Screening for prostate cancer in a city in Japan: age-specific prostate-specific antigen cutoff thresholds.

PURPOSE: Older men have higher prostate-specific antigen levels than younger men. However, the current Japanese Urological Association guidelines recommend secondary screening at a cutoff value of 4.0 ng/mL, even in older men. Here, we reexamined the cutoffs for older men using a prostate screening cohort in Japan and first performed an analysis to determine the indication cutoffs for detecting positive biopsies. METHODS: Data from 68,566 prostate cancer screenings in the city in 2018 were combined with cancer registration data. The optimal prostate-specific antigen levels to predict prostate cancer in different age groups were calculated using receiver operating characteristic curves after determining whether a cancer was registered within one year of screening. RESULTS: At the conventional prostate-specific antigen threshold of 4.0 ng/mL, the sensitivity, specificity, and negative predictive value were 94.9%, 91.7%, and 91.7%, respectively. The optimal prostate-specific antigen cutoff values for patients aged 50-59 years, 60-69 years, 70-79 years, and over 80 years were 3.900 ng/mL, 4.014 ng/mL, 4.080 ng/mL, and 4.780 ng/mL, respectively. CONCLUSIONS: The sensitivity and specificity of prostate cancer screening in the city were high, indicating a highly accurate screening. The prostate-specific antigen threshold was 4.78 ng/mL in patients older than 80 years. A higher prostate-specific antigen threshold may be useful in men over 80 years of age to avoid excess biopsy and reduce costs. Our results suggest that the current Japanese method of using PSA 4.0 ng/mL as a cutoff regardless of age may not be preferable for older men.

Evaluation of PET/CT imaging with [89Zr]Zr-DFO-girentuximab: a phase 1 clinical study in Japanese patients with renal cell carcinoma (Zirdac-JP).

BACKGROUND: PET/CT imaging with Zirconium-89 labeled [89Zr]Zr-DFO-girentuximab, which targets tumor antigen CAIX, may aid in the differentiation and characterization of clear cell renal cell carcinomas (RCC) and other renal and extrarenal lesions, and has been studied in European and American cohorts. We report results from a phase I study that evaluated the safety profile, biodistribution, and dosimetry of [89Zr]Zr-DFO-girentuximab in Japanese patients with suspected RCC. METHODS: Eligible adult patients received 37 MBq (± 10%; 10 mg mass dose) of intravenous [89Zr]Zr-DFO-girentuximab. Safety and tolerability profile was assessed based on adverse events, concomitant medications, physical examination, vital signs, hematology, serum chemistry, urinalysis, human anti-chimeric antibody measurement, and 12-lead electrocardiograms at predefined intervals. Biodistribution and normal organ and tumor dosimetry were evaluated with PET/CT images acquired at 0.5, 4, 24, 72 h and Day 5 ± 2 d after administration. RESULTS: [89Zr]Zr-DFO-girentuximab was administered in six patients as per protocol. No treatment-emergent adverse events were reported. Dosimetry analysis showed that radioactivity was widely distributed in the body, and that the absorbed dose in healthy organs was highest in the liver (mean ± standard deviation) (1.365 ± 0.245 mGy/MBq), kidney (1.126 ± 0.190 mGy/MBq), heart wall (1.096 ± 0.232 mGy/MBq), and spleen (1.072 ± 0.466 mGy/MBq). The mean effective dose, adjusted by the radioactive dose administered, was 0.470 mSv/MBq. The radiation dose was highly accumulated in the targeted tumor, while any abnormal accumulation in other organs was not reported. CONCLUSIONS: This study demonstrates that [89Zr]Zr-DFO-girentuximab administered to Japanese patients with suspected RCC has a favorable safety profile and is well tolerated and has a similar dosimetry profile to previously studied populations.

MMP1, IL-1ß, sTNFR-1, and IL-6 are prognostic factors for patients with unresectable or metastatic renal cell carcinoma treated with immune checkpoint inhibitors.

BACKGROUND: Few studies have reported reliable prognostic factors for immune checkpoint inhibitors (ICIs) in renal cell carcinoma (RCC). Therefore, we investigated prognostic factors in patients treated with ICIs for unresectable or metastatic RCC. METHODS: We included 43 patients who received ICI treatment for RCC between January 2018 and October 2021. Blood samples were drawn before treatment, and 73 soluble factors in the plasma were analyzed using a bead-based multiplex assay. We examined factors associated with progression-free survival (PFS), overall survival (OS), and immune-related adverse events (irAE) using the Chi-squared test, Kaplan-Meier method, and the COX proportional hazards model. RESULTS: Patients exhibited a median PFS and OS of 212 and 783 days, respectively. Significant differences in both PFS and OS were observed for MMP1 (PFS, p < 0.001; OS, p = 0.003), IL-1ß (PFS, p = 0.021; OS, p = 0.008), sTNFR-1 (PFS, p = 0.017; OS, p = 0.005), and IL-6 (PFS, p = 0.004; OS, p < 0.001). Multivariate analysis revealed significant differences in PFS for MMP1 (hazard ratio [HR] 5.305, 95% confidence interval [CI], 1.648-17.082; p = 0.005) and OS for IL-6 (HR 23.876, 95% CI, 3.426-166.386; p = 0.001). Moreover, 26 patients experienced irAE, leading to ICI discontinuation or withdrawal. MMP1 was significantly associated with irAE (p = 0.039). CONCLUSION: MMP1 may be associated with severe irAE, and MMP1, IL-1ß, sTNFR-1, and IL-6 could serve as prognostic factors in unresectable or metastatic RCC treated with ICIs. MMP1 and IL-6 were independent predictors of PFS and OS, respectively. Thus, inhibiting these soluble factors may be promising for enhancing antitumor responses in patients with RCC treated with ICIs.

Combination of Blood Adiponectin and Leptin Levels Is a Predictor of Biochemical Recurrence in Prostate Cancer Invading the Surrounding Adipose Tissue.

Biochemical recurrence is a process that progresses to castration-resistant prostate cancer (CRPC) and prediction of biochemical recurrence is useful in determining early therapeutic intervention and disease treatment. Prostate cancer is surrounded by adipose tissue, which secretes adipokines, affecting cancer progression. This study aimed to investigate the correlation between blood adipokines and CRPC biochemical recurrence. We retrospectively analyzed the clinical data, including preoperative serum adipokine levels, of 99 patients with pT3a pN0 prostate cancer who underwent proctectomy between 2011 and 2019. The primary outcome was biochemical recurrence (prostate-specific antigen: PSA > 0.2). We identified 65 non-recurrences and 34 biochemical recurrences (one progressed to CRPC). The initial PSA level was significantly higher (p = 0.006), but serum adiponectin (p = 0.328) and leptin (p = 0.647) levels and their ratio (p = 0.323) were not significantly different in the biochemical recurrence group compared with the non-recurrence group. In contrast, significantly more biochemical recurrences were observed in the group with adiponectin < 6 µg/mL and Leptin < 4 ng/mL (p = 0.046), initial PSA > 15 ng/mL, clinical Gleason pattern ≥ 4, and positive resection margin. A significant difference was also observed in the multivariate analysis (hazard ratio: 4.04, 95% confidence interval: 1.21-13.5, p = 0.0232). Thus, low preoperative serum adiponectin and high leptin levels were significantly associated with biochemical recurrence in adipose tissue-invasive prostate cancer, suggesting that they may be useful predictors of biochemical recurrence. Further studies with larger cases are needed to increase the validity of this study.

Final efficacy and safety results and biomarker analysis of a phase 2 study of cabozantinib in Japanese patients with advanced renal cell carcinoma.

BACKGROUND: Cabozantinib was established as the standard of care for the treatment of patients with renal cell carcinoma (RCC) whose disease had progressed after vascular endothelial growth factor receptor tyrosine kinase inhibitor (VEGFR-TKI) therapy in the global randomized trial METEOR. A phase 2 study was conducted to bridge the findings in METEOR to Japanese patients. Here, we report a biomarker analysis and update the efficacy and safety results of cabozantinib treatment. METHODS: Japanese patients with RCC who received at least one prior VEGFR-TKI were enrolled and received cabozantinib 60 mg orally once daily. The primary endpoint was objective response rate. Secondary endpoints included progression-free survival, overall survival, and safety. Exploratory analyses included the relationship between plasma protein hepatocyte growth factor (HGF) levels and treatment responses. RESULTS: In total, 35 patients were enrolled. The median treatment duration was 58.3 (range 5.1-131.4) weeks. The objective response rate was 25.7% (90% confidence interval [CI] 14.1-40.6). Kaplan-Meier estimate of median progression-free survival was 11.1 months (95% CI 7.4-18.4). The estimated progression-free survival proportion was 73.1% (95% CI 54.6-85.0) at 6 months. Median overall survival was not reached. Adverse events were consistent with those in METEOR and the safety profile was acceptable. Nonresponders to cabozantinib showed relatively higher HGF levels than responders at baseline. CONCLUSIONS: Updated analyses demonstrate the long-term efficacy and safety of cabozantinib in Japanese patients with advanced RCC after at least one VEGFR-TKI therapy. Responders tended to show lower baseline HGF levels ClinicalTrials.gov Identifier: NCT03339219.

Real-world effectiveness of nivolumab plus ipilimumab and second-line therapy in Japanese untreated patients with metastatic renal cell carcinoma: 2-year analysis from a multicenter retrospective clinical study (J-cardinal study).

BACKGROUND: Nivolumab plus ipilimumab combination therapy is one of the standard therapies for untreated renal cell carcinoma patients with an International Metastatic Renal Cell Carcinoma Database Consortium intermediate/poor risk. We have previously reported the 1-year analysis results of the effectiveness and safety of nivolumab plus ipilimumab combination therapy in the real-world setting in Japan. Here, we report the effectiveness of nivolumab plus ipilimumab combination therapy and of second-line therapy, using 2-year analysis. METHODS: This retrospective observational study enrolled Japanese patients with previously untreated metastatic renal cell carcinoma who initiated nivolumab plus ipilimumab combination therapy between August 2018 and January 2019. Data were collected from patients' medical records at baseline and at 3 months, 1 year and 2 years after the last enrollment. RESULTS: Of the 45 patients enrolled, 10 patients (22.2%) each had non-clear cell renal cell carcinoma and Eastern Cooperative Oncology Group performance status ≥2 at baseline. Median follow-up period was 24.0 months; objective response rate was 41.5%, with 6 patients achieving complete response; median progression-free survival was 17.8 months and 24-month progression-free survival and overall survival rates were 41.6 and 59.1%, respectively. Second-line therapy achieved an objective response rate of 20%; median progression-free survival was 9.8 months. Median progression-free survival 2 was 26.4 months. CONCLUSIONS: The effectiveness of nivolumab plus ipilimumab combination therapy at 2-year analysis in the real-world setting in Japan was comparable to that reported in CheckMate 214. The current analysis also demonstrated the effectiveness of second-line therapy after nivolumab plus ipilimumab combination therapy.

Prognostic value of programmed death-ligand 1 status in Japanese patients with renal cell carcinoma.

BACKGROUND: Programmed death-ligand 1 (PD-L1) positivity is associated with poor prognosis in renal cell carcinoma (RCC). Because the prognostic impact and effect of confounding factors are less known, we investigated the prognostic significance of PD-L1 expression in Japanese patients with recurrent/metastatic RCC who started systemic therapy in 2010-2015. METHODS: This multicenter, retrospective study recruited patients from 29 Japanese study sites who had prior systemic therapy for RCC (November 2018 to April 2019) and stored formalin-fixed paraffin-embedded primary lesion samples. The primary outcome was overall survival (OS) by PD-L1 expression. Secondary outcomes included OS in subgroups and duration of first- and second-line therapies by PD-L1 expression. OS distributions were estimated using Kaplan-Meier methodology. RESULTS: PD-L1 expression (on immune cells [IC] ≥ 1%) was observed in 315/770 (40.9%) patients. PD-L1 positivity was more prevalent in patients with poor risk per both Memorial Sloan Kettering Cancer Center [MSKCC] and International Metastatic RCC Database Consortium, and high-risk pathological features (higher clinical stage, nuclear grade and sarcomatoid features). Median OS for PD-L1-positive patients was 30.9 months (95% CI 25.5-35.7) versus 37.5 months (95% CI 34.0-42.6) for PD-L1-negative patients (HR 1.04 [90% CI 0.89-1.22, p = 0.65]; stratified by MSKCC risk and liver metastases). Propensity score weight (PSW)-adjusted OS was similar between PD-L1-positive and -negative patients (median 34.4 versus 31.5 months; estimated PSW-adjusted HR 0.986). CONCLUSIONS: This study suggests PD-L1 status was not an independent prognostic factor in recurrent/metastatic RCC during the study period because PD-L1 positivity was associated with poor prognostic factors, especially MSKCC risk status.

Correlation of urinary loss rate after catheter removal and long-term urinary continence after robot-assisted laparoscopic radical prostatectomy.

OBJECTIVES: To assess the correlation of urine loss rate after catheter removal with long-term continence after robot-assisted radical prostatectomy. METHODS: We enrolled 163 patients on whom robot-assisted radical prostatectomy was carried out and whose urine loss rate we were able to evaluate after catheter removal. Urinary incontinence was evaluated from immediately after removal of the catheter to the date of discharge, and at 1, 3, 6 and 12 months after surgery. Urine loss rate was defined as the urine loss volume divided by the total urine volume. RESULTS: The continence rates of patients with ≤1% urine loss rate on the day of catheter removal were 100% at 6 and 12 months after surgery. A multivariate analysis proved that ≤10% urine loss rate on the day of catheter removal was a significant predictor of continence at 3 months after surgery. Furthermore, the continence rate at 12 months of patients who did not achieve ≤10% urine loss rate on the day of catheter removal was 79.5%. Among them, the continence rate at 12 months of patients who achieved ≥15% urine loss rate improvement from the day of catheter removal to the next day was 95.2%; the factor differed significantly between the continence and incontinence groups at 12 months after surgery. CONCLUSIONS: The urine loss rate on the day of catheter removal is significantly related to the acquisition of urinary continence. Furthermore, our findings suggest that long-term urinary continence can be expected, even in the event of poor urine loss rate on the day of catheter removal, if it improves on the next day.

[A Case of Lymphoepithelioma-Like Carcinoma of the Ureter].

Lymphoepithelioma-like carcinoma (LELC) of the ureter is very rare and only 14 previous cases have been reported. Here, we report a case of LELC of the ureter. A 76-year-old woman was admitted to our hospital complaining of gross hematuria. Left ureteral cancer was suspected by the imaging examination, and laparoscopic left total nephroureterectomy was performed. Histopathological examination showed pure type of LELC in the ureter. She is alive without disease recurrence at fifteen months after surgery.

BHD-associated kidney cancer exhibits unique molecular characteristics and a wide variety of variants in chromatin remodeling genes.

Birt-Hogg-Dubé (BHD) syndrome is a hereditary kidney cancer syndrome, which predisposes patients to develop kidney cancer, cutaneous fibrofolliculomas and pulmonary cysts. The responsible gene FLCN is a tumor suppressor for kidney cancer, which plays an important role in energy homeostasis through the regulation of mitochondrial oxidative metabolism. However, the process by which FLCN-deficiency leads to renal tumorigenesis is unclear. In order to clarify molecular pathogenesis of BHD-associated kidney cancer, we conducted whole-exome sequencing analysis using next-generation sequencing technology as well as metabolite analysis using liquid chromatography-mass spectrometry and gas chromatography-mass spectrometry. Whole-exome sequencing analysis of BHD-associated kidney cancer revealed that copy number variations of BHD-associated kidney cancer are considerably different from those already reported in sporadic cases. In somatic variant analysis, very few variants were commonly observed in BHD-associated kidney cancer; however, variants in chromatin remodeling genes were frequently observed in BHD-associated kidney cancer (17/29 tumors, 59%). Metabolite analysis of BHD-associated kidney cancer revealed metabolic reprogramming toward upregulated redox regulation which may neutralize reactive oxygen species potentially produced from mitochondria with increased respiratory capacity under FLCN-deficiency. BHD-associated kidney cancer displays unique molecular characteristics that are completely different from sporadic kidney cancer, providing mechanistic insight into tumorigenesis under FLCN-deficiency as well as a foundation for development of novel therapeutics for kidney cancer.

FLCN alteration drives metabolic reprogramming towards nucleotide synthesis and cyst formation in salivary gland.

FLCN is a tumor suppressor gene which controls energy homeostasis through regulation of a variety of metabolic pathways including mitochondrial oxidative metabolism and autophagy. Birt-Hogg-Dubé (BHD) syndrome which is driven by germline alteration of the FLCN gene, predisposes patients to develop kidney cancer, cutaneous fibrofolliculomas, pulmonary cysts and less frequently, salivary gland tumors. Here, we report metabolic roles for FLCN in the salivary gland as well as their clinical relevance. Screening of salivary glands of BHD patients using ultrasonography demonstrated increased cyst formation in the salivary gland. Salivary gland tumors that developed in BHD patients exhibited an upregulated mTOR-S6R pathway as well as increased GPNMB expression, which are characteristics of FLCN-deficient cells. Salivary gland-targeted Flcn knockout mice developed cytoplasmic clear cell formation in ductal cells with increased mitochondrial biogenesis, upregulated mTOR-S6K pathway, upregulated TFE3-GPNMB axis and upregulated lipid metabolism. Proteomic and metabolite analysis using LC/MS and GC/MS revealed that Flcn inactivation in salivary gland triggers metabolic reprogramming towards the pentose phosphate pathway which consequently upregulates nucleotide synthesis and redox regulation, further supporting that Flcn controls metabolic homeostasis in salivary gland. These data uncover important roles for FLCN in salivary gland; metabolic reprogramming under FLCN deficiency might increase nucleotide production which may feed FLCN-deficient salivary gland cells to trigger tumor initiation and progression, providing mechanistic insight into salivary gland tumorigenesis as well as a foundation for development of novel therapeutics for salivary gland tumors.

Outcomes of treatment for localized prostate cancer in a single institution: comparison of radical prostatectomy and radiation therapy by propensity score matching analysis.

OBJECTIVES: To compare the outcomes of radical prostatectomy (RP), intensity-modulated radiation therapy (IMRT), and low-dose-rate brachytherapy (BT) using propensity score matching analysis in patients with clinically localized prostate cancer. METHODS: A group of 2273 patients with clinically localized prostate cancer between January 2004 and December 2015 at the Yokohama City University hospital were identified. The records of 1817 of these patients, who were followed up for a minimum of 2 years, were reviewed; 462 were treated with RP, 319 with IMRT, and 1036 with BT. The patients were categorized according to the National Comprehensive Cancer Network risk classification criteria, and biochemical outcomes and overall survival rates were examined. Biochemical failure for RP was defined as prostate-specific antigen (PSA) levels > 0.2 ng/ml, and for IMRT and BT as nadir PSA level + 2 ng/ml. Propensity scores were calculated using multivariable logistic regression based on covariates, including the patient's age, preoperative PSA, Gleason score, number of positive cores, and clinical T stage. RESULTS: Median follow-up was 77 months for the RP, 54 months for IMRT, and 66 months for BT patients. After the propensity scores were adjusted, a total of 372 (186 each) and 598 (299 each) patients were categorized into RP vs IMRT and RP vs BT groups, respectively. Kaplan-Meier analysis did not show any statistically significant differences in terms of overall survival rate between these groups (RP vs IMRT: p = 0.220; RP vs BT: p = 0.429). IMRT was associated with improved biochemical failure-free survival compared to RP in all risk groups (high-risk: p < 0.001; intermediate-risk: p = 0.009; low-risk: p = 0.001), whereas significant differences were observed only in the intermediate-risk group (p = 0.003) within the RP vs BT group. CONCLUSION: The results of our propensity score analysis of mid-term localized prostate cancer treatment outcomes demonstrated no significant differences in the overall survival rate. Despite the difference in biochemical failure definition between surgery and radiotherapeutic approaches, the results of this study demonstrate improved biochemical control favoring IMRT and BT as compared to RP.

Cabozantinib in advanced renal cell carcinoma: A phase II, open-label, single-arm study of Japanese patients.

OBJECTIVES: To evaluate the efficacy and safety of cabozantinib, through a bridging study to METEOR, in Japanese patients with advanced renal cell carcinoma who had progressed after prior tyrosine kinase inhibitor therapy. METHODS: This phase II, open-label, single-arm study (ClinicalTrials.gov registration number: NCT03339219) included adult Japanese patients with advanced renal cell carcinoma and measurable disease who had received one or more tyrosine kinase inhibitors. Patients received cabozantinib 60 mg orally once daily while there was clinical benefit, or until unacceptable toxicity or disease progression. The primary end-point was objective response rate per Response Evaluation Criteria in Solid Tumors Version 1.1. Secondary end-points included clinical benefit rate (complete or partial response, or ≥8-week stable disease), progression-free survival, overall survival and safety. RESULTS: Of the 35 patients enrolled, 68.6%, 22.9% and 8.6% had previously received one, two and three prior tyrosine kinase inhibitors, respectively. The median duration of cabozantinib exposure was 27.0 weeks (range 5.1-43.0 weeks). The objective response rate was 20.0% (90% confidence interval 9.8-34.3%), and the clinical benefit rate was 85.7% (95% confidence interval 69.7-95.2%). The 6-month estimated progression-free survival was 72.3% (95% confidence interval 53.3-84.6%); the median progression-free survival and overall survival were not reached. All patients reported adverse events, which were manageable by supportive treatment or dose modification; two patients (5.7%) discontinued therapy due to adverse events. CONCLUSIONS: The results showed that findings from METEOR can be extrapolated, and that cabozantinib 60 mg/day is a viable treatment option in Japanese patients with advanced renal cell carcinoma who had progressed after prior tyrosine kinase inhibitor therapy.

H255Y and K508R missense mutations in tumour suppressor folliculin (FLCN) promote kidney cell proliferation.

Germline H255Y and K508R missense mutations in the folliculin (FLCN) gene have been identified in patients with bilateral multifocal (BMF) kidney tumours and clinical manifestations of Birt-Hogg-Dubé (BHD) syndrome, or with BMF kidney tumours as the only manifestation; however, their impact on FLCN function remains to be determined. In order to determine if FLCN H255Y and K508R missense mutations promote aberrant kidney cell proliferation leading to pathogenicity, we generated mouse models expressing these mutants using BAC recombineering technology and investigated their ability to rescue the multi-cystic phenotype of Flcn-deficient mouse kidneys. Flcn H255Y mutant transgene expression in kidney-targeted Flcn knockout mice did not rescue the multi-cystic kidney phenotype. However, expression of the Flcn K508R mutant transgene partially, but not completely, abrogated the phenotype. Notably, expression of the Flcn K508R mutant transgene in heterozygous Flcn knockout mice resulted in development of multi-cystic kidneys and cardiac hypertrophy in some mice. These results demonstrate that both FLCN H255Y and K508R missense mutations promote aberrant kidney cell proliferation, but to different degrees. Based on the phenotypes of our preclinical models, the FLCN H255Y mutant protein has lost it tumour suppressive function leading to the clinical manifestations of BHD, whereas the FLCN K508R mutant protein may have a dominant negative effect on the function of wild-type FLCN in regulating kidney cell proliferation and, therefore, act as an oncoprotein. These findings may provide mechanistic insight into the role of FLCN in regulating kidney cell proliferation and facilitate the development of novel therapeutics for FLCN-deficient kidney cancer.

RBM10-TFE3 renal cell carcinoma characterised by paracentric inversion with consistent closely split signals in break-apart fluorescence in-situ hybridisation: study of 10 cases and a literature review.

AIMS: Xp11 rearrangement in renal cell carcinoma (RCC) typically involves gene fusion to the gene encoding transcription factor E3 (TFE3), a member of the microphthalmia-associated transcription factor family on chromosome Xp11.2. Dual-colour break-apart fluorescence in-situ hybridisation (FISH) is recommended to confirm histological diagnoses. Recently, RNA-binding motif protein 10 (RBM10), encoded by a gene on chromosome Xp11.3, was identified as a chimeric partner of TFE3; thus, RBM10-TFE3 fusion results from paracentric inversion. RBM10-TFE3 RCC may yield a false-negative result in FISH analysis of TFE3 expression. The aim of the present study was to investigate the clinicopathological features of RBM10-TFE3 RCC. METHODS AND RESULTS: Ten patients with RBM10-TFE3 RCC aged 31-71 years were investigated. Histological analysis, immunostaining, dual-colour break-apart FISH for TFE3, reverse transcription polymerase chain reaction and sequencing analysis were performed. No patient had a history of exposure to chemotherapy. Two of these patients died of RCC, and three were alive but developed metastases. Microscopically, the tumours were composed of a mixed architecture of tubulocystic and papillary patterns with scattered psammoma bodies. The tumours showed strong nuclear immunoreactivity for TFE3. FISH showed consistent closely spaced split signals in the RCCs of four patients, and polysomic signals with occasional closely spaced split signals in the RCCs of six patients. Of the latter six patients, five had renal failure, and four developed tumours in kidneys subjected to haemodialysis. CONCLUSIONS: The present study suggests that the carcinogenesis of RBM10-TFE3 RCC in some, but not all, patients may be associated with chronic kidney disease. The aggressive nature of RBM10-TFE3 RCC should be considered, as five patients experienced metastases.

Early assessment with 18F-2-fluoro-2-deoxyglucose positron emission tomography/computed tomography to predict short-term outcome in clear cell renal carcinoma treated with nivolumab.

BACKGROUND: We reported previously the usefulness of 18F-2-fluoro-2-deoxyglucose positron emission tomography/computed tomography (FDG-PET/CT) to predict prognosis of renal cell carcinoma (RCC) treated with molecular targeted agents. Herein we describe a preliminary research of nine patients who underwent FDG-PET/CT before and after initiation of nivolumab. METHODS: Patients with metastatic RCC who were treated by nivolumab from October 2016 to March 2017 were enrolled in this study. All patients underwent FDG-PET/CT at baseline and 1 month as a first response assessment, and contrast-enhanced or non-contrast-enhanced CT scan at 4 month as a second response assessment. Logistic regression analysis was performed to assess the association of potential predictors, including age, gender, baseline diameter, baseline maximum standardized uptake value (SUVmax), lung or not lung metastasis, elevation of SUVmax at 1st assessment, and decrease in diameter at 1st assessment with the response at 2nd assessment (decrease in the diameter ≥ 30% or not). RESULTS: There were 9 patients and 30 lesions. Mean days of first assessment with FDG-PET/CT and second assessment by CT scan from initiation of treatment were 32.3 ± 6.4, 115.5 ± 14.9, respectively. Lesions whose diameter decreased ≥30% at second assessment were defined as responding, and lesions whose diameter did not decrease ≥30% were defined as non-responding. There were 18 responding lesions, and 12 non-responding lesions. We compared change in diameter and SUVmax at first assessment with FDG-PET/CT, respectively. All lesions with decreased diameter and elevated SUVmax at first assessment with FDG-PET/CT showed responding at second assessment by CT scan, while most lesions with increased diameter and declined SUVmax at first assessment showed non-responding at second assessment. The multivariate logistic regression analyses revealed that only the elevation of SUVmax at 1 month was an independent predictor (P = 0.025, OR: 13.087, 95%CI: 1.373-124.716). CONCLUSION: Our findings suggest that the early assessment using FDG-PET/CT can be effective to predict the response of RCC to nivolumab. However, larger prospective studies are needed to confirm these preliminary results. TRIAL REGISTRATION: Registered in University Hospital Medical Information Network in JAPAN [ UMIN0000008141 ], registration date: 11 Jun 2012.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle.

Significant response to nivolumab for metastatic chromophobe renal cell carcinoma with sarcomatoid differentiation: a case report.

BACKGROUND: The treatment of advanced or metastatic renal cell carcinoma (RCC) has drastically changed since the approval of immune checkpoint therapy. Nivolumab is a treatment option for patients with metastatic RCC, previously treated with targeted antiangiogenic therapy. The efficacy of nivolumab for patients with RCC was established by the Checkmate 025 clinical trial. Chromophobe RCC (CRCC) represents around 5% of RCC cases, but non-clear cell RCC (non-ccRCC) subtypes were excluded from the Checkmate 025 clinical trial. We report a case in which the use of nivolumab as the seventh-line therapy elicited a significant response in the treatment of metastatic CRCC with sarcomatoid differentiation. CASE PRESENTATION: We report a case of a 41-year-old woman with metastatic CRCC with sarcomatoid differentiation. She was treated with sunitinib, pazopanib, everolimus, sorafenib, axtinib, and temsirolimus, but treatment was discontinued because of disease progression or strong adverse events. Seventh-line treatment with nivolumab was initiated and significant clinical improvement was noted after 4 cycles. The treatment was well-tolerated with no significant side effects and the patient continues with nivolumab treatment at present. CONCLUSIONS: Nivolumab may be an attractive treatment option for non-ccRCC patients with sarcomatoid differentiation that exhibited aggressive characteristics and poor prognosis. Further investigation is warranted.

PD-1 and PD-L1 are more highly expressed in high-grade bladder cancer than in low-grade cases: PD-L1 might function as a mediator of stage progression in bladder cancer.

BACKGROUND: Bladder cancers have been characterized as a tumor group in which the immunological response is relatively well preserved. Programmed death ligand 1 (PD-L1, B7-H1, CD274) has been shown to be expressed in several malignancies, including bladder cancer. However, the clinicopathological impact of this biomarker has not yet been established. In the present study, a quantitative real-time polymerase chain reaction (qPCR) was performed using paired normal and cancerous bladder cancer tissue to investigate PD-1/PD-L1 gene expression. METHODS: We examined the mRNA expression of PD-1/PD-L1 by a qPCR using 58 pairs of normal and cancerous human bladder tissue specimens. We also examined the correlation with the expressions of the STAT1 and NFAT genes, which are thought to be upstream and downstream of the PD-L1 pathway, respectively. RESULTS: There were no significant differences between normal and cancerous tissue in the expression of the PD-1 and PD-L1 genes (p = 0.724 and p = 0.102, respectively). However, PD-1 and PD-L1 were both more highly expressed in high-grade bladder cancer than in low-grade bladder cancer (p < 0.050 and p < 0.010). PD-L1 was positively correlated with the expressions of both the STAT1 (r = 0.681, p < 0.001) and the NFATc1 genes (r = 0.444. p < 0.001). CONCLUSIONS: PD-1 and PD-L1 might be a new biomarker that correlates with the pathological grade of bladder cancer. PD-L1 might function as a mediator of stage progression in bladder cancer and STAT1-NFAT pathway might associate this function.

The acceleration of glucose accumulation in renal cell carcinoma assessed by FDG PET/CT demonstrated acquisition of resistance to tyrosine kinase inhibitor therapy.

BACKGROUND: Tyrosine-kinase inhibitor (TKI) targeting angiogenesis improves the prognosis of patients with metastatic renal cell carcinoma (RCC), but its effect is temporary. In order to understand the mechanism by which RCC acquires resistance to TKI, we investigated the change of glucose accumulation in RCC by FDG PET/CT when they demonstrated progression disease (PD) against TKI. METHODS: We monitored the FDG accumulation in RCC of 38 patients treated with TKI by 162 PET/CT sequentially until they were judged to demonstrate PD. Standardized uptake value (SUV), a simplified index of tissue FDG accumulation rate, was measured, and the sequential changes of max SUVmax (the highest SUV in an individual patient) was analyzed. Additionally, the expression of glucose transporter 1 (GLUT-1) and associated proteins in 786-O cells cultured under hypoxia were analyzed. RESULTS: The 10 patients with RCC which FDG accumulation was accelerated after beginning of TKI treatment demonstrated PD soon. The other 28 patients with RCC which FDG accumulation was suppressed by TKI showed longer progression-free survival (3.6 months vs 6.5 months, P = 0.0026), but this suppression in most cases (96%) was temporary and FDG accumulation was accelerated when tumor demonstrated PD. Interestingly, the FDG accumulation at PD was higher than that before TKI treatment in the half cases. The acceleration of FDG accumulation was suppressed by following treatment by mammalian target of rapamycin (mTOR) inhibitor. Additionally, in vitro assay demonstrated that the expression of GLUT-1 was increased in the RCC cells surviving under hypoxia condition via mTOR pathway. CONCLUSIONS: The acceleration of glucose accumulation dependent on mTOR in RCC assessed by FDG PET/CT demonstrated acquisition of resistance to TKI. FDG PET/CT had potential as an assessment method monitoring not only the initial response but also following status of RCC during TKI treatment. TRIAL REGISTRATION: UMIN0000008141 , 11 Jun 2012. This trial was retrospectively registered.