Human CD4 Metastability Is a Function of the Allosteric Disulfide Bond in Domain 2.

CD4 is expressed on the surface of specific leukocytes where it plays a key role in the activation of immunostimulatory T-cells and acts as a primary receptor for HIV-1 entry. CD4 has four ecto-domains (D1-D4) of which D1, D2, and D4 contain disulfide bonds. Although disulfide bonds commonly serve structural or catalytic functions, a rare class of disulfide bonds possessing unusually high dihedral strain energy and a relative ease of reduction can impact protein function by shuffling their redox state. D2 of CD4 possesses one such "allosteric" disulfide. While it is becoming accepted that redox exchange of the D2 allosteric disulfide plays an essential role in regulating CD4 activity, the biophysical consequences of its reduction remain incompletely understood. By analyzing the hydrodynamic volume, secondary structure, and thermal stability of the reduced and nonreduced forms of the single D1 and D2 domains, as well as the various redox isomers of two domain CD4, we have shown that ablation of the allosteric disulfide bond in domain 2 results in both a favorable structural collapse and an increase in the stability of CD4. Conversely, ablating the structural disulfide of D1 results in destabilizing structural rearrangements in CD4. These findings expand our understanding of the mechanisms by which oxidoreduction of the D2 allosteric disulfide regulates CD4 function; they reveal the intrinsic disulfide-dependent metastability of D2 and illustrate that redox shuffling of the allosteric disulfide results in previously undescribed conformational changes in CD4 that are likely important for its interaction with its protein partners.

Impact of Deuteration on the Assembly Kinetics of Transthyretin Monitored by Native Mass Spectrometry and Implications for Amyloidoses.

It is well established that the formation of transthyretin (TTR) amyloid fibrils is linked to the destabilization and dissociation of its tetrameric structure into insoluble aggregates. Isotope labeling is used for the study of TTR by NMR, neutron diffraction, and mass spectrometry (MS). Here MS, thioflavin T fluorescence, and crystallographic data demonstrate that while the X-ray structures of unlabeled and deuterium-labeled TTR are essentially identical, subunit exchange kinetics and amyloid formation are accelerated for the deuterated protein. However, a slower subunit exchange is noted in deuterated solvent, reflecting the poorer solubility of non-polar protein side chains in such an environment. These observations are important for the interpretation of kinetic studies involving deuteration. The destabilizing effects of TTR deuteration are rather similar in character to those observed for aggressive mutations of TTR such as L55P (associated with familial amyloid polyneuropathy).

Intrinsic disorder within the erythrocyte binding-like proteins from Plasmodium falciparum.

The ability of the malaria parasite, Plasmodium falciparum, to proliferate within the human host depends on its invasion of erythrocytes. Erythrocyte binding-like (EBL) proteins play crucial roles in the attachment of merozoites to human erythrocytes by binding to specific receptors on the cell surface. In this study, we have carried out a bioinformatics analysis of the three EBL proteins EBA-140, EBA-175 and EBA-181 and show that they contain a large amount of intrinsic disorder in particular within the RIII-V domains. The functional role of these domains has so far not been identified, although antibodies raised against these regions were shown to inhibit parasite invasion. Here, we obtain a more complete structural and dynamic view of the EBL proteins by focusing on the biophysical characterization of a smaller construct of the RIII-V regions of EBA-181 (EBA-181945-1097). We show using a number of techniques that EBA-181945-1097 is intrinsically disordered, and we obtain a detailed structural and dynamic characterization of the protein at atomic resolution using nuclear magnetic resonance (NMR) spectroscopy. Our results show that EBA-181945-1097 is essentially a statistical coil with the presence of several turn motifs and does not possess transiently populated secondary structures as is common for many intrinsically disordered proteins that fold via specific, pre-formed molecular recognition elements.

How the ESRF helps industry and how they help the ESRF.

The ESRF has worked with, and provided services for, the pharmaceutical industry since the construction of its first protein crystallography beamline in the mid-1990s. In more recent times, industrial clients have benefited from a portfolio of beamlines which offer a wide range of functionality and beam characteristics, including tunability, microfocus and micro-aperture. Included in this portfolio is a small-angle X-ray scattering beamline dedicated to the study of biological molecules in solution. The high demands on throughput and efficiency made by the ESRF's industrial clients have been a major driving force in the evolution of the ESRF's macromolecular crystallography resources, which now include remote access, the automation of crystal screening and data collection, and a beamline database allowing sample tracking, experiment reporting and real-time at-a-distance monitoring of experiments. This paper describes the key features of the functionality put in place on the ESRF structural biology beamlines and outlines the major advantages of the interaction of the ESRF with the pharmaceutical industry.

Building a brighter future for Africa with the African Light Source.

Africa is the only habitable continent that is not yet host to a light source - an important tool across disciplines. Scientists from the Executive Committee of the African Light Source Foundation discuss work towards building an advanced light source in Africa, and what remains to be done.

The rheological and structural properties of Fmoc-peptide-based hydrogels: the effect of aromatic molecular architecture on self-assembly and physical characteristics.

Biocompatible hydrogels are of high interest as a class of biomaterials for tissue engineering, regenerative medicine, and controlled drug delivery. These materials offer three-dimensional scaffolds to support the growth of cells and development of hierarchical tissue structures. Fmoc-peptides were previously demonstrated as attractive building blocks for biocompatible hydrogels. Here, we further investigate the biophysical properties of Fmoc-peptide-based hydrogels for medical applications. We describe the structural and thermal properties of these Fmoc-peptides, as well as their self-assembly process. Additionally, we study the role of interactions between aromatic moieties in the self-assembly process and on the physical and structural properties of the hydrogels.

Neutron fibre diffraction studies of amyloid using H2O/D2O isotopic replacement.

The first neutron fibre diffraction studies of an amyloid system are presented. The techniques used to prepare the large samples needed are described, as well as the procedures used to isotopically replace H2O in the sample by D2O. The results demonstrate the feasibility of this type of approach for the pursuit of novel structural analyses that will strongly complement X-ray fibre diffraction studies and probe aspects of amyloid structure that to date have remained obscure. The approach is demonstrated using an amyloid form of the peptide NSGAITIG, but is equally applicable for the study of other systems such as Alzheimer's Aß peptide.

Preliminary neutron crystallographic study of human transthyretin.

Preliminary studies of perdeuterated crystals of human transthyretin (TTR) have been carried out using the LADI-III and D19 diffractometers at the Institut Laue-Langevin in Grenoble. The results demonstrate the feasibility of a full crystallographic analysis to a resolution of 2.0 Å using Laue diffraction and also illustrate the potential of using monochromatic instruments such as D19 for higher resolution studies where larger crystals having smaller unit cells are available. This study will yield important information on hydrogen bonding, amino-acid protonation states and hydration in the protein. Such information will be of general interest for an understanding of the factors that stabilize/destabilize TTR and for the design of ligands that may be used to counter TTR amyloid fibrillogenesis.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions.

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)(2), showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Crystallization and preliminary X-ray diffraction analysis of human cytosolic seryl-tRNA synthetase.

Human cytosolic seryl-tRNA synthetase (hsSerRS) is responsible for the covalent attachment of serine to its cognate tRNA(Ser). Significant differences between the amino-acid sequences of eukaryotic, prokaryotic and archaebacterial SerRSs indicate that the domain composition of hsSerRS differs from that of its eubacterial and archaebacterial analogues. As a consequence of an N-terminal insertion and a C-terminal extra-sequence, the binding mode of tRNA(Ser) to hsSerRS is expected to differ from that in prokaryotes. Recombinant hsSerRS protein was purified to homogeneity and crystallized. Diffraction data were collected to 3.13 Šresolution. The structure of hsSerRS has been solved by the molecular-replacement method.

Crystal structure of Spa40, the specificity switch for the Shigella flexneri type III secretion system.

The pathogenic bacterium Shigella flexneri uses a type III secretion system to inject virulence factors from the bacterial cytosol directly into host cells. The machinery that identifies secretion substrates and controls the export of extracellular components and effector proteins consists of several inner-membrane and cytoplasmic proteins. One of the inner membrane components, Spa40, belongs to a family of proteins proposed to regulate the switching of substrate specificity of the export apparatus. We show that Spa40 is cleaved within the strictly conserved amino acid sequence NPTH and substitution of the proposed autocatalytic residue abolishes cleavage. Here we also report the crystal structure of the cytoplasmic complex Spa40(C) and compare it with the recent structures of the homologues from Escherichia coli and Salmonella typhimurium. These structures reveal the tight association of the cleaved fragments and show that the conserved NPTH sequence lies on a loop which, when cleaved, swings away from the catalytic N257 residue, resulting in different surface features in this region. This structural rearrangement suggests a mechanism by which non-cleaving forms of these proteins interfere with correct substrate switching of the apparatus.

A preliminary neutron crystallographic study of an A-DNA crystal.

The LADI-III diffractometer at the Institut Laue-Langevin has been used to carry out a preliminary neutron crystallographic study of the self-complementary DNA oligonucleotide d(AGGGGCCCCT)(2) in the A conformation. The results demonstrate the viability of a full neutron crystallographic analysis with the aim of providing enhanced information on the ion-water networks that are known to be important in stabilizing A-DNA. This is the first account of a single-crystal neutron diffraction study of A-DNA. The study was carried out with the smallest crystal used to date for a neutron crystallographic study of a biological macromolecule.

Expression, purification and preliminary crystallographic analysis of Pseudomonas aeruginosa RocR protein.

Pseudomonas aeruginosa RocR, an EAL-domain protein which regulates the expression of virulence genes and biofilm formation, has been cloned and expressed in Escherichia coli and purified. Here, the crystallization and preliminary diffraction analysis of RocR are reported. The X-ray diffraction data were processed to a resolution of 2.50 A. The crystals belonged to space group P6(1)22 or P6(5)22, with unit-cell parameters a = 118.8, b = 118.8, c = 495.1 A, alpha = beta = 90, gamma = 120 degrees .

Structural basis for mannose recognition by a lectin from opportunistic bacteria Burkholderia cenocepacia.

Chronic colonization of the lungs by opportunist bacteria such as Pseudomonas aeruginosa and members of the Bcc (Burkholderia cepacia complex) is the major cause of morbidity and mortality among CF (cystic fibrosis) patients. PA-IIL (lecB gene), a soluble lectin from Ps. aeruginosa, has been the subject of much interest because of its very strong affinity for fucose. Orthologues have been identified in the opportunist bacteria Ralstonia solanacearum, Chromobacterium violaceum and Burkholderia of Bcc. The genome of the J2315 strain of B. cenocepacia, responsible for epidemia in CF centres, contains three genes that code for proteins with PA-IIL domains. The shortest gene was cloned in Escherichia coli and pure recombinant protein, BclA (B. cenocepacia lectin A), was obtained. The presence of native BclA in B. cenocepacia extracts was checked using a proteomic approach. The specificity of recombinant BclA was characterized using surface plasmon resonance showing a preference for mannosides and supported with glycan array experiments demonstrating a strict specificity for oligomannose-type N-glycan structures. The interaction thermodynamics of BclA with methyl alpha-D-mannoside demonstrates a dissociation constant (K(d)) of 2.75 x 10(-6) M. The X-ray crystal structure of the complex with methyl alpha-D-mannoside was determined at 1.7 A (1 A=0.1 nm) resolution. The lectin forms homodimers with one binding site per monomer, acting co-operatively with the second dimer site. Each monomer contains two Ca2+ ions and one sugar ligand. Despite strong sequence similarity, the differences between BclA and PA-IIL in their specificity, binding site and oligomerization mode indicate that the proteins should have different roles in the bacteria.

A molecular mechanism for transthyretin amyloidogenesis.

Human transthyretin (TTR) is implicated in several fatal forms of amyloidosis. Many mutations of TTR have been identified; most of these are pathogenic, but some offer protective effects. The molecular basis underlying the vastly different fibrillation behaviours of these TTR mutants is poorly understood. Here, on the basis of neutron crystallography, native mass spectrometry and modelling studies, we propose a mechanism whereby TTR can form amyloid fibrils via a parallel equilibrium of partially unfolded species that proceeds in favour of the amyloidogenic forms of TTR. It is suggested that unfolding events within the TTR monomer originate at the C-D loop of the protein, and that destabilising mutations in this region enhance the rate of TTR fibrillation. Furthermore, it is proposed that the binding of small molecule drugs to TTR stabilises non-amyloidogenic states of TTR in a manner similar to that occurring for the protective mutants of the protein.

Structural basis of high-affinity glycan recognition by bacterial and fungal lectins.

The structural diversity of bacterial and fungal lectins has been highlighted during the past few years. Some of the new structures reproduce folds previously observed in plants or mammals, but many constitute new folds that have never been observed before, either at all or not with a lectin function, testifying to the increasing diversity. The novelty of the new structures is greater at the level of the sugar-binding sites, with some bacterial lectins displaying unusually high affinity for oligosaccharides and even monosaccharides. Analysis of the thermodynamic contributions to the energy of binding gives clues to the strategies used by bacteria to recognise and attach to their host.

A preliminary neutron crystallographic study of thaumatin.

A preliminary neutron crystallographic study of the sweet protein thaumatin is presented. Large hydrogenated crystals were prepared in deuterated crystallization buffer using the gel-acupuncture method. Data were collected to a resolution of 2 A on the LADI-III diffractometer at the Institut Laue Langevin (ILL). The results demonstrate the feasibility of a full neutron crystallographic analysis of this structure aimed at providing relevant information on the location of H atoms, the distribution of charge on the protein surface and localized water in the structure. This information will be of interest for understanding the specificity of thaumatin-receptor interactions and will contribute to further understanding of the molecular mechanisms underlying the perception of taste.

A novel amyloid designable scaffold and potential inhibitor inspired by GAIIG of amyloid beta and the HIV-1 V3 loop.

The GAIIG sequence, common to the amyloid beta peptide (residues 29-33) and to the HIV-1 gp120 (residues 24-28 in a typical V3 loop), self-assembles into amyloid fibrils, as suggested by theory and the experiments presented here. The longer YATGAIIGNII sequence from the V3 loop also self-assembles into amyloid fibrils, of which the first three and the last two residues are outside the amyloid GAIIG core. We postulate that this sequence, with suitably selected modifications at the flexible positions, can serve as a designable scaffold for novel amyloid-based materials. Moreover, we report the single crystal X-ray structure of the beta-breaker peptide GAIPIG at 1.05 Å resolution. The structural information provided in this study could serve as the basis for structure-based design of potential inhibitors of amyloid formation.

Beta-propeller crystal structure of Psathyrella velutina lectin: an integrin-like fungal protein interacting with monosaccharides and calcium.

The lectin from the mushroom Psathyrella velutina recognises specifically N-acetylglucosamine and N-acetylneuraminic acid containing glycans. The crystal structure of the 401 amino acid residue lectin shows that it adopts a very regular seven-bladed beta-propeller fold with the N-terminal region tucked into the central cavity around the pseudo 7-fold axis. In the complex with N-acetylglucosamine, six monosaccharides are bound in pockets located between two consecutive propeller blades. Due to the repeats shown by the sequence the binding sites are very similar. Five hydrogen bonds between the protein and the sugar hydroxyl and N-acetyl groups stabilize the complex, together with the hydrophobic interactions with a conserved tyrosine and histidine. The complex with N-acetylneuraminic acid shows molecular mimicry with the same hydrogen bond network, but with different orientations of the carbohydrate ring in the binding site. The beta-hairpin loops connecting the two inner beta-strands of each blade are metal binding sites and two to three calcium ions were located in the structure. The multispecificity and high multivalency of this mushroom lectin, combined with its similarity to the extracellular domain of an important class of cell adhesion molecules, integrins, are another example of the outstanding success of beta-propeller structures as molecular binding machines in nature.

Engineering of PA-IIL lectin from Pseudomonas aeruginosa - Unravelling the role of the specificity loop for sugar preference.

BACKGROUND: Lectins are proteins of non-immune origin capable of binding saccharide structures with high specificity and affinity. Considering the high encoding capacity of oligosaccharides, this makes lectins important for adhesion and recognition. The present study is devoted to the PA-IIL lectin from Pseudomonas aeruginosa, an opportunistic human pathogen capable of causing lethal complications in cystic fibrosis patients. The lectin may play an important role in the process of virulence, recognizing specific saccharide structures and subsequently allowing the bacteria to adhere to the host cells. It displays high values of affinity towards monosaccharides, especially fucose--a feature caused by unusual binding mode, where two calcium ions participate in the interaction with saccharide. Investigating and understanding the nature of lectin-saccharide interactions holds a great potential of use in the field of drug design, namely the targeting and delivery of active compounds to the proper site of action. RESULTS: In vitro site-directed mutagenesis of the PA-IIL lectin yielded three single point mutants that were investigated both structurally (by X-ray crystallography) and functionally (by isothermal titration calorimetry). The mutated amino acids (22-23-24 triad) belong to the so-called specificity binding loop responsible for the monosaccharide specificity of the lectin. The mutation of the amino acids resulted in changes to the thermodynamic behaviour of the mutants and subsequently in their relative preference towards monosaccharides. Correlation of the measured data with X-ray structures provided the molecular basis for rationalizing the affinity changes. The mutations either prevent certain interactions to be formed or allow formation of new interactions--both of afore mentioned have strong effects on the saccharide preferences. CONCLUSION: Mutagenesis of amino acids forming the specificity binding loop allowed identification of one amino acid that is crucial for definition of the lectin sugar preference. Altering specificity loop amino acids causes changes in saccharide-binding preferences of lectins derived from PA-IIL, via creation or blocking possible binding interactions. This finding opens a gate towards protein engineering and subsequent protein design to refine the desired binding properties and preferences, an approach that could have strong potential for drug design.