Biological and molecular characterization of two Anticarsia gemmatalis multiple nucleopolyhedrovirus clones exhibiting contrasting virulence.

Baculovirus natural populations are known to be genetically heterogeneous and such genotypic diversity could have implications in the performance of biocontrol agents. The Anticarsia gemmatalis nucleopolyhedrovirus (AgMNPV) has been widely used to control the velvetbean caterpillar, Anticarsia gemmatalis, in Brazil. In the present work, morphological and molecular analyses as well as the biological activity of AgMNPV genotypes derived from a Brazilian field isolate (AgMNPV-79) were carried out. The existence of genotypic variants in the population was confirmed by DNA restriction analysis. Although difference in virulence was observed among the variants, the most (Ag79-01) and the least (AgL-16) virulent clones do not show any morphological and cytopathological changes when compared to the most studied isolate (AgMNPV-2D). The complete genome analysis of the two viral clones showed the presence of single open reading frames (ORFs) of the pe-38 and he65 genes, which contrasts with the two split ORFs present in the genome of the AgMNPV-2D isolate. The viral clone AgL-16 has many variations in the ie-2 and pe-38 genes, which are transcription regulatory genes responsible for the regulation of viral early gene expression during insect cell infection. Furthermore, other genes showed alterations like the odv-e56, which have an essential role in the maturation and envelopment of the ODVs, and bro-a and bro-b genes which were fused to form a single ORF. For the Ag79-01, although the total number of single nucleotide variants (SNVs) was more prominent in the pe-38 gene, its genome showed very few modifications in comparison to the AgMNPV-2D genome.

Genome-wide diversity in temporal and regional populations of the betabaculovirus Erinnyis ello granulovirus (ErelGV).

BACKGROUND: Erinnyis ello granulovirus (ErelGV) is a betabaculovirus infecting caterpillars of the sphingid moth E. ello ello (cassava hornworm), an important pest of cassava crops (Manihot esculenta). In this study, the genome of seven field isolates of the virus ErelGV were deep sequenced and their inter- and intrapopulational sequence diversity were analyzed. RESULTS: No events of gene gain/loss or translocations were observed, and indels were mainly found within highly repetitive regions (direct repeats, drs). A naturally occurring isolate from Northern Brazil (Acre State, an Amazonian region) has shown to be the most diverse population, with a unique pattern of polymorphisms. Overall, non-synonymous substitutions were found all over the seven genomes, with no specific gathering of mutations on hotspot regions. Independently of their sizes, some ORFs have shown higher levels of non-synonymous changes than others. Non-core genes of known functions and structural genes were among the most diverse ones; and as expected, core genes were the least variable genes. We observed remarkable differences on diversity of paralogous genes, as in multiple copies of p10, fgf, and pep. Another important contrast on sequence diversity was found on genes encoding complex subunits and/or involved in the same biological processes, as late expression factors (lefs) and per os infectivity factors (pifs). Interestingly, several polymorphisms in coding regions lie on sequences encoding specific protein domains. CONCLUSIONS: By comparing and integrating information about inter- and intrapopulational diversity of viral isolates, we provide a detailed description on how evolution operates on field isolates of a betabaculovirus. Our results revealed that 35-41% of the SNPs of ErelGV lead to amino acid changes (non-synonymous substitutions). Some genes, especially non-core genes of unknown functions, tend to accumulate more mutations, while core genes evolve slowly and are more conserved. Additional studies would be necessary to understand the actual effects of such gene variations on viral infection and fitness.

The complete genome of the tospovirus Zucchini lethal chlorosis virus.

BACKGROUND: Zucchini lethal chlorosis virus (ZLCV) causes significant losses in the production of cucurbits in Brazil. This virus belongs to the genus Tospovirus (family Bunyaviridae) and seems to be exclusively transmitted by Frankliniella zucchini (Thysanoptera). Tospoviruses have a tripartite and single-stranded RNA genome classified as S (Small), M (Medium) and L (Large) RNAS. Although ZLCV was identified as a member of the genus Tospovirus in 1999, its complete genome had not been sequenced until now. FINDINGS: We sequenced the full-length genome of two ZLCV isolates named ZLCV-SP and ZLCV-DF. The phylogenetic analysis showed that ZLCV-SP and ZLCV-DF clustered with the previously reported isolate ZLCV-BR09. Their proteins were closely related, except the non-structural protein (NSm), which was highly divergent (approximately 90 % identity). All viral proteins clustered similarly in our phylogenetic analysis, excluding that these ZLCV isolates have originated from reassortment events of different tospovirus species. CONCLUSION: Here we report for the first time the complete genome of two ZLCV isolates that were found in the field infecting zucchini and cucumber.

Assessment of messenger RNA (mRNA) of Mycobacterium tuberculosis as a marker of cure in patients with pulmonary tuberculosis.

AIMS: To analyse the performance of RT-qPCR using 85B mRNA in the diagnosis of Mycobacterium tuberculosis infection and in the assessment of the response to treatment for pulmonary tuberculosis (TB). METHODS AND RESULTS: Ninety-eight patients with signs of pulmonary TB were selected: 56 were considered infected with Myco. tuberculosis and they had positive cultures or evident clinical response to anti-TB treatment. Patients with pulmonary tuberculosis were evaluated by culture and RT-qPCR for a 30-day specific treatment. It was found that both tests demonstrated a decline in viable bacilli at 15 and 30 days after the beginning of the therapy in most of the patients. The quantification of the 85B mRNA target was performed in 52 patients who had initially shown positive results by RT-qPCR and who were followed on the days 15 and 30 after the specific treatment. Thus 85B mRNA was detectable in sputum samples in 52 patients with a confirmed diagnosis of pulmonary tuberculosis on day 0. During the specific treatment the 85B mRNA was detectable in 13 patients on day 15 and in only three patients on day 30. CONCLUSIONS: Mycobacterium tuberculosis mRNA in the sputum is a useful prognostic marker and its quantification, an early and reliable indicator for monitoring response to treatment, drug resistance, re-infection and relapse. SIGNIFICANCE AND IMPACT OF THE STUDY: RT-qPCR is a tool that can be used in clinical and therapeutic monitoring as an indicator of bacterial resistance and indicator of the period of transmissibility of Myco. tuberculosis in patients with pulmonary TB undergoing treatment.

The First Report of Tomato chlorotic spot virus (TCSV) Infecting Long Beans and Chili Peppers in the Dominican Republic.

The Dominican Republic has a significant area of the country cultivated with vegetables. In July 2013, in the provinces of Moca and La Vega, horticultural crops showed typical tospovirus symptoms (>30% incidence), including bronzing, chlorosis, necrosis, and ring spots on leaves and fruits. Samples were collected from potatoes (Solanum tuberosum), long beans (Vignaun guiculata), chili peppers (Capsicum frutescens), sweet peppers (C. annuum), and tomatoes (S. lycopersicum). Serological tests were clearly positive for infection by Tomato spotted wilt virus (TSWV) and/or related tospoviruses when tested with AgDia immunostrips. The viral RNA extracted from five plants per host was pooled to construct a cDNA library that was sequenced using an Illumina HiSeq 2000 platform. The paired-end reads were assembled using CLC Genomic Workbench version 6.0.3. The assembled contigs were submitted to BLASTx against a viral genome database. The results confirmed the presence of Tomato chlorotic spot virus (TCSV) and TSWV. Then, PCR tests were performed with primers pairs TSWV-LF 5' CTGTTGTCTATTGAGGATTGTG 3' AND TSWV-LR 5' CAGAGAGCTTGTTAATGCAGGAC 3' to amplify part of the TSWV L RNA, the pairs TCSV-SF 5' AACTGGGAAAGCAGAAAACC 3' and TCSV-SR 5' CCTTACTCCGAACATTGCA 3', and GRSV-SF 5' CTGTCAGGAAAATCTTGACCTG 3' and GRSV-SR 5' CTTGACTCCAAACATCTCGT 3' to detect part of the TCSV and Groundnut ringspot virus (GRSV) S segments. In the long bean and chili pepper samples from La Vega, only TCSV was detected (40% of the all samples) based on amplification of the expected size fragment with the S RNA specific primer pair. All the other samples were positive for TSWV and no GRSV was detected. The complete N gene of TCSV and TSWV were amplified using the primer pairs TCSV-NR2 5' CACACTGAACTGAACTATAACACAC 3' and TCSV-NF 5' ACCTTGAATCATATCTCTCG 3' and primers N-TSWV_FW 5' TACGGATCCGATGTCTAAGGTTAAGCTCAC 3' and N-TSWV_RV 5' TTATCTCGAGTCAAGCAAGTTCTGCGAG 3'. The TCSV N protein sequences (KJ399303 and KJ399304) were 99% identical with the TCSV found in processing tomatoes in the Dominican Republic (1) and the United States (2). The TSWV N protein sequences (KJ399313, KJ399314 and KJ399315) shared 96 to 98% identity with the TSWV N sequences available. Dot blot hybridization tests (1) using DIG-labeled specific TCSV N gene probe confirmed TCSV infection in PCR-positive long bean and chili pepper samples, whereas no hybridization signal was detected for TSWV-infected tomatoes, potatoes, sweet peppers, or healthy samples. In addition, no reassortants were detected based on amplification of the expected size RNA fragments (3). These other amplicons (KJ399301, KJ399299, KJ399302, and KJ399300) showed 98% identity with the L and M segments of TCSV. Thrips collected from symptomatic plants were identified mainly as Frankliniella schultzei, consistent with the main thrips species transmitting TCSV. In the last two years, TCSV was reported in North and Central America and in the Caribbean Basin (1,2,4). These findings have an important epidemiological impact since TCSV represents a new threat to other horticultural crops affected by this tospovirus. References: (1) O. Batuman et al. Plant Dis. 98:286, 2014. (2) A. Londono et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Virology 413:216, 2011. (4) C. G. Webster et al. Plant Health Progress. Online publication. doi:10.1094/PHP-2013-0812-01-BR, 2013.

A distinct tymovirus infecting Cassia hoffmannseggii in Brazil.

Leaves of Cassia hoffmannseggii, a wild fabaceous species found in the Atlantic Forest, with a severe mosaic symptom were collected in Pernambuco State, Brazil. By transmission electron microscopy, two types of virus particles were found: the first was recognized as particles of a potyvirus, which was later identified as Cowpea aphid-borne mosaic virus; and the second was isometric and present in high concentration. The observation of vesicles at the periphery of chloroplasts suggested a tymovirus infection, which was confirmed by subsequent assays. A serological assay against several tymovirus antisera resulted in positive reaction of this tymo-like virus with an antiserum of Passion fruit yellow mosaic virus. By means of RT-PCR and using degenerated primers for the conserved region of RNA-dependent RNA polymerase (RdRp) gene of tymoviruses, a specific DNA fragment was amplified and sequenced. Based on this sequence, a specific forward primer was synthesized and successfully used to amplify the 3' terminal genome region, containing the partial RdRp gene and the complete coat protein (CP) sequences. The CP was 188 amino acids (aa) long, and the highest CP aa identity was observed with Kennedya yellow mosaic virus (61 %). Based on the current ICTV demarcation criterion, this isolate was considered as a distinct tymovirus and tentatively named as Cassia yellow mosaic-associated virus.

The complete genome of a baculovirus isolated from an insect of medical interest: Lonomia obliqua (Lepidoptera: Saturniidae).

Lonomia obliqua (Lepidoptera: Saturniidae) is a species of medical importance due to the severity of reactions caused by accidental contact with the caterpillar bristles. Several natural pathogens have been identified in L. obliqua, and among them the baculovirus Lonomia obliqua multiple nucleopolyhedrovirus (LoobMNPV). The complete genome of LoobMNPV was sequenced and shown to have 120,022 bp long with 134 putative open reading frames (ORFs). Phylogenetic analysis of the LoobMNPV genome showed that it belongs to Alphabaculovirus group I (lepidopteran-infective NPV). A total of 12 unique ORFs were identified with no homologs in other sequenced baculovirus genomes. One of these, the predicted protein encoded by loob035, showed significant identity to an eukaryotic transcription terminator factor (TTF2) from the Lepidoptera Danaus plexippus, suggesting an independent acquisition through horizontal gene transfer. Homologs of cathepsin and chitinase genes, which are involved in host integument liquefaction and viral spread, were not found in this genome. As L. obliqua presents a gregarious behavior during the larvae stage the impact of this deletion might be neglectable.

Chlorophyllin protects HEp-2 cells from nuclear fragmentation induced by poliovirus.

AIMS: Chlorophyllin (CHLN) is a synthetic derivative of chlorophyll that possesses antimutagenic activity against several environmental contaminants. In the present study, CHLN was assayed for its capacity to prevent nuclear fragmentation (NF) in HEp-2 cells infected with poliovirus. METHODS AND RESULTS: CHLN was assayed at concentrations of 0.5 and 2.5 microg ml(-1), and NF was monitored using the comet assay and acridine orange staining. We demonstrated that CHLN reduced the percentage of NF in poliovirus-infected HEp-2 cells, when cells were treated with drug before infection or exposed continuously to drug. However, the highest degree of protection was achieved when the virus was exposed to CHLN before infection followed by protocol where infected cultures were continuously exposed to the drug after infection. CONCLUSIONS: It is suggested that CHLN primarily binds to the virus which inhibits cell penetration, thereby maintaining nuclear integrity. SIGNIFICANCE AND IMPACT OF THE STUDY: Considering that CHLN has several beneficial properties and no significant toxic effects in humans and animals, it would be an ideal candidate drug to test for antiviral activity.