RESUMO
BACKGROUND Helicobacter pylori has a high infection rate worldwide, and epidemiological study of H. pylori is important. Artificial intelligence has been widely used in the field of medical research and has become a hotspot in recent years. This paper proposed a prediction model for H. pylori infection based on machine learning in adults. MATERIAL AND METHODS Adult patients were selected as research participants, and information on 30 factors was collected. The chi-square test, mutual information, ReliefF, and information gain were used to screen the feature factors and establish 2 subsets. We constructed an H. pylori infection prediction model based on XGBoost and optimized the model using a grid search by analyzing the correlation between features. The performance of the model was assessed by comparing its accuracy, recall, precision, F1 score, and AUC with those of 4 other classical machine learning methods. RESULTS The model performed better on the part B subset than on the part A subset. Compared with the other 4 machine learning methods, the model had the highest accuracy, recall, F1 score, and AUC. SHAP was used to evaluate the importance of features in the model. It was found that H. pylori infection of family members, living in rural areas, poor washing hands before meals and after using the toilet were risk factors for H. pylori infection. CONCLUSIONS The model proposed in this paper is superior to other models in predicting H. pylori infection and can provide a scientific basis for identifying the population susceptible to H. pylori and preventing H. pylori infection.
Assuntos
Infecções por Helicobacter , Helicobacter pylori , Aprendizado de Máquina , Humanos , Infecções por Helicobacter/diagnóstico , Infecções por Helicobacter/epidemiologia , Adulto , Masculino , Feminino , Pessoa de Meia-Idade , Fatores de RiscoRESUMO
Due to disturbances in hormones and long-term glucocorticoid replacement therapy (GRT), congenital adrenocortical hyperplasia (CAH) patients are at risk of impaired bone structure and metabolism. This cross-sectional, case-control study aims to investigate for the first time bone microarchitecture features in 21-hydroxylase deficiency (21OHD; N = 38) and 17α-hydroxylase deficiency (17OHD; N = 16) patients using high-resolution peripheral quantitative computed tomography (HR-pQCT) by matching the same sex and similar age [21OHD vs. control: 29.5 (24.0-34.3) vs. 29.6 (25.9-35.2) years; 17OHD vs. controls: 29.0 (21.5-35.0) vs. 29.7 (24.6-35.3) years] with healthy controls (1:3). All patients underwent HR-pQCT scans of the nondominant radius and tibia, and had received GRT. Compared with corresponding controls, 17OHD cases had higher height (P < 0.001), weight (P = 0.013) and similar body mass index (BMI), while 21OHD had lower height (P < 0.001), similar weight and higher BMI (P < 0.001). 17OHD and 21OHD patients demonstrated various significant bone differences in most HR-pQCT indices, suggesting abnormalities in bone microarchitectures from healthy people. Further correlation analyses revealed that some characteristics, such as height and hormones, may contribute to the bone differences in HR-pQCT indices between two diseases. However, treatment dosage and time were not correlated, indicating that the current glucocorticoid doses may be within safety limits for bone impairment. Overall, our study for the first time revealed changes of bone microarchitecture in CAH patients and their potential relations with clinical characteristics. Further longitudinal researches are required to confirm these findings.
Assuntos
Densidade Óssea , Glucocorticoides , Humanos , Estudos Transversais , Estudos de Casos e Controles , Glucocorticoides/uso terapêutico , Glucocorticoides/metabolismo , Minerais/metabolismo , Rádio (Anatomia) , Tíbia , Oxigenases de Função Mista/metabolismo , Absorciometria de FótonRESUMO
BACKGROUND: Cushing's disease (CD) is rare in pediatric patients. It is characterized by elevated plasma adrenocorticotropic hormone (ACTH) from pituitary adenomas, with damage to multiple systems and development. In recent years, genetic studies have shed light on the etiology and several mutations have been identified in patients with CD. CASE PRESENTATION: A girl presented at the age of 10 years and 9 months with facial plethora, hirsutism and acne. Her vision and eye movements were impaired. A quick weight gain and slow growth were also observed. Physical examination revealed central obesity, moon face, buffalo hump, supra-clavicular fat pads and bruising. Her plasma ACTH level ranged between 118 and 151 pg/ml, and sella enhanced MRI showed a giant pituitary tumor of 51.8 × 29.3 × 14.0 mm. Transsphenoidal pituitary debulk adenomectomy was performed and immunohistochemical staining confirmed an ACTH-secreting adenoma. Genetic analysis identified a novel germline GPR101 (p.G169R) and a somatic USP8 (p. S719del) mutation. They were hypothesized to impact tumor growth and function, respectively. CONCLUSIONS: We reported a rare case of pediatric giant pituitary ACTH adenoma and pointed out that unusual concurrent mutations might contribute to its early onset and large volume.
Assuntos
Adenoma Hipofisário Secretor de ACT , Adenoma , Hipersecreção Hipofisária de ACTH , Neoplasias Hipofisárias , Adenoma Hipofisário Secretor de ACT/diagnóstico , Adenoma Hipofisário Secretor de ACT/genética , Adenoma Hipofisário Secretor de ACT/cirurgia , Adenoma/diagnóstico , Adenoma/genética , Adenoma/cirurgia , Hormônio Adrenocorticotrópico , Endopeptidases/genética , Complexos Endossomais de Distribuição Requeridos para Transporte/genética , Feminino , Células Germinativas/patologia , Humanos , Mutação , Hipersecreção Hipofisária de ACTH/diagnóstico , Neoplasias Hipofisárias/genética , Neoplasias Hipofisárias/cirurgia , Receptores Acoplados a Proteínas G , Ubiquitina Tiolesterase/genéticaRESUMO
OBJECTIVE: Ectopic adrenocorticotropic hormone syndrome (EAS) is a rare cause of Cushing's syndrome and diagnosis and management remain challenging. The aim of this study was to present the clinical spectrum of a group of EAS cases in a single center to explore better management strategies. METHODS: A retrospective study was conducted to identify 88 confirmed EAS cases at our hospital from 1984 to 2019. The clinical, biochemical, imaging, and pathological features were analyzed. RESULTS: Of the 88 eligible patients with EAS, 38 (43.2%) cases of pulmonary neuroendocrine tumors (NETs) and a larger number of thymic/mediastinal NETs (29 cases, 33%) were identified. The clinical and biological features of EAS and Cushing's disease overlapped but were more severe in EAS. Inferior petrosal sinus sampling (97.4%) and computed tomography (85.4%) provided the highest positive diagnostic accuracy. Computed tomography is also a useful tool to identify tumors in chest cavity compared with nonchest lesions (91.2% vs 57.1%). Although a greater tumor size (4.54 cm vs 1.44 cm) and higher rate of insuppressible high-dose dexamethasone suppression test (83.3% vs 51.5%) were found in thymic/mediastinum NETs than in pulmonary NETs, the level of hormone production had no difference. CONCLUSION: EAS had more common and severe clinical presentations than Cushing's disease, and multiple imaging approaches are required for reliable diagnosis. A higher proportion of thymic/mediastinal NETs was found in our study. For patients without a certain tumor source, long-term follow-up and further evaluations are needed.
Assuntos
Síndrome de ACTH Ectópico , Hormônio Adrenocorticotrópico , Síndrome de ACTH Ectópico/diagnóstico , Diagnóstico Diferencial , Humanos , Amostragem do Seio Petroso , Estudos RetrospectivosRESUMO
BACKGROUND: Ectopic ACTH-secreting pituitary adenoma (EAPA) are a rare cause of Cushing's disease. Due to the lack of consensus and experience in terms of the diagnosis and treatment of EAPAs, preoperative identification and optimal treatment remain challenging. PURPOSE: To investigate the characteristics of EAPAs and offer some proposals for the diagnosis and management of this uncommon disease, the EAPA patients admitted to our center and all of the EAPA cases reported in the literature were reviewed. METHODS: In a retrospective electronic medical chart review, 6 patients (0.39%) with EAPAs were identified from 1536 consecutive patients who were admitted to our hospital with a diagnosis of Cushing's syndrome between January 2000 and August 2019. A literature review was performed on the online databases PubMed and EMBASE, and 52 cases conformed to the criteria. The data regarding biochemical tests, imaging examinations and follow-ups were analyzed. RESULTS: The mean age of patients with EAPAs was 37.7 years old, and an obvious female predominance (3.5: 1) was demonstrated. The most common location of EAPAs was the cavernous sinus (34.5%), followed by the sphenoid sinus (31.0%) and the suprasellar region (20.7%). No significant differences in the biochemical test results were found among tumors in different locations. Except for sex, no risk factors related to remission were found. Although no significant differences among different locations were found, the tumors in the cavernous sinus had a relatively higher rate of invisibility in terms of imaging and a higher non-remission rate than tumors in other locations. CONCLUSIONS: In patients with negative intrasellar findings, the uncommon disease of EAPA should be considered. Due to the endocrine similarity between intrasellar pituitary corticotrophin adenoma and EAPA, the preoperative identification of EAPA depends on a careful review of the imaging examinations. Locations such as the cavernous sinus, sphenoid sinus and suprasellar region should be considered first. Tumor resection is recommended when the diagnosis is confirmed.
Assuntos
Adenoma Hipofisário Secretor de ACT/epidemiologia , Adenoma Hipofisário Secretor de ACT/etiologia , Adulto , Feminino , Instalações de Saúde/estatística & dados numéricos , Humanos , Masculino , Estudos Retrospectivos , Fatores de RiscoRESUMO
BACKGROUND: Congenital adrenal hyperplasia (CAH) resulting from steroid 11ß-hydroxylase deficiency (11ß-OHD) is caused by mutations in the CYP11B1 gene. It is the second major form of CAH associated with hypertension and hypopotassemia. The aim of this study was to provide a genetic analysis of 11ß-OHD in a Chinese family. CASE PRESENTATION: A 19-year-old Chinese man was clinically diagnosed with 11ß-OHD. His initial clinical manifestations included precocious puberty, hyperpigmentation, hypertension, and hypopotassemia. The patient had taken an overdose of dexamethasone (0.75 mg/d) for more than 10 years before finally developing iatrogenic Cushing's syndrome. Our aim was to perform a molecular diagnosis of his family. Mutations in the CYP11B1 gene of the patient and his parents were examined using polymerase chain reaction (PCR) resequencing. Additionally, to predict the possible effects of novel mutations on the structure and function of 11ß-hydroxylase, these mutations were analyzed by MutationTaster software. Two novel pathogenic mutations were found in the CYP11B1 gene: a heterozygous in-frame insertion deletion mutation c.1440_1447delinsTAAAAG in exon 9 inherited from the father and a heterozygous mutation c.1094_1120delTGCGTGCGGCCCTCAAGGAGACCTTGC (p.364_372del) in exon 6 inherited from the mother. CONCLUSIONS: A clear genetic diagnosis can be made by analyzing the functional and structural consequences of CYP11B1 gene mutations that lead to 11ß-OHD. Because the dosage of glucocorticoid should be adjusted to minimize the risk of iatrogenic Cushing's syndrome, clinical follow-up should be conducted with these patients.
Assuntos
Hiperplasia Suprarrenal Congênita/diagnóstico por imagem , Hiperplasia Suprarrenal Congênita/genética , Povo Asiático/genética , Heterozigoto , Esteroide 11-beta-Hidroxilase/genética , Humanos , Masculino , Mutação/genética , Adulto JovemRESUMO
We report a broadband electro-optical (EO) modulator based on tunable plasmonic metamaterial. Transparent conducting oxides provide an excellent active plasmonic material for optoelectronic applications. By utilizing our indium-tin-oxide- (ITO) based multilayer structure, light absorption of the active ITO layer can be electrically modulated over a large spectrum range. Based on the attenuated total reflectance configuration, bias polarity-dependent modulation up to 37% has been experimentally demonstrated. This EO modulator has advantages of simple design, easy fabrication, compact size, broadband performance, large modulation depth, as well as compatibility with existing silicon photonics platforms.
RESUMO
OBJECTIVE: To explore the clinical characteristics of adrenocorticotropic hormone (ACTH) independent macronodular adrenal hyperplasia (AIMAH). METHODS: A total of 30 AIMAH patients from January 2001 to December 2011 at our hospital were reviewed retrospectively and their clinical data collected. RESULTS: AIMAH was equally distributed between genders. Their mean age was 44 ± 9 years and median course of disease 5 years. Hypertension was the most common clinical manifestation. Circadian rhythm of plasma cortisol disappeared in all patients, and the level of 24 hour urinary free cortisol (24 hUFC) was normal only in 4 (13.3%) patients. Both low and high dose dexamethasone suppression tests were not suppressed in 30 (100.0%) and 28 (93.3%) patients respectively. The stimulation tests for detecting aberrant expression of hormone receptors were performed in 14 patients. At least one aberrant cortisol response was identified in 12 patients. Twenty-five patients underwent adrenalectomy. Among 7 patients of bilateral adrenalectomy, 6 achieved remission while 8 patients did so among 14 patients of unilateral adrenalectomy. CONCLUSIONS: AIMAH should be considered in patients with massively enlarged bilateral adrenal glands. Treatment modalities should be decided according to clinical manifestations and cortisol level so as to relieve symptoms and improve prognosis.
Assuntos
Doenças do Córtex Suprarrenal/patologia , Doenças do Córtex Suprarrenal/diagnóstico , Doenças do Córtex Suprarrenal/terapia , Hormônio Adrenocorticotrópico , Adulto , Idoso , Síndrome de Cushing/diagnóstico , Síndrome de Cushing/terapia , Feminino , Humanos , Hiperplasia , Masculino , Pessoa de Meia-Idade , Estudos Retrospectivos , Adulto JovemRESUMO
Microbial nitrate reduction processes involve two competing pathways: denitrification (DEN) and dissimilatory nitrate reduction to ammonium (DNRA). This study investigated the distribution of DNRA in a sole sulfur-driven nitrogen conversion process using a laboratory-scale sequencing biofilm batch reactor (SBBR) through a series of batch tests with varying sulfide/nitrate (S/N) ratios. The results showed that DNRA became more dominant in the sulfide-oxidizing autotrophic denitrification (SOAD) process as the S/N ratio increased to 1.5:1, 1.7:1, and 2:1, reaching a peak of 35.3% at the S/N ratio of 1.5:1. Oxidation-reduction potential (ORP) patterns demonstrated distinct inflection points for nitrate and nitrite consumption under the SOAD-only conditions, whereas these points overlapped when DNRA coexisted with SOAD. Analysis of 16S ribosomal RNA identified Ignavibacterium, Hydrogenophaga, and Geobacter as the dominant genera responsible for DNRA during autotrophic nitrate reduction. The findings of the DNRA divergence investigation provided valuable insights into enhancing biological nitrogen removal processes, particularly when coupled with the anammox.
Assuntos
Desnitrificação , Nitratos , Oxirredução , Sulfetos , Nitratos/metabolismo , Reatores Biológicos , Compostos de Amônio/metabolismo , RNA Ribossômico 16S , NitrogênioRESUMO
We demonstrate greatly enhanced light absorption by monolayer graphene over a broad spectral range, from visible to near IR, based on the attenuated total reflection. In the experiment, graphene is sandwiched between two dielectric media referred to as superstrate and substrate. Based on numerical calculation and experimental results, the closer the refractive indices of the superstrate and the substrate are, the higher the absorption of graphene is. The light absorption of monolayer graphene up to 42.7% is experimentally achieved.
RESUMO
BACKGROUND: Triple A syndrome is a rare autosomal recessive disease characterized by adrenal failure, alacrima, achalasia, and progressive neurologic symptoms. AIM: Here, we describe the clinical and genetic characteristics in a Chinese patient with novel mutations in the AAAS gene. MATERIALS AND METHODS: The clinical and radiologic characteristics of the patient have been fully described. The coding sequences, including exon-intron boundaries, were amplified from genomic DNA and were sequenced. RESULTS: The clinical and radiologic findings of the patient are fully described. The sequencing of the AAAS gene detected two novel heterozygous mutations, including a c.577C>T, p.Gln193X in exon 7 and a novel frameshift mutation c.1062_1063insAC, p.Ser355fsX416 in exon 11. The testing of parents confirmed their heterozygous carrier status. CONCLUSIONS: There are significant clinical variability and mutational heterogeneities in Asian patients with this syndrome. DNA analysis is very helpful in establishing the final diagnosis of triple A syndrome, although its implication in the prediction of clinical expression and the outcome of the disorder is limited.
Assuntos
Insuficiência Adrenal/genética , Povo Asiático/genética , Acalasia Esofágica/genética , Mutação da Fase de Leitura/genética , Proteínas do Tecido Nervoso/genética , Complexo de Proteínas Formadoras de Poros Nucleares/genética , Mutação Puntual/genética , Pré-Escolar , Heterozigoto , Humanos , MasculinoRESUMO
INTRODUCTION: Pars plana vitrectomy (PPV) is a primary strategy to restore vision for patients who have rhegmatogenous retinal detachment (RRD). Perfluorocarbon liquid (PFCL) is frequently used during PPV surgery. However, the unintended intraocular retention of PFCL may cause retina toxicity and thus lead to possible postoperative complications. In this paper, the experiences and surgical outcomes of a NGENUITY 3D Visualization System-assisted PPV are shown to evaluate the possibility of excluding the application of PFCL. METHODS: A consecutive series of 60 cases with RRD were presented, all of whom had undergone 23-gauge PPV with the assistance of a three-dimensional (3D) visualization system. Among them, 30 cases used PFCL to assist the drainage of subretinal fluid (SRF), while the other 30 cases did not. Parameters including retinal reattachment rate (RRR), best-corrected visual acuity (BCVA), operation time, and SRF residual were compared between the two groups. RESULTS: Baseline data showed no statistical significance between the two groups. At the last postoperative follow-up, the RRR of all the 60 cases reached 100% and best-corrected visual acuity (BCVA) gained significant improvement. The BCVA (logMAR) increased from 1.293 ± 0.881 to 0.479 ± 0.316 in the PFCL-excluded group, exhibiting better results than the PFCL included group, whose final BCVA was 0.650 ± 0.371. More importantly, excluding PFCL greatly reduced the operation time (decrease of 20%), therefore, avoiding possible complications caused by both the use of PFCL and the operation process. CONCLUSION: With the assistance of the 3D visualization system, it is feasible to treat RRD and perform PPV without using PFCL. The 3D visualization system is highly recommendable, as not only can it achieve the same surgical effect without the assistance of PFCL, but also simplify the operation procedure, shorten the operation time, save costs, and avoid complications related to PFCL.
RESUMO
Objectives: To analyze and summarize the effect of SSA treatment on EAS due to p-NETs (EAS-p-NETs). Methods: Thirteen patients with EAS-p-NETs treated with SSAs at our center or described in the literature were included in this study. Clinical characteristics, laboratory data, imaging studies, histopathologic results, the effect of SSA treatment, and the prognosis of these EAS-p-NET patients were evaluated. Results: Four males and 9 females with an average age of 42.9 years were included in the study. The mean duration of follow-up was 38.8 ± 28.2 months. As one of the combined treatment measures, SSAs controlled the levels of ACTH and cortisol in 9 of the 13 patients (69.2%). Partial response was observed in 3 patients (23.1%), stable disease in 2 patients (15.4%), and progressive disease in 6 patients (46.2%). The median time to tumor progression was 24 months, and the median overall survival was 61 months. The side effects of SSA treatment included temporary mild abdominal pain, diarrhea, gallstones, and cholecystitis. Conclusions: As a supplemental therapy, SSA treatment led to clinical and biochemical improvement with a good safety profile in patients exhibiting EAS-p-NET with metastasis. However, tumor progression was inhibited by SSA treatment in only a few patients. Combined with other treatments, SSAs may improve the prognosis of patients with EAS-p-NETs.
RESUMO
The Talbot effect (or the self-imaging effect) can be observed for a periodic object with a pitch larger than the diffraction limit of an imaging system, where the paraxial approximation is applied. In this paper, we show that the super Talbot effect can be achieved in an indefinite metamaterial even when the period is much smaller than the diffraction limit in both two-dimensional and three-dimensional numerical simulations, where the paraxial approximation is not applied. This is attributed to the evanescent waves, which carry the information about subwavelength features of the object, can be converted into propagating waves and then conveyed to far field by the metamaterial, where the permittivity in the propagation direction is negative while the transverse ones are positive. The indefinite metamaterial can be approximated by a system of thin, alternating multilayer metal and insulator (MMI) stack. As long as the loss of the metamaterial is small enough, deep subwavelength image size can be obtained in the super Talbot effect.
RESUMO
OBJECTIVE: To explore the clinical and molecular genetic characteristics of a Chinese female patient with partial 17α-hydroxylase/17, 20 lyase deficiency (17OHD), a rare type of congenital adrenal hyperplasia. METHODS: Her clinical features and laboratory data were collected. Genomic DNA was extracted from leukocytes of peripheral blood of her and her mother. All eight exons of CYP17A1 gene, including flanking regions of introns, were amplified by PCR. The mutations of CYP17A1 gene were identified by direct sequencing or cloning and sequencing the amplified DNA fragments. RESULTS: The patient presented with hypertension, hypokalemia and irregular menstruation. DNA sequencing results demonstrated a compound heterozygous mutation in CYP17A1 gene. One allele of her had the deletion of phenylalanine (TTC) at either codon 53 or 54 and the other allele contained a base transversion at codon 329 (TAC/AA) and leading to a missense mutation of tyrosine to lysine and the open reading frame shift following this codon to produce a truncated enzyme with 417 amino acids and without activity site. Her mother was a heterozygous carrier of the latter allele. CONCLUSION: The partial 17OHD in this patient is caused by a compound heterozygous mutation in CYP17A1 gene.
Assuntos
Heterozigoto , Esteroide 17-alfa-Hidroxilase , Hiperplasia Suprarrenal Congênita/genética , Feminino , Humanos , Liases , Mutação , Mutação de Sentido IncorretoRESUMO
Objective: To analyze and summarize the clinical characteristics, treatments, and prognosis of Cushing's syndrome (CS) with nocardiosis. Methods: A patient in our hospital and additional 17 patients of CS with nocardiosis in the English literature were included in this study. Clinical characteristics, laboratory data, imaging studies, treatments, and prognosis were evaluated. Results: A 41-year-old man with CS was diagnosed and treated in our hospital. He had co-infections of nocardiosis and aspergillosis. Together with 17 patients of CS with nocardiosis in the English literature, 2 patients (11.1%) were diagnosed as Cushing's disease (CD) while 16 (88.9%) were diagnosed or suspected as ectopic ACTH syndrome (EAS). The average 24hrUFC was 7,587.1 ± 2,772.0 µg/d. The average serum total cortisol and ACTH (8 AM) was 80.2 ± 18.7 µg/dl and 441.8 ± 131.8 pg/ml, respectively. The most common pulmonary radiologic findings in CT scan were cavitary lesions (10/18) and nodules (8/18). Co-infections were found in 33.3% (6/18) patients. The CS patients with co-infections had higher levels of ACTH (671.5 ± 398.2 vs 245.5 ± 217.1 pg/ml, P = 0.047), and 38.9% (7/18) patients survived through the antibiotic therapy and the treatment of CS. Patients with lower level of ACTH (survival vs mortality: 213.1 ± 159.0 vs 554.7 ± 401.0 pg/ml, P = 0.04), no co-infection, underwent CS surgery, and received antibiotic therapy for more than 6 months, had more possibilities to survive. Conclusions: Nocardia infection should be cautioned when a patient of CS presented with abnormal chest radiographs. The mortality risk factors for CS with nocardiosis are high level of ACTH and co-infections. We should endeavor to make early etiological diagnosis, apply long-term sensitive antibiotics and aggressive treatments of CS.
Assuntos
Síndrome de Cushing/complicações , Nocardiose/complicações , Síndrome de ACTH Ectópico/complicações , Síndrome de ACTH Ectópico/tratamento farmacológico , Hormônio Adrenocorticotrópico/metabolismo , Adulto , Antibacterianos/farmacologia , Síndrome de Cushing/diagnóstico , Síndrome de Cushing/tratamento farmacológico , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Nocardiose/diagnóstico , Nocardiose/tratamento farmacológico , Prognóstico , Radiografia Torácica , Risco , Fatores de RiscoRESUMO
Context: Traditionally, low-dose dexamethasone suppression test (LDDST) was used to confirm the diagnosis of Cushing's syndrome (CS), and high-dose dexamethasone suppression test (HDDST) was used to differentiate Cushing's disease (CD) and ectopic adrenocorticotropin (ACTH) syndrome (EAS), but some studies suggested that HDDST might be replaced by LDDST. For the differential diagnosis of CS, dexamethasone suppression test was usually combined with other tests such as bilateral petrosal sinus sampling (BIPSS) and pituitary magnetic resonance imaging, but the optimal pathway to incorporate these tests is still controversial. Objectives: To develop an optimized pathway for the differential diagnosis of CD and EAS based on LDDST. Design and Setting: Single-center retrospective study (2011-2019). Patients: Two hundred sixty-nine CD and 29 EAS patients with pathological diagnosis who underwent consecutive low- and high-dose DST. Results: For the differential diagnosis of CD and EAS, the area under curve (AUC) of LDDST using urine free cortisol (0.881) was higher than that using serum cortisol (0.685) (p < 0.001) in head-to-head comparison among a subgroup of 108 CD and 10 EAS. The AUC of LDDST (0.883) was higher than that of HDDST (0.834) among all the included patients. With the cutoff of <26%, the sensitivity and specificity of LDDST were 39.4% and 100%. We designed a new pathway in which BIPSS was only reserved for those patients with unsuppressed LDDST and adenoma <6mm, yielding an overall sensitivity of 97.7% and specificity of 86.7%. Conclusion: LDDST had similar value to HDDST in differentiating CD and EAS using the specific cutoff point. The pathway that combined LDDST and BIPSS could differentiate CD and EAS accurately.
Assuntos
Síndrome de Cushing/diagnóstico , Dexametasona/farmacologia , Técnicas de Diagnóstico Endócrino , Síndrome de ACTH Ectópico/sangue , Síndrome de ACTH Ectópico/diagnóstico , Adenoma/diagnóstico , Adenoma/metabolismo , Adenoma/patologia , Adolescente , Hormônio Adrenocorticotrópico/sangue , Hormônio Adrenocorticotrópico/metabolismo , Adulto , Idoso , Calibragem , Criança , Síndrome de Cushing/sangue , Síndrome de Cushing/etiologia , Diagnóstico Diferencial , Técnicas de Diagnóstico Endócrino/normas , Relação Dose-Resposta a Droga , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Amostragem do Seio Petroso , Hipersecreção Hipofisária de ACTH/sangue , Hipersecreção Hipofisária de ACTH/diagnóstico , Neoplasias Hipofisárias/diagnóstico , Neoplasias Hipofisárias/metabolismo , Neoplasias Hipofisárias/patologia , Estudos Retrospectivos , Sensibilidade e Especificidade , Adulto JovemRESUMO
Background: Endogenous Cushing's syndrome (CS), also called hypercortisolism, leads to a significant increase in mortality due to excessive cortisol production, which is mainly due to cardiovascular disease. CS complicated with cardiomyopathies, which is a rare and severe condition, has rarely been reported in the literature. Objective: To investigate the clinical characteristics of CS complicated with cardiomyopathies, we retrospectively reviewed the clinical manifestations, laboratory results, cardiac imaging results and prognosis to further understand the diagnosis, treatment, and management of these cases. Methods: The clinical data of patients diagnosed with CS complicated with cardiomyopathies obtained from discharge sheets from Peking Union Medical College Hospital from January 1986 to August 2021 were collected. Case reports of CS complicated with cardiomyopathies were retrieved from PubMed. In addition, Cushing's disease (CD) patients without cardiomyopathies were collected as controls to compare the clinical features. Results: A total of 19 cases of CS complicated with cardiomyopathies and cases of CD without cardiomyopathies (n = 242) were collected. The causes of CS included pituitary adenoma (n = 8, 42.11%), adrenal adenoma (n = 7, 36.84%), ectopic adrenocorticotropic hormone (ACTH) tumor (n = 2, 10.53%) and unclear causes (n = 2, 10.53%) in the CS complicated with cardiomyopathies group. The types of cardiomyopathies were dilated cardiomyopathies (n = 15, 78.94%) and hypertrophic cardiomyopathies (n = 4, 21.05%). The serum sodium concentration was significantly higher [145.50 (140.50-148.00) mmol/L vs. 141.00 (140.00-143.00) mmol/L], while the serum potassium concentration was significantly lower [2.70 (2.40-3.60) mmol/L] vs. 3.90 (3.50-4.20 mmol/L)] in the CS complicated with cardiomyopathies group compared to the CD patients without cardiomyopathies. There were no significant differences between the CS complicated with cardiomyopathies group and the CD patients without cardiomyopathies in the serum cortisol concentration and 24-h urine free cortisol, but a significant difference in the adrenocorticotropic hormone level [109.00 (91.78-170.30) pg/ml vs. 68.60 (47.85-110.00) pg/ml]. Twelve/16 (75.0%) patients showed significant improvement or even a complete healing of the heart structure and function after remission of hypercortisolemia after treatment with CS. Conclusions: CS complicated with cardiomyopathies is a very rare clinical entity, in which cortisol plays an important role and it can be greatly improved after remission of hypercortisolemia.
RESUMO
We experimentally demonstrate focusing and guiding electromagnetic (EM) waves in a designer surface plasmonic waveguide with deep subwavelength mode cross section. Our experiments show that a metal grating with suitable parameters, functioning as a designer surface plasmonic waveguide, can support deep subwavelength surface modes and the width of the modes can be squeezed also into deep subwavelength by tapering the width of the waveguide. The results provide a new insight into deep subwavelength waveguiding and focusing.