CuGenDBv2: an updated database for cucurbit genomics.

The Cucurbitaceae (cucurbit) family consists of about 1,000 species in 95 genera, including many economically important and popular fruit and vegetable crops. During the past several years, reference genomes have been generated for >20 cucurbit species, and variome and transcriptome profiling data have been rapidly accumulated for cucurbits. To efficiently mine, analyze and disseminate these large-scale datasets, we have developed an updated version of Cucurbit Genomics Database. The updated database, CuGenDBv2 (http://cucurbitgenomics.org/v2), currently hosts 34 reference genomes from 27 cucurbit species/subspecies belonging to 10 different genera. Protein-coding genes from these genomes have been comprehensively annotated by comparing their protein sequences to various public protein and domain databases. A novel 'Genotype' module has been implemented to facilitate mining and analysis of the functionally annotated variome data including SNPs and small indels from large-scale genome sequencing projects. An updated 'Expression' module has been developed to provide a comprehensive gene expression atlas for cucurbits. Furthermore, synteny blocks between any two and within each of the 34 genomes, representing a total of 595 pair-wise genome comparisons, have been identified and can be explored and visualized in the database.

First report of watermelon crinkle leaf-associated virus 1 naturally infecting watermelon (Citrullus lanatus) in Georgia, USA.

Watermelon (Citrullus lanatus) is one of the major vegetable crops grown in Georgia during the spring and summer seasons, contributing $180 million of farmgate value to the state's economy (Georgia Farm Gate Value Report 2019). During the summer of 2021, watermelon plants with foliar symptoms such as yellow mottling, chlorosis, and wrinkling with thickened, bunchy, and upward curling were observed on commercial fields of Georgia, USA. A disease incidence of 15-20% in ~56 ac in Tift county and 10-15% in ~60 ac in Wilcox county was observed. The symptoms observed were similar to those described for watermelon crinkle leaf-associated viruses (WCLaV-1 and WCLaV-2) from Florida (Hendrick et al., 2021) and Texas (Hernandez et al., 2021). Symptomatic leaves from Tift (n=40) and Wilcox (n=20) counties were collected, surface sterilized with 0.1% bleach and used for total nucleic acid extractions using MagMAX 96 Viral RNA isolation kit (ThermoFisher Scientific, Waltham, MA, USA) following the manufacturer's instruction without DNase treatment. The potential introduction of WCLaV-1 and WCLaV-2 into Georgia was tested by reverse-transcription-polymerase chain reaction (RT-PCR) assay using specific primers targeting RNA-dependent-RNA polymerase (RdRp) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). The expected amplicon sizes for RdRp (~900 nt) and MP (~500 nt) genes of WCLaV-1 located on RNA 1 and RNA 2 segements, respectively, were observed in 39 of 40 (97.5%) samples from Tift and seven of 20 (35%) samples from Wilcox. However, WCLaV-2 was not detected in any of the tested samples. All 60 samples also tested negative for the whitefly-transmitted viruses prevalent in the region, including cucurbit chlorotic yellows virus, cucurbit yellow stunting disorder virus, and cucurbit leaf crumple virus using virus-specific primers (Kavalappara et al., 2021). A subset of the samples analyzed by RT-PCR were also tested by SYBR green-based real-time RT-PCR assay targeting MP gene of WCLaV-1 using primers WCLaV-1FP (5'TCCACAAGCTTGATGGA- GGG3') and WCLaV-1RP (5'TCCCGAGTGAGGAAGCTAGT3'). The virus was detected in samples from both counties and the results matched with those obtained by the conventional RT-PCR assays (Suppl. Table 1). The presence of WCLaV-1 was further confirmed by sequencing (Genewiz, South Plainfield, NJ, USA) coupled with BLASTn analysis of amplicons resulted from the conventional RT-PCR from three randomly selected samples . The partial RdRp sequences (OL469153 to OL469155) were 99.3% and 99.9% identical to the corresponding sequences of WCLaV-1 isolates from China (KY781184) and Texas (MW559074) respectively. The partial MP sequences (OL469150 to OL469152) were 100% identical to those from China (KY781185) and Texas (MW559077). WCLaV-1 and WCLaV-2 were first discovered in Asia (Xin et al., 2017). Both viruses were subsequently reported from North and South Americas (Hendrick et al., 2021; Hernandez et al., 2021; Maeda et al., 2021), indicating their geographical expansion. Biological information, including vector relations, is unknown for both viruses and other members of the genus Coguvirus (family Phenuiviridae), to which they are provisionally assigned (Zhang et al., 2021). Further studies are also required to understand the biology and impact of both viruses on watermelon production and other crops, if any.

QTL associated with gummy stem blight resistance in watermelon.

KEY MESSAGE: We identified QTLs associated with gummy stem blight resistance in an interspecific F2:3 Citrullus population and developed marker assays for selection of the loci in watermelon. Gummy stem blight (GSB), caused by three Stagonosporopsis spp., is a devastating fungal disease of watermelon (Citrullus lanatus) and other cucurbits that can lead to severe yield losses. Currently, no commercial cultivars with genetic resistance to GSB in the field have been reported. Utilizing GSB-resistant cultivars would reduce yield losses, decrease the high cost of disease control, and diminish hazards resulting from frequent fungicide application. The objective of this study was to identify quantitative trait loci (QTLs) associated with GSB resistance in an F2:3 interspecific Citrullus mapping population (N = 178), derived from a cross between Crimson Sweet (C. lanatus) and GSB-resistant PI 482276 (C. amarus). The population was phenotyped by inoculating seedlings with Stagonosporopsis citrulli 12178A in the greenhouse in two separate experiments, each with three replications. We identified three QTLs (ClGSB3.1, ClGSB5.1 and ClGSB7.1) associated with GSB resistance, explaining between 6.4 and 21.1% of the phenotypic variation. The genes underlying ClGSB5.1 includes an NBS-LRR gene (ClCG05G019540) previously identified as a candidate gene for GSB resistance in watermelon. Locus ClGSB7.1 accounted for the highest phenotypic variation and harbors twenty-two candidate genes associated with disease resistance. Among them is ClCG07G013230, encoding an Avr9/Cf-9 rapidly elicited disease resistance protein, which contains a non-synonymous point mutation in the DUF761 domain that was significantly associated with GSB resistance. High throughput markers were developed for selection of ClGSB5.1 and ClGSB7.1. Our findings will facilitate the use of molecular markers for efficient introgression of the resistance loci and development of GSB-resistant watermelon cultivars.

First report of cucurbit chlorotic yellows virus in association with other whitefly-transmitted viruses in squash (Cucurbita pepo) in Georgia.

Viruses transmitted by whiteflies (Bemisia tabaci) cause severe damage to cucurbits in the southern United States. In the fall of 2020, samples of squash plants (Cucurbita pepo) exhibiting symptoms of yellow mottle, interveinal yellowing, and leaf crumple were collected from an insecticide trial in Tifton, Georgia. Total nucleic acid was isolated using the MagMAX 96 Viral RNA Isolation Kit (ThermoFisher Scientific) following the manufacturer's instructions but without DNase treatment. Polymerase chain reaction (PCR) and reverse transcription (RT)-PCR were carried out to determine the presence of whitefly-transmitted viruses. We identified infection by cucurbit chlorotic yellows virus (CCYV) using primers targeting a 953 nt segment of CCYV RNA1 encoding the RNA dependent RNA polymerase gene (RdRp) (CCYV-RDRP-1515F-5'CTCCGAGTAGATCATCCCAAATC3' and CCYV-RDRP-1515R-5'TCACCAGAAACTCCACAATCTC 3') along with other whitefly-transmitted viruses previously reported in Georgia. CCYV was detected from 27 of the 28 samples tested, while cucurbit yellow stunting disorder virus (CYSDV; Polston et al., 2008) and cucurbit leaf crumple virus (CuLCrV; Gadhave et al., 2020) were detected from 23 and 28 squash samples, respectively, with all three viruses regularly occurring as mixed infections. The presence of CCYV was further confirmed by amplification of portions of two different genomic segments from RNA2, including a section of the heat-shock protein (HSP) homolog gene (Bananej et al. 2013) as well as a portion of the coat protein (CP) gene which was amplified using primers CCYV_CPF-5'TCCCGGTGCCAACT GAGACA3' and CCYV_CPR- 5' TACGCGCGGCAGAGGAATTT 3'. The respective 462 bp HSP and 375 bp CP amplicons were cloned and sequenced. The partial coat protein gene sequence (MW251342) was 97.86% identical to a CCYV isolate from Shanghai (KY400633). The partial HSP sequence (MW251341) shared 99.73% identity with the recently identified CCYV isolate from California (MH806868). Criniviruses are an emerging group of whitefly-transmitted viruses responsible for worldwide losses of billions of dollars annually (Tzanetakis et al., 2013). CCYV, a member of the genus Crinivirus, was believed to be restricted to Asia, Africa, and the Mediterranean regions of Europe (Bananej et al., 2013; Orfanidou et al., 2014) until it was recently identified in the Imperial Valley of California (Wintermantel et al., 2019). Southern Georgia has been experiencing high whitefly populations, resulting in the emergence of CuLCrV and CYSDV on vegetables in recent years. Because CCYV can produce symptoms virtually identical to those of CYSDV and occurs in mixed infections in cucurbits with other whitefly-transmitted viruses, its epidemiology, role in disease incidence, severity, and impact on economically important crops in the southeastern United States will require further investigation.

Genetic architecture of fruit size and shape variation in cucurbits: a comparative perspective.

The Cucurbitaceae family hosts many economically important fruit vegetables (cucurbits) such as cucumber, melon, watermelon, pumpkin/squash, and various gourds. The cucurbits are probably best known for the diverse fruit sizes and shapes, but little is known about their genetic basis and molecular regulation. Here, we reviewed the literature on fruit size (FS), shape (FSI), and fruit weight (FW) QTL identified in cucumber, melon, and watermelon, from which 150 consensus QTL for these traits were inferred. Genome-wide survey of the three cucurbit genomes identified 253 homologs of eight classes of fruit or grain size/weight-related genes cloned in Arabidopsis, tomato, and rice that encode proteins containing the characteristic CNR (cell number regulator), CSR (cell size regulator), CYP78A (cytochrome P450), SUN, OVATE, TRM (TONNEAU1 Recruiting Motif), YABBY, and WOX domains. Alignment of the consensus QTL with candidate gene homologs revealed widespread structure and function conservation of fruit size/shape gene homologs in cucurbits, which was exemplified with the fruit size/shape candidate genes CsSUN25-26-27a and CsTRM5 in cucumber, CmOFP1a in melon, and ClSUN25-26-27a in watermelon. In cucurbits, the andromonoecy (for 1-aminocyclopropane-1-carboxylate synthase) and the carpel number (for CLAVATA3) loci are known to have pleiotropic effects on fruit shape, which may complicate identification of fruit size/shape candidate genes in these regions. The present work illustrates the power of comparative analysis in understanding the genetic architecture of fruit size/shape variation, which may facilitate QTL mapping and cloning for fruit size-related traits in cucurbits. The limitations and perspectives of this approach are also discussed.

Genome of 'Charleston Gray', the principal American watermelon cultivar, and genetic characterization of 1,365 accessions in the U.S. National Plant Germplasm System watermelon collection.

Years of selection for desirable fruit quality traits in dessert watermelon (Citrullus lanatus) has resulted in a narrow genetic base in modern cultivars. Development of novel genomic and genetic resources offers great potential to expand genetic diversity and improve important traits in watermelon. Here, we report a high-quality genome sequence of watermelon cultivar 'Charleston Gray', a principal American dessert watermelon, to complement the existing reference genome from '97103', an East Asian cultivar. Comparative analyses between genomes of 'Charleston Gray' and '97103' revealed genomic variants that may underlie phenotypic differences between the two cultivars. We then genotyped 1365 watermelon plant introduction (PI) lines maintained at the U.S. National Plant Germplasm System using genotyping-by-sequencing (GBS). These PI lines were collected throughout the world and belong to three Citrullus species, C. lanatus, C. mucosospermus and C. amarus. Approximately 25 000 high-quality single nucleotide polymorphisms (SNPs) were derived from the GBS data using the 'Charleston Gray' genome as the reference. Population genomic analyses using these SNPs discovered a close relationship between C. lanatus and C. mucosospermus and identified four major groups in these two species correlated to their geographic locations. Citrullus amarus was found to have a distinct genetic makeup compared to C. lanatus and C. mucosospermus. The SNPs also enabled identification of genomic regions associated with important fruit quality and disease resistance traits through genome-wide association studies. The high-quality 'Charleston Gray' genome and the genotyping data of this large collection of watermelon accessions provide valuable resources for facilitating watermelon research, breeding and improvement.

An integrated genetic map based on four mapping populations and quantitative trait loci associated with economically important traits in watermelon (Citrullus lanatus).

BACKGROUND: Modern watermelon (Citrullus lanatus L.) cultivars share a narrow genetic base due to many years of selection for desirable horticultural qualities. Wild subspecies within C. lanatus are important potential sources of novel alleles for watermelon breeding, but successful trait introgression into elite cultivars has had limited success. The application of marker assisted selection (MAS) in watermelon is yet to be realized, mainly due to the past lack of high quality genetic maps. Recently, a number of useful maps have become available, however these maps have few common markers, and were constructed using different marker sets, thus, making integration and comparative analysis among maps difficult. The objective of this research was to use single-nucleotide polymorphism (SNP) anchor markers to construct an integrated genetic map for C. lanatus. RESULTS: Under the framework of the high density genetic map, an integrated genetic map was constructed by merging data from four independent mapping experiments using a genetically diverse array of parental lines, which included three subspecies of watermelon. The 698 simple sequence repeat (SSR), 219 insertion-deletion (InDel), 36 structure variation (SV) and 386 SNP markers from the four maps were used to construct an integrated map. This integrated map contained 1339 markers, spanning 798 cM with an average marker interval of 0.6 cM. Fifty-eight previously reported quantitative trait loci (QTL) for 12 traits in these populations were also integrated into the map. In addition, new QTL identified for brix, fructose, glucose and sucrose were added. Some QTL associated with economically important traits detected in different genetic backgrounds mapped to similar genomic regions of the integrated map, suggesting that such QTL are responsible for the phenotypic variability observed in a broad array of watermelon germplasm. CONCLUSIONS: The integrated map described herein enhances the utility of genomic tools over previous watermelon genetic maps. A large proportion of the markers in the integrated map are SSRs, InDels and SNPs, which are easily transferable across laboratories. Moreover, the populations used to construct the integrated map include all three watermelon subspecies, making this integrated map useful for the selection of breeding traits, identification of QTL, MAS, analysis of germplasm and commercial hybrid seed detection.

Small RNA Profiling of Cucurbit Yellow Stunting Disorder Virus from Susceptible and Tolerant Squash (Cucurbita pepo) Lines.

RNA silencing is a crucial mechanism of the antiviral immunity system in plants. Small RNAs guide Argonaut proteins to target viral RNA or DNA, preventing virus accumulation. Small RNA profiles in Cucurbita pepo line PI 420328 with tolerance to cucurbit yellow stunting disorder virus (CYSDV) were compared with those in Gold Star, a susceptible cultivar. The lower CYSDV symptom severity in PI 420328 correlated with lower virus titers and fewer sRNAs derived from CYSDV (vsRNA) compared to Gold Star. Elevated levels of 21- and 22-nucleotide (nt) size class vsRNAs were observed in PI 420328, indicating more robust and efficient RNA silencing in PI 420328. The distribution of vsRNA hotspots along the CYSDV genome was similar in both PI 420328 and Gold Star. However, the 3' UTRs, CPm, and p26 were targeted at a higher frequency in PI 420328.

Form and contour: breeding and genetics of organ shape from wild relatives to modern vegetable crops.

Shape is a primary determinant of consumer preference for many horticultural crops and it is also associated with many aspects of marketing, harvest mechanics, and postharvest handling. Perceptions of quality and preference often map to specific shapes of fruits, tubers, leaves, flowers, roots, and other plant organs. As a result, humans have greatly expanded the palette of shapes available for horticultural crops, in many cases creating a series of market classes where particular shapes predominate. Crop wild relatives possess organs shaped by natural selection, while domesticated species possess organs shaped by human desires. Selection for visually-pleasing shapes in vegetable crops resulted from a number of opportunistic factors, including modification of supernumerary cambia, allelic variation at loci that control fundamental processes such as cell division, cell elongation, transposon-mediated variation, and partitioning of photosynthate. Genes that control cell division patterning may be universal shape regulators in horticultural crops, influencing the form of fruits, tubers, and grains in disparate species. Crop wild relatives are often considered less relevant for modern breeding efforts when it comes to characteristics such as shape, however this view may be unnecessarily limiting. Useful allelic variation in wild species may not have been examined or exploited with respect to shape modifications, and newly emergent information on key genes and proteins may provide additional opportunities to regulate the form and contour of vegetable crops.

Comparative mapping in watermelon [Citrullus lanatus (Thunb.) Matsum. et Nakai].

The first single-nucleotide polymorphism (SNP) maps for watermelon [Citrullus lanatus (Thunb.) Matsum. et Nakai] were constructed and compared. Three populations were developed from crosses between two elite cultivars, Klondike Black Seeded × New Hampshire Midget (KBS × NHM), an elite cultivar and wild egusi accession, Strain II × PI 560023 (SII × Egusi) and an elite cultivar and a wild citron accession, ZWRM50 × PI 244019 (ZWRM × Citroides). The SII × Egusi and ZWRM × Citroides F(2) populations consisted of 187 and 182 individuals respectively while the KBS × NHM recombinant inbred line (RIL) population consisted of 164 lines. The length of the genetic maps were 1,438, 1,514 and 1,144 cM with average marker distances of 3.8, 4.2, and 3.4 cM for the KBS × NHM, SII × Egusi and ZWRM × Citroides populations, respectively. Shared markers were used to align the three maps so that the linkage groups (LGs) represented the 11 chromosomes of the species. Marker segregation distortion were observed in all three populations, but was highest (12.7 %) in the ZWRM × Citroides population, where Citroides alleles were favored. The three maps were used to construct a consensus map containing 378 SNP markers with an average distance of 5.1 cM between markers. Phenotypic data was collected for fruit weight (FWT), fruit length (FL), fruit width (FWD), fruit shape index (FSI), rind thickness (RTH) and Brix (BRX) and analyzed for quantitative trait loci (QTL) associated with these traits. A total of 40 QTL were identified in the three populations, including major QTL for fruit size and shape that were stable across genetic backgrounds and environments. The present study reports the first SNP maps for Citrullus and the first map constructed using two elite parents. We also report the first stable QTL associated with fruit size and shape in Citrullus lanatus. These maps, QTL and SNPs should be useful for the watermelon community and represent a significant step towards the potential use of molecular tools in watermelon breeding.

QTL associated with resistance to Stagonosporopsis citrulli in Citrullus amarus.

Gummy stem blight (GSB) is a fungal disease affecting cucurbit crops, including watermelon (Citrullus lanatus), leading to significant yield losses. The disease is caused by three Stagonosporopsis species, of which Stagonosporopsis citrulli is the most common in the southeastern United States. Currently no gummy stem blight-resistant watermelon cultivars are available to growers. In this study, QTL-seq in an interspecific population developed from Sugar Baby × PI 189225 (Citrullus amarus) identified QTL on chromosomes 2, 5, 9 and 11. A novel QTL on chromosome 5 (Qgsb5.2) associated with resistance to S. citrulli (PVE = 13.3%) was confirmed by genetic mapping. KASP marker assays were developed for selection of Qgsb5.2 to allow breeders to track the allele contributing resistance to GSB, reducing the need for laborious phenotyping. Pyramiding different GSB resistance QTL could be a useful strategy to develop GSB resistant watermelon cultivars.

Persistent, and Asymptomatic Viral Infections and Whitefly-Transmitted Viruses Impacting Cantaloupe and Watermelon in Georgia, USA.

Cucurbits in Southeastern USA have experienced a drastic decline in production over the years due to the effect of economically important viruses, mainly those transmitted by the sweet potato whitefly (Bemisia tabaci Gennadius). In cucurbits, these viruses can be found as a single or mixed infection, thereby causing significant yield loss. During the spring of 2021, surveys were conducted to evaluate the incidence and distribution of viruses infecting cantaloupe (n = 80) and watermelon (n = 245) in Georgia. Symptomatic foliar tissues were collected from six counties and sRNA libraries were constructed from seven symptomatic samples. High throughput sequencing (HTS) analysis revealed the presence of three different new RNA viruses in Georgia: cucumis melo endornavirus (CmEV), cucumis melo amalgavirus (CmAV1), and cucumis melo cryptic virus (CmCV). Reverse transcription-polymerase chain reaction (RT-PCR) analysis revealed the presence of CmEV and CmAV1 in 25% and 43% of the total samples tested, respectively. CmCV was not detected using RT-PCR. Watermelon crinkle leaf-associated virus 1 (WCLaV-1), recently reported in GA, was detected in 28% of the samples tested. Furthermore, RT-PCR and PCR analysis of 43 symptomatic leaf tissues collected from the fall-grown watermelon in 2019 revealed the presence of cucurbit chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and cucurbit leaf crumple virus (CuLCrV) at 73%, 2%, and 81%, respectively. This finding broadens our knowledge of the prevalence of viruses in melons in the fall and spring, as well as the geographical expansion of the WCLaV-1 in GA, USA.

Genetic Resources and Vulnerabilities of Major Cucurbit Crops.

The Cucurbitaceae family provides numerous important crops including watermelons (Citrullus lanatus), melons (Cucumis melo), cucumbers (Cucumis sativus), and pumpkins and squashes (Cucurbita spp.). Centers of domestication in Africa, Asia, and the Americas were followed by distribution throughout the world and the evolution of secondary centers of diversity. Each of these crops is challenged by multiple fungal, oomycete, bacterial, and viral diseases and insects that vector disease and cause feeding damage. Cultivated varieties are constrained by market demands, the necessity for climatic adaptations, domestication bottlenecks, and in most cases, limited capacity for interspecific hybridization, creating narrow genetic bases for crop improvement. This analysis of crop vulnerabilities examines the four major cucurbit crops, their uses, challenges, and genetic resources. ex situ germplasm banks, the primary strategy to preserve genetic diversity, have been extensively utilized by cucurbit breeders, especially for resistances to biotic and abiotic stresses. Recent genomic efforts have documented genetic diversity, population structure, and genetic relationships among accessions within collections. Collection size and accessibility are impacted by historical collections, current ability to collect, and ability to store and maintain collections. The biology of cucurbits, with insect-pollinated, outcrossing plants, and large, spreading vines, pose additional challenges for regeneration and maintenance. Our ability to address ongoing and future cucurbit crop vulnerabilities will require a combination of investment, agricultural, and conservation policies, and technological advances to facilitate collection, preservation, and access to critical Cucurbitaceae diversity.

A Contrast of Three Inoculation Techniques used to Determine the Race of Unknown Fusarium oxysporum f.sp. niveum Isolates.

Fusarium wilt of watermelon (Citrullus lanatus), caused by Fusarium oxysporum f. sp. niveum (Fon), has reemerged as a major production constraint in the southeastern USA, especially in Florida. Deployment of integrated pest management strategies, such as race-specific resistant cultivars, requires information on the diversity and population density of the pathogen in growers' fields. Despite some progress in developing molecular diagnostic tools to identify pathogen isolates, race determination often requires bioassay approaches. Race typing was conducted by root-dip inoculation, infested kernel seeding method, and the modified tray-dip method with each of the four watermelon differentials (Black Diamond, Charleston Grey, Calhoun Grey, Plant Introduction 296341-FR). Isolates are assigned a race designation by calculation of disease incidence five weeks after inoculation. If less than 33% of the plants for a particular cultivar were symptomatic, they were categorized as resistant. Those cultivars with incidence greater than 33% were regarded as susceptible. This paper describes three different methods of inoculation to ascertain race, root-dip, infested kernel, and modified tray-dip inoculation, whose applications vary according to the experimental design.

High Throughput Sequencing-Aided Survey Reveals Widespread Mixed Infections of Whitefly-Transmitted Viruses in Cucurbits in Georgia, USA.

Viruses transmitted by the sweet potato whitefly (Bemisia tabaci) have been detrimental to the sustainable production of cucurbits in the southeastern USA. Surveys were conducted in the fall of 2019 and 2020 in Georgia, a major cucurbit-producing state of the USA, to identify the viruses infecting cucurbits and their distribution. Symptomatic samples were collected and small RNA libraries were prepared and sequenced from three cantaloupes, four cucumbers, and two yellow squash samples. An analysis of the sequences revealed the presence of the criniviruses cucurbit chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and the begomovirus cucurbit leaf crumple virus (CuLCrV). CuLCrV was detected in 76%, CCYV in 60%, and CYSDV in 43% of the total samples (n = 820) tested. The level of mixed infections was high in all the cucurbits, with most plants tested being infected with at least two of these viruses. Near-complete genome sequences of two criniviruses, CCYV and CYSDV, were assembled from the small RNA sequences. An analysis of the coding regions showed low genetic variability among isolates from different hosts. In phylogenetic analysis, the CCYV isolates from Georgia clustered with Asian isolates, while CYSDV isolates clustered with European and USA isolates. This work enhances our understanding of the distribution of viruses on cucurbits in South Georgia and will be useful to develop strategies for managing the complex of whitefly-transmitted viruses in the region.

A Genome-Wide Analysis of the Pentatricopeptide Repeat (PPR) Gene Family and PPR-Derived Markers for Flesh Color in Watermelon (Citrullus lanatus).

Watermelon (Citrullus lanatus) is an economically important fruit crop grown for consumption of its large edible fruit flesh. Pentatricopeptide-repeat (PPR) encoding genes, one of the large gene families in plants, are important RNA-binding proteins involved in the regulation of plant growth and development by influencing the expression of organellar mRNA transcripts. However, systematic information regarding the PPR gene family in watermelon remains largely unknown. In this comprehensive study, we identified and characterized a total of 422 C. lanatus PPR (ClaPPR) genes in the watermelon genome. Most ClaPPRs were intronless and were mapped across 12 chromosomes. Phylogenetic analysis showed that ClaPPR proteins could be divided into P and PLS subfamilies. Gene duplication analysis suggested that 11 pairs of segmentally duplicated genes existed. In-silico expression pattern analysis demonstrated that ClaPPRs may participate in the regulation of fruit development and ripening processes. Genotyping of 70 lines using 4 single nucleotide polymorphisms (SNPs) from 4 ClaPPRs resulted in match rates of over 0.87 for each validated SNPs in correlation with the unique phenotypes of flesh color, and could be used in differentiating red, yellow, or orange watermelons in breeding programs. Our results provide significant insights for a comprehensive understanding of PPR genes and recommend further studies on their roles in watermelon fruit growth and ripening, which could be utilized for cultivar development of watermelon.

Chromosomal Locations and Interactions of Four Loci Associated With Seed Coat Color in Watermelon.

Different species of edible seed watermelons (Citrullus spp.) are cultivated in Asia and Africa for their colorful nutritious seeds. Consumer preference varies for watermelon seed coat color. Therefore, it is an important consideration for watermelon breeders. In 1940s, a genetic model of four genes, R, T, W and D, was proposed to elucidate the inheritance of seed coat color in watermelon. In this study, we developed three segregating F2 populations: Sugar Baby (dotted black seed, RRTTWW) × plant introduction (PI) 482379 (green seed, rrTTWW), Charleston Gray (dotted black seed, RRTTWW) × PI 189225 (red seed, rrttWW), and Charleston Gray (dotted black seed, RRTTWWdd) × UGA147 (clump seed, RRTTwwDD) to re-examine the four-gene model and to map the four genes. In the dotted black × green population, the dotted black seed coat color (R_) is dominant to green seed coat color (rr). In the dotted black × red population, the dominant dotted black seed coat color and the recessive red seed coat color segregate for the R and T genes, where the R gene is dominantly epistatic to the T gene. However, the inheritance of the T locus did not fit the four-gene model, thus we named it T1 . In the dotted black × clump population, the clump seed coat color and the dotted black seed coat color segregate for W and D, where D is recessively epistatic to W. The R, T1 , W, and D loci were mapped on chromosomes 3, 5, 6, and 8, respectively, using QTL-seq and genotyping-by-sequencing (GBS). Kompetitive Allele Specific PCR (KASP™) assays and SNP markers linked to the four loci were developed to facilitate maker-assisted selection (MAS) for watermelon seed coat color.

Whole genome resequencing of watermelons to identify single nucleotide polymorphisms related to flesh color and lycopene content.

Cultivated watermelon (Citrullus lanatus) is one of the most important food crops in the Cucurbitaceae family. Diversification after domestication has led cultivated watermelons to exhibit diverse fruit flesh colors, including red, yellow, and orange. Recently, there has been increased interest in red-fleshed watermelons because they contain the antioxidant cis-isomeric lycopene. We performed whole genome resequencing (WGRS) of 24 watermelons with different flesh colors to identify single-nucleotide polymorphisms (SNPs) related to high lycopene content. The resequencing data revealed 203,894-279,412 SNPs from read mapping between inbred lines and the 97103 reference genome. In total, 295,065 filtered SNPs were identified, which had an average polymorphism information content of 0.297. Most of these SNPs were intergenic (90.1%) and possessed a transversion (Tv) rate of 31.64%. Overall, 2,369 SNPs were chosen at 0.5 Mb physical intervals to analyze genetic diversity across the 24 inbred lines. A neighbor-joining dendrogram and principal coordinate analysis (PCA) based on the 2,369 SNPs revealed that the 24 inbred lines could be grouped into high and low lycopene-type watermelons. In addition, we analyzed SNPs that could discriminate high lycopene content, red-fleshed watermelon from low lycopene, yellow or orange watermelon inbred lines. For validation, 19 SNPs (designated as WMHL1-19) were chosen randomly, and cleavage amplified polymorphic sequence (CAPS) markers were designed. Genotyping of the above 24 lines and 12 additional commercial cultivars using WMHL1-19 CAPS markers resulted in match rates of over 0.92 for most validated markers in correlation with the flesh color phenotypes. Our results provide valuable genomic information regarding the high lycopene content phenotype of red-fleshed cultivated watermelons, and the identified SNPs will be useful for the development of molecular markers in the marker-assisted breeding of watermelons with high lycopene content.