Probing the Ca2+ mobilizing properties on primary cortical neurons of a new stable cADPR mimic.

Cyclic adenosine diphosphate ribose (cADPR) is a second messenger involved in the Ca2+ homeostasis. Its chemical instability prompted researchers to tune point by point its structure, obtaining stable analogues featuring interesting biological properties. One of the most challenging derivatives is the cyclic inosine diphosphate ribose (cIDPR), in which the hypoxanthine isosterically replaces the adenine. As our research focuses on the synthesis of N1 substituted inosines, in the last few years we have produced new flexible cIDPR analogues, where the northern ribose has been replaced by alkyl chains. Interestingly, some of them mobilized Ca2+ ions in PC12 cells. To extend our SAR studies, herein we report on the synthesis of a new stable cIDPR derivative which contains the 2″S,3″R dihydroxypentyl chain instead of the northern ribose. Interestingly, the new cyclic derivative and its open precursor induced an increase in intracellular calcium concentration ([Ca2+]i) with the same efficacy of the endogenous cADPR in rat primary cortical neurons.

Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures.

ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.

Peptide Nucleic Acid-Functionalized Adenoviral Vectors Targeting G-Quadruplexes in the P1 Promoter of Bcl-2 Proto-Oncogene: A New Tool for Gene Modulation in Anticancer Therapy.

The B-cell lymphoma 2 (Bcl-2) gene encodes for an antiapoptotic protein associated with the onset of many human tumors. Several oligonucleotides (ONs) and ON analogues are under study as potential tools to counteract the Bcl-2 expression. Among these are Peptide Nucleic Acids (PNAs). The absence of charges on PNA backbones allows the formation of PNA/DNA complexes provided with higher stability than the corresponding natural DNA/DNA counterparts. To date, the use of PNAs in antigene or antisense strategies is strongly limited by their inability to efficiently cross the cellular membranes. With the aim of downregulating the expression of Bcl-2, we propose here a novel antigene approach which uses oncolytic adenoviral vectors (OAds) as a new cancer cell-targeted PNA delivery system. The ability of oncolytic Ad5D24 vectors to selectively infect and kill cancer cells was exploited to transfect with high efficiency and selectivity a short cytosine-rich PNA complementary to the longest loop of the main G-quadruplex formed by the 23-base-long bcl2midG4 sequence located 52-30 bp upstream of the P1 promoter of Bcl-2 gene. Physico-chemical and biological investigations confirmed the ability of the PNA-conjugated Ad5D24 vectors to load and transfect their PNA cargo into human A549 and MDA-MB-436 cancer cell lines, as well as the synergistic (OAd+PNA) cytotoxic effect against the same cell lines. This approach holds promise for safer chemotherapy because of reduced toxicity to healthy tissues and organs.

New Linear Precursors of cIDPR Derivatives as Stable Analogs of cADPR: A Potent Second Messenger with Ca2+-Modulating Activity Isolated from Sea Urchin Eggs.

Herein, we report on the synthesis of a small set of linear precursors of an inosine analogue of cyclic ADP-ribose (cADPR), a second messenger involved in Ca2+ mobilization from ryanodine receptor stores firstly isolated from sea urchin eggs extracts. The synthesized compounds were obtained starting from inosine and are characterized by an N1-alkyl chain replacing the "northern" ribose and a phosphate group attached at the end of the N1-alkyl chain and/or 5'-sugar positions. Preliminary Ca2+ mobilization assays, performed on differentiated C2C12 cells, are reported as well.

New G-Quadruplex-Forming Oligodeoxynucleotides Incorporating a Bifunctional Double-Ended Linker (DEL): Effects of DEL Size and ODNs Orientation on the Topology, Stability, and Molecularity of DEL-G-Quadruplexes.

G-quadruplexes (G4s) are unusual secondary structures of DNA occurring in guanosine-rich oligodeoxynucleotide (ODN) strands that are extensively studied for their relevance to the biological processes in which they are involved. In this study, we report the synthesis of a new kind of G4-forming molecule named double-ended-linker ODN (DEL-ODN), in which two TG4T strands are attached to the two ends of symmetric, non-nucleotide linkers. Four DEL-ODNs differing for the incorporation of either a short or long linker and the directionality of the TG4T strands were synthesized, and their ability to form G4 structures and/or multimeric species was investigated by PAGE, HPLC⁻size-exclusion chromatography (HPLC⁻SEC), circular dichroism (CD), and NMR studies in comparison with the previously reported monomeric tetra-ended-linker (TEL) analogues and with the corresponding tetramolecular species (TG4T)4. The structural characterization of DEL-ODNs confirmed the formation of stable, bimolecular DEL-G4s for all DEL-ODNs, as well as of additional DEL-G4 multimers with higher molecular weights, thus suggesting a way towards the obtainment of thermally stable DNA nanostructures based on reticulated DEL-G4s.

Characterisation and Antioxidant Activity of Crude Extract and Polyphenolic Rich Fractions from C. incanus Leaves.

Cistus incanus (Cistaceae) is a Mediterranean evergreen shrub. Cistus incanus herbal teas have been used as a general remedy in traditional medicine since ancient times. Recent studies on the antioxidant properties of its aqueous extracts have indicated polyphenols to be the most active compounds. However, a whole chemical characterisation of polyphenolic compounds in leaves of Cistus incanus (C. incanus) is still lacking. Moreover, limited data is available on the contribution of different polyphenolic compounds towards the total antioxidant capacity of its extracts. The purpose of this study was to characterise the major polyphenolic compounds present in a crude ethanolic leaf extract (CEE) of C. incanus and develop a method for their fractionation. Superoxide anion, hydroxyl and DPPH (1,1-diphenyl-2-picrylhydrazyl) radical scavenging assays were also performed to evaluate the antioxidant properties of the obtained fractions. Three different polyphenolic enriched extracts, namely EAC (Ethyl Acetate Fraction), AF1 and AF2 (Aqueos Fractions), were obtained from CEE. Our results indicated that the EAC, enriched in flavonols, exhibited a higher antiradical activity compared to the tannin enriched fractions (AF1 and AF2). These findings provide new perspectives for the use of the EAC as a source of antioxidant compounds with potential uses in pharmaceutical preparations.

Higher-order G-quadruplex structures and porphyrin ligands: Towards a non-ambiguous relationship.

Herein, we evaluated the interaction of the tetracationic porphyrin H2TCPPSpm4 with three distinct DNA G-quadruplex (G4) models, i.e., the tetramolecular G4 d(TGGGGT)4 (Q1), the 5'-5' stacked G4-dimer [d(CGGAGGT)4]2 (Q2), and a mixture of 5'-5' stacked G-wires [d(5'-CGGT-3'-3'-GGC-5')4]n (Qn). The combined data obtained from UV-Vis, CD, fluorescence, PAGE, RLS, AFM, NMR, and HPLC-SEC experiments allowed us to shed light on the binding mode of H2TCPPSpm4 with the three G4 models differing for the type and the number of available G4 ending faces, the length of the G4 units, and the number of stacked G4 building blocks. Specifically, we found that H2TCPPSpm4 interacted with the shortest Q1 as an end-stacking ligand, whereas the groove binding mode was ascertained in the case of the Q2 and Qn G4 models. In the case of the interaction with Q1 and Qn, we found that H2TCPPSpm4 induces the formation of supramolecular aggregates at porphyrin/G4 ratios higher than 2:1, whereas no significant aggregation was observed for the interaction with Q2 up to the 5:1 ratio. These results unambiguously demonstrated the suitability of porphyrins for the development of specific G4 ligands or G4-targeting diagnostic probes, being H2TCPPSpm4 capable to distinguish between different G4s.

Polymorphism of G-quadruplexes formed by short oligonucleotides containing a 3'-3' inversion of polarity: From G:C:G:C tetrads to π-π stacked G-wires.

G-wires are supramolecular DNA structures based on the G-quadruplex (G4) structural motif obtained by the self-assembly of interlocked slipped G-rich oligonucleotide (ON) strands, or by end-to-end stacking of G4 units. Despite the increasing interest towards G-wires due to their potential applications in DNA nanotechnologies, the self-assembly process to obtain G-wires having a predefined length and stability is still neither completely understood nor controlled. In our previous studies, we demonstrated that the d(5'CG2-3'-3'-G2C5') ON, characterized by the presence of a 3'-3'-inversion of polarity site self-assembles into a G-wire structure when annealed in the presence of K+ ions. Herein, by using CD, PAGE, HPLC size exclusion chromatography, and NMR investigations we studied the propensity of shorter analogues having sequences 5'CGn-3'-3'-GmC5' (with n = 1 and 1 ≤ m ≤ 3) to form the corresponding G-quadruplexes and stacked G-wires. The results revealed that the formation of G-wires starting from d(5'CGn-3'-3'-GmC5') ONs is possible only for the sequences having n and m > 1 in which both guanosines flanking the 5'-ending cytosines are not involved into the 3'-3' phosphodiester bond.

3D Chitosan-Gallic Acid Complexes: Assessment of the Chemical and Biological Properties.

Three-dimensional chitosan-gallic acid complexes were proposed and prepared for the first time by a simple adsorption process of gallic acid (GA) on three-dimensional chitosan structures (3D chitosan). Highly porous 3D devices facilitate a high GA load, up to 2015 mmol/kg at pH 4.0. The preservation of the redox state of GA released from 3D chitosan was confirmed by spectroscopic analyses. The antioxidant activity of 3D chitosan-GA complexes was assessed using the DPPH radical scavenging assay and was found to be dramatically higher than that of free chitosan. The mechanical property of 3D chitosan-GA complexes was also evaluated using a compression test. Finally, 3D chitosan-GA complexes showed a significant antimicrobial capacity against E. coli and S. aureus, selected, respectively, as a model strain for Gram-negative and Gram-positive bacteria. Our study demonstrated a new, simple, and eco-friendly approach to prepare functional chitosan-based complexes for nutraceutical, cosmeceutical, and pharmaceutical applications.

Cytosine-rich oligonucleotides incorporating a non-nucleotide loop: A further step towards the obtainment of physiologically stable i-motif DNA.

i-Motifs, also known as i-tetraplexes, are secondary structures of DNA occurring in cytosine-rich oligonucleotides (CROs) that recall increasing interest in the scientific community for their relevance in various biological processes and DNA nanotechnology. This study reports the design of new structurally modified CROs, named Double-Ended-Linker-CROs (DEL-CROs), capable of forming stable i-motif structures. Here, two C-rich strands having sequences d(AC4A) and d(C6) have been attached, in a parallel fashion, to the two linker's edges by their 3' or 5' ends. The resulting DEL-CROs have been investigated for their capability to form i-motif structures by circular dichroism, poly-acrylamide gel electrophoresis, HPLC-size-exclusion chromatography, and NMR studies. This investigation established that DEL-CROs could form more stable i-motif structures than the corresponding unmodified CROs. In particular, the i-motif formed by DEL-5'-d(C6)2 resulted stable enough to be detected even at near physiological conditions (37 °C, pH 7.0). The results open the way to developing pH-switchable nanocarriers and aptamers based on suitably functionalized DEL-CROs.

Exploring a peptide nucleic acid-based antisense approach for CD5 targeting in chronic lymphocytic leukemia.

We herein report an innovative antisense approach based on Peptide Nucleic Acids (PNAs) to down-modulate CD5 expression levels in chronic lymphocytic leukemia (CLL). Using bioinformatics tools, we selected a 12-mer tract of the CD5 mRNA as the molecular target and synthesized the complementary and control PNA strands bearing a serine phosphate dipeptide tail to enhance their water solubility and bioavailability. The specific recognition of the 12-mer DNA strand, corresponding to the target mRNA sequence by the complementary PNA strand, was confirmed by non-denaturing polyacrylamide gel electrophoresis, thermal difference spectroscopy, circular dichroism (CD), and CD melting studies. Cytofluorimetric assays and real-time PCR analysis demonstrated the downregulation of CD5 expression due to incubation with the anti-CD5 PNA at RNA and protein levels in Jurkat cell line and peripheral blood mononuclear cells from B-CLL patients. Interestingly, we also observed that transfection with the anti-CD5 PNA increases apoptotic response induced by fludarabine in B-CLL cells. The herein reported results suggest that PNAs could represent a potential candidate for the development of antisense therapeutic agents in CLL.

Bioconjugation of a PNA Probe to Zinc Oxide Nanowires for Label-Free Sensing.

Zinc oxide nanowires (ZnONWs) are largely used in biosensing applications due to their large specific surface area, photoluminescence emission and electron mobility. In this work, the surfaces of ZnONWs are modified by covalent bioconjugation of a peptidic nucleic acid (PNA) probe whose sequence is properly chosen to recognize a complementary DNA (cDNA) strand corresponding to a tract of the CD5 mRNA, the main prognostic marker of chronic lymphatic leukemia. The interaction between PNA and cDNA is preliminarily investigated in solution by circular dichroism, CD melting, and polyacrylamide gel electrophoresis. After the immobilization of the PNA probe on the ZnONW surface, we demonstrate the ability of the PNA-functionalized ZnONW platform to detect cDNA in the µM range of concentration by electrical, label-free measurements. The specificity of the sensor is also verified against a non-complementary DNA sequence. These preliminary results highlight the potential application of PNA-bioconjugated ZnONWs to label-free biosensing of tumor markers.

Assisting PNA transport through cystic fibrosis human airway epithelia with biodegradable hybrid lipid-polymer nanoparticles.

Cystic fibrosis (CF) is characterized by an airway obstruction caused by a thick mucus due to a malfunctioning Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) protein. The sticky mucus restricts drugs in reaching target cells limiting the efficiency of treatments. The development of new approaches to enhance drug delivery to the lungs represents CF treatment's main challenge. In this work, we report the production and characterization of hybrid core-shell nanoparticles (hNPs) comprising a PLGA core and a dipalmitoylphosphatidylcholine (DPPC) shell engineered for inhalation. We loaded hNPs with a 7-mer peptide nucleic acid (PNA) previously considered for its ability to modulate the post-transcriptional regulation of the CFTR gene. We also investigated the in vitro release kinetics of hNPs and their efficacy in PNA delivery across the human epithelial airway barrier using an ex vivo model based on human primary nasal epithelial cells (HNEC) from CF patients. Confocal analyses and hNPs transport assay demonstrated the ability of hNPs to overcome the mucus barrier and release their PNA cargo within the cytoplasm, where it can exert its biological function.

Probing the DNA Reactivity and the Anticancer Properties of a Novel Tubercidin-Pt(II) Complex.

Herein, we reported on the synthesis of a novel Pt(II) neutral complex having as ligand the nucleoside tubercidin, a potent anti-tumor agent extracted from the bacterium Streptomyces Tubercidicus. In detail, the chelation of the metal by a diamine linker installed at C6 purine position of tubercidin assured the introduction of a cisplatin-like unit in the molecular scaffold. The behavior of the synthesized complex with a double-strand DNA model was monitored by CD spectroscopy and compared with that of cisplatin and tubercidin. In addition, the cell viability was evaluated against HeLa, A375 and WM266 human cancer cell lines using the MTT test. Lastly, the results of the apoptotic assay (FITC Annexin V) performed on the HeLa cancer cell line are also reported.

PNA-Based Graphene Oxide/Porous Silicon Hybrid Biosensor: Towards a Label-Free Optical Assay for Brugada Syndrome.

Peptide nucleic acid (PNA) is a synthetic DNA mimic that outperforms the properties of traditional oligonucleotides (ONs). On account of its outstanding features, such as remarkable binding affinity towards complementary DNA or RNA as well as high thermal and chemical stability, PNA has been proposed as a valuable alternative to the ON probe in gene-sensor design. In this study, a hybrid transducer made-up of graphene oxide (GO) nano-sheets covalently grafted onto a porous silicon (PSi) matrix has been investigated for the early detection of a genetic cardiac disorder, the Brugada syndrome (BS). A functionalization strategy towards the realization of a potential PNA-based device is described. A PNA, able to detect the SCN5A gene associated with the BS, has been properly synthesized and used as a bioprobe for the realization of a proof-of-concept label-free optical PNA-biosensor. PSi reflectance and GO photoluminescence signals were simultaneously exploited for the monitoring of the device functionalization and response.

Rúbricas como instrumento de evaluación de ateneos en una residencia de Bioquímica Clínica de un hospital universitario. Estudio sobre su confiabilidad e impacto educativo / Rubrics as an evaluation instrument for conferences in a Clinical Biochemistry residency at a university hospital. Study on its reliability and educational impact / Rubricas como instrumento de avaliação de congressos em uma residência de Bioquímica Clínica de um hospital universitário. Estudo sobre sua confiabilidade e impacto educacional

Resumen El objetivo del estudio fue describir el uso de rúbricas para la evaluación formativa de la participación de profesionales en formación en el desarrollo de ateneos. Se realizó un estudio observacional, descriptivo, transversal y retrospectivo sobre la rúbrica de ateneos de programas de formación de posgrado de Bioquímica Clínica y se analizó la confiabilidad (por medio del coeficiente alfa de Cronbach) y su impacto educativo. Se analizaron 51 rúbricas sobre 41 ateneos de 9 profesionales en formación (residentes y becarios) por 19 evaluadores. La estimación de confiabilidad arrojó un alfa de Cronbach de 0,71 (nivel de confianza del 95%, p≤0,05). La rúbrica aquí analizada ha servido para clarificar las metas de aprendizajes de una actividad tradicional en la formación de posgrado en servicio. Se ha logrado generar un instrumento de evaluación confiable que puede ser utilizado en otras profesiones y especialidades del equipo de salud.

Abstract The objective of the study was to describe the use of rubrics for the formative evaluation of the participation of professionals in training in the development of conferences. An observational, descriptive, cross-sectional and retrospective study was carried out on the rubric of athenaeums of postgraduate training programmes in Clinical Biochemistry, analysing its reliability (by means of Cronbach's alpha coefficient) and its educational impact. Fifty-one rubrics difewere analysed on 41 athenaeums of 9 professionals in training (residents and fellows) by 19 evaluators. The reliability estimate yielded a Cronbach's alpha of 0.71 (95% confidence level, p≤0.05). The rubric analysed here has served to clarify the learning goals of a traditional activity in postgraduate training in service. It has been possible to generate a reliable evaluation instrument that can be used in other professions and specialties of the health team.

Resumo O objetivo do estudo foi descrever a utilização de rubricas para avaliação formativa da participação de profissionais em formação no desenvolvimento de ateneus. Foi realizado um estudo observacional, descritivo, transversal e retrospectivo da rubrica de ateneus dos programas de formação pós-graduação em Bioquímica Clínica, analisando a sua fiabilidade (através do coeficiente alpha de Cronbach) e o seu impacto educacional. Cinquenta e uma rubricas de 41 ateneus de 9 profissionais em formação (residentes e bolsistas) foram analisadas por 19 avaliadores. A estimativa de confiabilidade resultou em um alfa de Cronbach de 0,71 (nível de confiança de 95%, p≤0,05). A rubrica aqui analisada serviu para esclarecer os objetivos de aprendizagens de uma atividade tradicional na formação pós-graduação em serviço. Foi possível gerar um instrumento de avaliação confiável que pode ser utilizado em outras profissões e especialidades da equipe de saúde.

Mixed Nodule Infection in Sinorhizobium meliloti-Medicago sativa Symbiosis Suggest the Presence of Cheating Behavior.

In the symbiosis between rhizobia and legumes, host plants can form symbiotic root nodules with multiple rhizobial strains, potentially showing different symbiotic performances in nitrogen fixation. Here, we investigated the presence of mixed nodules, containing rhizobia with different degrees of mutualisms, and evaluate their relative fitness in the Sinorhizobium meliloti-Medicago sativa model symbiosis. We used three S. meliloti strains, the mutualist strains Rm1021 and BL225C and the non-mutualist AK83. We performed competition experiments involving both in vitro and in vivo symbiotic assays with M. sativa host plants. We show the occurrence of a high number (from 27 to 100%) of mixed nodules with no negative effect on both nitrogen fixation and plant growth. The estimation of the relative fitness as non-mutualist/mutualist ratios in single nodules shows that in some nodules the non-mutualist strain efficiently colonized root nodules along with the mutualist ones. In conclusion, we can support the hypothesis that in S. meliloti-M. sativa symbiosis mixed nodules are formed and allow non-mutualist or less-mutualist bacterial partners to be less or not sanctioned by the host plant, hence allowing a potential form of cheating behavior to be present in the nitrogen fixing symbiosis.

Unbalanced translocation (3;5)(q26.1;p14): a clinical report.

A patient with a multiple congenital anomalies/mental retardation (MCA/MR) syndrome had an unbalanced translocation (3;5)(q26.1;p14), causing partial 5p monosomy and partial 3q trisomy. The phenotype observed in this patient results from the combination of those described in the isolated dup(3q) and del(5p) syndromes. Some clinical features of this patient are shared by the Smith-Lemli-Opitz syndrome (SLOS), a well-known MCA/MR syndrome due to the deficiency of 7-dehydrocholesterol reductase (DHCR7). We review the previously reported cases of chromosomal anomalies with clinical features suggesting SLOS.

[The experience of someone involved in the psychiatry reform in Brazil]. / Um relato de experiência de quem vivencia a reforma psiquiátrica no Brasil.

This report is a descriptive study based on bibliographic reviews, developed in the Health Policies course, a subject which is part of the Master's degree from the University of Rio de Janeiro (UNIRIO). Our objective is to report on our experiences working with psychosocial care, which has been our goal over the last 4 years, with an approach on the strategies adopted by the Brazilian Health Department, directed toward restructuring mental health care in Brazil. One realizes the need for objective interventions in order to make this process effective, such as the construction of a solid and amplified network for mental health care, the municipalization of health services which would reduce the risk of a fragmentation in services provided and would promote participation of family members and society in caring and reinserting mentally-ill patients.

Molecular characterization of an analphoid supernumerary marker chromosome derived from 18q22.1➔qter in prenatal diagnosis: a case report.

BACKGROUND: Small supernumerary marker chromosomes (sSMC) occur in 0.072% of unselected cases of prenatal diagnoses, and their molecular cytogenetic characterization is required to establish a reliable karyotype-phenotype correlation. A small group of sSMC are C-band-negative and devoid of alpha-satellite DNA. We report the molecular cytogenetic characterization of a de novo analphoid sSMC derived from 18q22.1→qter in cultured amniocytes. RESULTS: We identified an analphoid sSMC in cultured amniocytes during a prenatal diagnosis performed because of advanced maternal age. GTG-banding revealed an sSMC in all metaphases. FISH experiments with a probe specific for the chromosome 18 centromere, and C-banding revealed neither alphoid sequences nor C-banding-positive satellite DNA thereby suggesting the presence of a neocentromere. To characterize the marker in greater detail, we carried out additional FISH experiments with a set of appropriate BAC clones. The pattern of the FISH signals indicated a symmetrical organization of the marker, the breakpoint likely representing the centromere of an inverted duplicated chromosome that results in tetrasomy of 18q22.1→qter. The karyotype after molecular cytogenetic investigations was interpreted as follows: 47,XY,+inv dup(18)(qter→q22.1::q22.1→neo→qter). CONCLUSION: Our case is the first report, in the prenatal diagnosis setting, of a de novo analphoid marker chromosome originating from the long arm of chromosome 18, and the second report of a neocentromere formation at 18q22.1.