First report of Grapevine enamovirus 1 in Vitis vinifera cultivar 'Meunier' in France.

Grapevine enamovirus 1 (GEV-1) is a member of the genus Enamovirus in the family Solemoviridae. GEV-1 was first described in 2017 in a few grapevine cultivars in Brazil (Silva et al. 2017) and subsequently in China (Ren et al. 2021). We first identified GEV-1 using high throughput sequencing (Illumina, NOVASeq SP, TruSeq mRNA stranded 2*150 bp) of ribosomal RNA depleted total RNAs extracts using RNeasy Plant mini kit) (Qiagen) from a Vitis vinifera 'Meunier' leaf sample collected in a more than 20 year old commercial vineyard in the Champagne region of France in 2019. Analyses of the 47,573,330 total reads were performed using CLC Genomics Workbench 12.0 software (Qiagen) as previously described (Hily et al. 2018). The GEV-1 genome, determined only from the HTS data (isolate GEV-1-Fr; GenBank accession No. MW760844), is 6 262 nucleotides (nt) long and fully covered with 5,706 reads (mapping parameters of 0,5 in length and 0,7 in similarity fractions using CLC). Compared with the previously determined sequences (NC_034836 and KX645875) from Brazil, the GEV-1-Fr sequence contain a few indels, including a deletion of 9 nt in the 5' untranslated region (UTR), an insertion of 3 nt located in the overlapping region of the open reading frame (ORF)1 and ORF2, and a single nt insertion in the non-coding region between ORF2 and ORF3. These indels also exist within the sequence of isolate SD-CG from China (MT536978). However, GEV-1-Fr contains a unique 45 nt insertion in the 3'-UTR, although this needs to be verified using standard assays. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity at the nt level with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. The GEV-1-infected 'Meunier' grapevine showed symptoms of light chlorotic patterns on the leaves that were probably due to the presence of other co-infecting viruses, including Grapevine fanleaf virus, Grapevine Pinot gris virus, Grapevine rupestris stem pitting-associated virus and Grapevine fleck virus. The detection of GEV-1 was further confirmed in the 'Meunier' grapevine via RT-PCR using newly designed primer pairs Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT and Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG that amplified a 474 bp fragment of ORF5. We also designed a TaqManTM assay in OFR5 with the following primers and probe; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG, Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC, Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was positive for GEV-1. To our knowledge, this is the first report of GEV-1 in France and in European vineyards in general. Although many aspects of the virus biology are yet to be elucidated, our results expand its geographical range. New GEV-1 detection primers can be developed, considering its genetic diversity, to facilitate its detection and further define its evolutionary history. Compared to the original sequences (NC_034836 and KX645875) in Brazil a few indels have been identified, including a deletion of 9nt located in the 5' untranslated region (UTR), an insertion of 3nt located in the overlapping region of the open reading frame (ORF)1 and ORF2 and a single nucleotide insertion in the non-coding region between ORF2 and ORF3. All indels were already described in the Chinese sequence (MT536978). However, this new GEV-1-Fr isolate is the only one that displays a 45nt insertion in the 3'-UTR. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. No specific symptoms were observed in the GEV-1-infected 'Meunier' grapevine other than light chlorotic patterns on the leaves that were probably due to the presence of other virus, as this plant was co-infected with grapevine fanleaf virus (GFLV), grapevine Pinot gris virus (GPGV), grapevine rupestris stem pitting-associated virus (GRSPaV) and grapevine fleck virus (GFkV). The detection of GEV-1 was further confirmed via RT-PCR using newly designed primer pairs located in the 'aphid transmission protein' producing a 474 nt amplicon; Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT; Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG. GEV-1 was detected in all cuttings (N=15) obtained from the original plant. We also designed a tool for a TaqManTM-based detection in the same genome region as mentioned above; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG; Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC; Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was found positive for GEV-1 in gapevine in France.

Characterization of Grapevine Fanleaf Virus Isolates in 'Chardonnay' Vines Exhibiting Severe and Mild Symptoms in Two Vineyards.

Fanleaf degeneration is a complex viral disease of Vitis spp. that detrimentally impacts fruit yield and reduces the productive lifespan of most vineyards worldwide. In France, its main causal agent is grapevine fanleaf virus (GFLV). In the past, field experiments were conducted to explore cross-protection as a management strategy of fanleaf degeneration, but results were unsatisfactory because the mild virus strain negatively impacted fruit yield. In order to select new mild GFLV isolates, we examined two old 'Chardonnay' parcels harbouring vines with distinct phenotypes. Symptoms and agronomic performances were monitored over the four-year study on 21 individual vines that were classified into three categories: asymptomatic GFLV-free vines, GFLV-infected vines severely diseased and GFLV-infected vines displaying mild symptoms. The complete coding genomic sequences of GFLV isolates in infected vines was determined by high-throughput sequencing. Most grapevines were infected with multiple genetically divergent variants. While no specific molecular features were apparent for GFLV isolates from vines displaying mild symptoms, a genetic differentiation of GFLV populations depending on the vineyard parcel was observed. The mild symptomatic grapevines identified during this study were established in a greenhouse to recover GFLV variants of potential interest for cross-protection studies.

Evidence of differential spreading events of grapevine pinot Gris virus in Italy using datamining as a tool.

Since its identification in 2003, grapevine Pinot gris virus (GPGV, Trichovirus) has now been detected in most grape-growing countries. So far, little is known about the epidemiology of this newly emerging virus. In this work, we used datamining as a tool to monitor in-silico the sanitary status of three vineyards in Italy. All data used in the study were recovered from a work that was already published and for which data were publicly available as SRA (Sequence Read Archive, NCBI) files. While incomplete, knowledge gathered from this work was still important, with evidence of differential accumulation of the virus in grapevine according to year, location, and variety-rootstock association. Additional data regarding GPGV genetic diversity were collected. Some advantages and pitfalls of datamining are discussed.