected with the human cDNA for GPR55 were tested for their ability to bind and to mediate GTPgammaS binding by cannabinoid ligands. Using an antibody and peptide blocking approach, the nature of the G-protein coupling was determined and further demonstrated by measuring activity of downstream signalling pathways. KEY RESULTS: We demonstrate that GPR55 binds to and is activated by the cannabinoid ligand CP55940. In addition endocannabinoids including anandamide and virodhamine activate GTPgammaS binding via GPR55 with nM potencies. Ligands such as cannabidiol and abnormal cannabidiol which exhibit no CB1 or CB2 activity and are believed to function at a novel cannabinoid receptor, also showed activity at GPR55. GPR55 couples to Galpha13 and can mediate activation of rhoA, cdc42 and rac1. CONCLUSIONS: These data suggest that GPR55 is a novel cannabinoid receptor, and its ligand profile with respect to CB1 and CB2 described here will permit delineation of its physiological function(s).

The alpha / beta and alpha 2 / alpha 1-globin mRNA ratios in different forms of alpha-thalassemia.

The present study provides information about the alpha / beta and alpha 2 / alpha 1-mRNA ratios in reticulocytes of normal adults and individuals with different alpha-globin gene deficiencies; it found its origin in analytical data of blood samples from a Laotian couple and their newborn baby. The father carried the 4.2 kb deletion on one chromosome and a TAA --> CAA mutation at the terminating codon of the alpha 2 gene (Hb Constant Spring or CS) on the other chromosome. The mother had the 3.7 kb deletion on one chromosome and a TA A --> TAT mutation at the terminating codon of the alpha 2-globin gene (Hb Paksé) of the second chromosome. The baby was a compound heterozygote for the two termination codon mutations. The mRNA data for this family were compared to those for persons with several well-defined alpha-globin gene deficiencies. The results confirm the importance of the alpha 2 alpha 1-mRNA for the synthesis of alpha chains in alpha-thalassemia-2 homozygotes (-alpha/-alpha) and in patients with Hb H disease due to the deletion of three alpha-globin genes (-alpha/--). Furthermore, the MRNA production of the alpha 1-globin gene on the chromosome with the alpha CS mutation (alpha CS alpha) is only one-half of that by the alpha 2 alpha 1-globin gene of a chromosome with a 3.7 or 4.2 kb deletion, explaining the greater severity of, and higher Hb H level in Hb H patients with the alpha CS alpha condition (alpha CS alpha/--) as compared to those with the three gene deletion (-alpha/--). The methodology could be useful as a preliminary screening for the presence of point mutations leading to the functional loss of a single alpha-globin gene, provided common deletional alleles have been excluded.

Astroglia and glutamate in physiology and pathology: aspects on glutamate transport, glutamate-induced cell swelling and gap-junction communication.

Astroglia have the capacity to monitor extracellular glutamate (Glu) and maintain it at low levels, metabolize Glu, or release it back into the extracellular space. Glu can induce an increase in astroglial cell volume with a resulting decrease of the extracellular space, and thereby alter the concentration of extracellular substances. Many lines of evidence show that K(+) can be buffered within the astroglial gap-junction-coupled network, and recent results show that gap junctions are permeable for Glu. All these events occur dynamically: the astroglial network has the capacity to interfere actively with neurotransmission, thereby contributing to a high signal-to-noise ratio for the Glu transmission. High-quality neuronal messages during normal physiology can then be maintained. With the same mechanisms, astroglia might exert a neuroprotective function in situations of moderately increased extracellular Glu concentrations, i.e., corresponding to conditions of pathological hyper-excitability, or corresponding to early stages of an acute brain injury. If the astroglial functions are failing, neuronal dysfunction can be reinforced.

A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene.

This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.

Identification of several alpha-globin gene variations in a small Laotian family.

The present study concerns the identification of four alpha-globin gene deficiencies, one alpha 1-globin gene mutation, and one beta-globin gene mutation in a Laotian couple and their newborn baby. The parents were Hb E heterozygotes and the baby was an Hb E homozygote. The father carried the 4.2-kb deletion on one chromosome and a TAA-->CAA mutation at the terminating codon of the alpha 2-gene (Hb Constant Spring or CS) on the other chromosome. Moreover, the remaining alpha 1-globin gene on the chromosome with the 4.2-kb deletion was mutated at codon 74 (GAC-->CAC; Asp-->His; Hb Q-Thailand). The mother had the 3.7-kb deletion on one chromosome and a TAA-->TAT mutation at the terminating codon of the alpha 2-globin gene (Hb Paksé) of the second chromosome. The baby was a compound heterozygote for the two termination codon mutations and, at birth, had a high level of Hb Bart's (16.6%) reflecting a mild form of Hb H disease.

Endothelin-1 decreases glutamate uptake in primary cultured rat astrocytes.

Endothelin-1 (ET-1) is a potent vasoconstrictor peptide that is also known to induce a wide spectrum of biological responses in nonvascular tissue. In this study, we found that ET-1 (100 nM) inhibited the glutamate uptake in cultured astrocytes expressing the glutamate/aspartate transporter (GLAST); astrocytes did not express the glutamate transporter-1 (GLT-1). The V(max) and the K(m) of the glutamate uptake were reduced by 57% and 47%, respectively. Application of the ET(A) and ET(B) receptor antagonists BQ-123 and BQ-788 partly inhibited the ET-1-evoked decrease in the glutamate uptake, whereas the nonspecific ET receptor antagonist bosentan completely inhibited this decrease. Incubation of the cultures with pertussis toxin abolished the effect of ET-1 on the uptake. The ET-1-induced decrease in the glutamate uptake was independent of extracellular free Ca(2+) concentration, whereas the intracellular Ca(2+) antagonists thapsigargin and 3,4,5-trimethoxybenzoic acid 8-(diethylamino)octyl ester abolished the effect of ET-1 on the glutamate uptake. Incubation with the protein kinase C (PKC) antagonist staurosporine, but not with the fatty acid-binding protein bovine serum albumin, prevented the ET-1-induced decrease in the glutamate uptake. These results suggest that ET-1 impairs the high-affinity glutamate uptake in cultured astrocytes through a G protein-coupled mechanism, involving PKC and changes in intracellular Ca(2+).

Hb Hakkari or alpha 2 beta 2 31(B13)Leu-->Arg, a severely unstable hemoglobin variant associated with numerous intra-erythroblastic inclusions and erythroid hyperplasia of the bone marrow.

A severely unstable hemoglobin variant, Hb Hakkari or alpha 2 beta 2 31 (B13)Leu-->Arg, has been observed in a 5-year-old Turkish girl with a severe hemolytic anemia without Heinz body formation. A modest increase in liver and spleen size was present and the level of Hb F was a high 33%. The variant could not be observed in red cells and was only detected through sequencing of the amplified beta-globin gene and also by hybridization with specific oligonucleotide probes. The parents were normal, and it is assumed that the variant occurred as a de novo mutation. Smears from bone marrow aspirates showed numerous inclusion bodies in the erythroblast and, as a result, a erythroid hyperplasia. It is suggested that the hemoglobin variant which is unstable and is readily losing its heme group because one of the heme binding sites has been lost, precipitates in the erythroblasts, thus interfering with the maturation process and causing the severe anemia.

Co-inheritance of Hb D-Punjab (codon 121; GAA-->CAA) and beta (0) -thalassemia (IVS-II-1;G-->A).

PURPOSE: Homozygosity for Hb D-Punjab (or Hb D-Los Angeles; codon 121; GAA-->CAA) is rare among Arabs. The co-inheritance of Hb D with beta(0)-thalassemia trait is even rarer, with only 10 previous cases reported worldwide. PATIENTS AND METHODS: We present clinical and hematological data for two Hb D homozygotes and three compound heterozygotes for Hb D-Punjab and beta(0)-thalassemia (IVS-II-1; G-->A). All the individuals belong to a consanguineous Kuwaiti Arab family. The hemoglobin variant and the beta-thalassemia allele were characterized by sequencing, allele-specific amplification, and oligonucleotide hybridization. RESULTS: The hematology was unremarkable except for a moderate elevation of Hb F (3-4%) and significant hypochromia and microcytosis in the subject with Hb D/beta(0)-thalassemia. CONCLUSION: This report confirms the benign nature of homozygosity for Hb D.

Hb Anamosa or alpha 2(111)(G18)Ala-->Val beta 2 (alpha 2 mutation) and Hb Mulhacen or alpha 2(123)(H6)Ala-->Ser beta 2 (alpha 1 mutation) are two silent, stable variants detected by sequencing of amplified DNA.

We have identified silent amino acid substitutions in two alpha chain variants present in families from Iowa, USA, and Granada, Spain. Both involve an alanine residue in the core peptide, namely Ala-->Val at position 111 (codon change in the alpha 2 gene; GCC->GTC; Hb Anamosa) and Ala-->Ser at position 123 (codon change in the alpha 1 gene; GCC-->TCC; Hb Mulhacen). The two variants are stable. Sequencing of the amplified alpha 2- and alpha 1-globin genes greatly facilitated the characterization of the two variants.

Hb Costa Rica or alpha 2 beta 2 77(EF1)His --> Arg: the first example of a somatic cell mutation in a globin gene.

We have identified a minor hemoglobin component (approximately 5%) in the blood of a healthy Costa Rican female, but not in her mother and two brothers (father not studied), that has an His --> Arg replacement at position beta 77 (Hb Costa Rica). No other amino acid replacements were observed and no beta- or gamma-chain-like peptides were present. Hb Costa Rica has abnormal stability. Sequence analyses of numerous polymerase chain reaction (PCR)-amplified segments of DNA that contain exon 2 of the beta gene failed to identify a CAC --> CGC (His --> Arg) mutation. The same was the case when cDNA was sequenced, indicating that a beta-Costa Rica-mRNA could not be detected with this procedure. Gene mapping of genomic DNA with Bg/II, BamHI, and HindIII gave normal fragments only and with the same intensity as observed for the fragments of a normal control. The quantities of the beta chain variants Hb J-Iran and Hb Fukuyama with related mutations at beta 77 vary between 30% and 45% in heterozygotes, whereas that of Hb F-Kennestone with the same His --> Arg mutation but in the G gamma-globin gene, is a high 40%-45% (as percentage of total G gamma) in a heterozygous newborn. These different observations exclude a heterozygosity of the A --> G mutation at codon beta 77, as well as a deletion comparable to that of Hbs Lepore or Kenya, or a beta-globin gene duplication, and point to a nontraditional inheritance of Hb Costa Rica. Allele-specific amplification of cDNA with appropriate primers identified the presence of a low level of mutated mRNA in the reticulocytes of the patient, which was confirmed by dotblot analysis of the same material with 32P-labeled probes. Comparable amplification products were not observed in genomic DNA. The A --> G mutation apparently occurred in a somatic cell at a relatively early stage in the development of the hematopoietic cell system, and Hb Costa Rica accumulated through rapid cell divisions in patchy areas in the bone marrow (somatic mosaicism). An unequal distribution of Hb Costa Rica over the red cells supports this possibility.