First report of barley yellow dwarf virus PAS (Luteovirus pashordei) in oat in Australia.

Luteoviruses (family Tombusviridae) and poleroviruses (family Solemoviridae) are economically important pathogens of cereals such as wheat (Triticum aestivum), barley (Hordeum vulgare) and oat (Avena sativa). In Australia, the luteoviruses barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV), along with the poleroviruses cereal yellow dwarf virus RPV (CYDV RPV) and maize yellow dwarf virus RMV (MYDV RMV), were distinguished from each other and reported in the 1980s (Sward and Lister 1988; Waterhouse and Helms 1985). The poleroviruses barley virus G (BVG) and cereal yellow dwarf virus RPS (CYDV RPS) were reported in Australia more recently (Nancarrow et al. 2019; Nancarrow et al. 2023), while the luteovirus barley yellow dwarf virus PAS (BYDV PAS) has not previously been reported in Australia. During 2010, an oat plant exhibiting yellow/ red leaf discoloration and stunted growth was collected from a roadside in Horsham, Victoria, Australia. The plant tested positive for BYDV PAV and negative for BYDV MAV, CYDV RPV and MYDV RMV by tissue blot immunoassay (TBIA) as described by Trebicki et al (2017). The virus isolate has since been continuously maintained in a glasshouse in live wheat plants using aphids (Rhopalosiphum padi). In 2021, total RNA extracted from a wheat plant infected with this isolate (Nancarrow et al. 2023) tested positive for BYDV PAV by RT-PCR using the primers BYDV-1/BYDV-2 (Rastgou et al. 2005), but negative for BYDV PAV, CYDV RPV and MYDV RMV using other published primers (Deb and Anderson 2008). A high-throughput sequencing (HTS) library was prepared from the total RNA with the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) without ribosomal RNA depletion and sequenced on a NovaSeq 6000 (Illumina). Raw reads were trimmed and filtered using fastp v0.20.0 (Chen et al. 2018) while de novo assembly of all of the resulting 5,049,052 reads was done using SPAdes v3.15.3 (Nurk et al. 2017). BLASTn analysis of the resulting 4,067 contigs (128- 12,457 bp in length) revealed only one large virus-like contig (5,649 bp) which was most similar to BYDV PAS isolates on NCBI GenBank, sharing 87% nucleotide (nt) identity with BYDV PAS isolate OH2 (MN128939), 86% nt identity with the BYDV PAS reference sequence (NC_002160) and 82% nt identity with the BYDV PAV reference sequence (NC_004750). Additionally, 4,008 HTS reads were mapped to the assembled genome sequence with Bowtie2 v2.4.5. (Langmead and Salzberg 2012) with 100% genome coverage and an average coverage depth of 101X. Primers were designed to the assembled genome sequence to generate overlapping amplicons across the genome, and the resulting amplicons were Sanger sequenced. This confirmed the genome sequence of BYDV PAS isolate PT from Australia (5649 bp, GC content 47.9%), which was deposited in GenBank (LC782749). Ten additional plant samples collected from western Victoria, Australia, all tested positive for BYDV PAS by RT-PCR using the primers PASF and PASR (Laney et al. 2018). The additional samples consisted of one oat sample collected in 2005, one barley sample collected in 2007, three wheat samples collected in 2016 and one barley, one brome grass (Bromus sp.) and three wheat samples collected in 2020. BYDV PAS is also efficiently transmitted by R. padi but is often more prevalent and severe than BYDV PAV; it can also overcome some sources of virus resistance that are effective against BYDV PAV (Chay et al. 1996, Robertson and French 2007). To our knowledge, this is the first report of BYDV PAS in Australia. Further work is needed to determine the extent of its distribution, incidence, impacts and epidemiology in Australia, along with its relationship to other BYDV PAS isolates.

First report of cereal yellow dwarf virus RPS infecting wheat in Australia.

Yellow dwarf viruses (YDVs) reduce grain yield in a wide range of cereal hosts worldwide. Cereal yellow dwarf virus RPV (CYDV RPV) and cereal yellow dwarf virus RPS (CYDV RPS) are members of the Polerovirus genus within the Solemoviridae family (Scheets et al. 2020; Sõmera et al. 2021). Along with barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV) (genus Luteovirus, family Tombusviridae), CYDV RPV is found worldwide and has mostly been identified as being present in Australia based on serological detection (Waterhouse and Helms 1985; Sward and Lister 1988). However, CYDV RPS has not previously been reported in Australia. In October 2020, a plant sample (226W) was collected from a volunteer wheat (Triticum aestivum) plant located near Douglas, Victoria, Australia that displayed yellow-reddish leaf symptoms typical of YDV infection. The sample tested positive for CYDV RPV and negative for BYDV PAV and BYDV MAV by tissue blot immunoassay (TBIA) (Trebicki et al. 2017). Given that CYDV RPV and CYDV RPS can both be detected using serological tests for CYDV RPV (Miller et al. 2002), total RNA was extracted from stored leaf tissue of plant sample 226W for further testing using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) with modified lysis buffer (Constable et al. 2007; MacKenzie et al. 1997). The sample was then tested by RT-PCR using three sets of primers that were designed to detect CYDV RPS, targeting three distinct overlapping regions (each approximately 750 bp in length) of the 5' end of the genome where CYDV RPV and CYDV RPS differ most (Miller et al. 2002). The primers CYDV RPS1L (GAGGAATCCAGATTCGCAGCTT)/ CYDV RPS1R (GCGTACCAAAAGTCCACCTCAA) targeted the P0 gene, while CYDV RPS2L (TTCGAACTGCGCGTATTGTTTG)/ CYDV RPS2R (TACTTGGGAGAGGTTAGTCCGG) and CYDV RPS3L (GGTAAGACTCTGCTTGGCGTAC)/ CYDV RPS3R (TGAGGGGAGAGTTTTCCAACCT) targeted two different regions of the RdRp gene. Sample 226W tested positive using all three sets of primers and the amplicons were directly sequenced. NCBI BLASTn and BLASTx analyses showed that the CYDV RPS1 amplicon (Accession No. OQ417707) shared 97% nucleotide (nt) identity and 98% amino acid (aa) identity similarity with the CYDV RPS isolate SW (Accession No. LC589964) from South Korea, while the CYDV RPS2 amplicon (Accession No. OQ417708) shared 96% nt identity and 98% aa identity similarity with the same CYDV RPS isolate SW. The CYDV RPS3 amplicon (Accession No. OQ417709) shared 96% nt identity and 97% aa identity similarity with the CYDV RPS isolate Olustvere1-O (Accession No. MK012664) from Estonia, confirming that isolate 226W is CYDV RPS. In addition, total RNA extracted from 13 plant samples that had previously tested positive for CYDV RPV by TBIA were tested for CYDV RPS using the primers CYDV RPS1 L/R and CYDV RPS3 L/R. The additional samples, consisting of wheat (n=8), wild oat (Avena fatua, n=3) and brome grass (Bromus sp., n=2), were collected at the same time as sample 226W from seven fields within the same region. Five of the wheat samples were collected from the same field as sample 226W, one of which tested positive for CYDV RPS while the remaining 12 samples were negative. To the best of our knowledge, this is the first report of CYDV RPS in Australia. It is not known if CYDV RPS is a recent introduction to Australia, and its incidence and distribution in cereals and grasses in Australia, while currently unknown, is being investigated.

Biology and genetic diversity of phasey bean mild yellows virus, a common virus in legumes in Australia.

This study examined the natural and experimental host range and aphid and graft transmission of the tentative polerovirus phasey bean mild yellows virus (PBMYV). Eleven complete coding sequences from PBMYV isolates were determined from a range of hosts and locations. We found two genetically distinct variants of PBMYV. PBMYV-1 was the originally described variant, and PBMYV-2 had a large putative recombination in open reading frame 5 such that PBMYV-1 and PBMYV-2 shared only 65-66% amino acid sequence identity in the P5 protein. The virus was transmitted by a clonal colony of cowpea aphids (Aphis craccivora) and by grafting with infected scions but was not transmitted by a clonal colony of green peach aphids (Myzus persicae). PBMYV was found in natural infections in 11 host species with a range of symptoms and severity, including seven important grain legume crops from across a wide geographic area in Australia. PBMYV was common and widespread in the tropical weed phasey bean (Macroptilium lathyroides), but it is likely that there are other major alternative hosts for the virus in temperate regions of Australia. The experimental host range of PBMYV included the Fabaceae hosts chickpea (Cicer arietinum), faba bean (Vicia faba), pea (Pisum sativum), and phasey bean, but transmissions failed to infect several other members of the families Asteraceae, Cucurbitaceae, Fabaceae and Solanaceae. PBMYV was commonly found in grain legume crops in eastern and western Australia, sometimes at greater than 90% incidence. This new knowledge about PBMYV warrants further assessments of its economic impact on important grain legume crops.

Genetic diversity and recombination between turnip yellows virus strains in Australia.

Disease outbreaks caused by turnip yellows virus (TuYV), a member of the genus Polerovirus, family Luteoviridae, regularly occur in canola and pulse crops throughout Australia. To understand the genetic diversity of TuYV for resistance breeding and management, genome sequences of 28 TuYV isolates from different hosts and locations were determined using high-throughput sequencing (HTS). We aimed to identify the parts of the genome that were most variable and clarify the taxonomy of viruses related to TuYV. Poleroviruses contain seven open reading frames (ORFs): ORF 0-2, 3a, and 3-5. Phylogenetic analysis based on the genome sequences, including isolates of TuYV and brassica yellows virus (BrYV) from the GenBank database, showed that most genetic variation among isolates occurred in ORF 5, followed by ORF 0 and ORF 3a. Phylogenetic analysis of ORF 5 revealed three TuYV groups; P5 group 1 and group 3 shared 45-49% amino acid sequence identity, and group 2 is a recombinant between the other two. Phylogenomic analysis of the concatenated ORFs showed that TuYV is paraphyletic with respect to BrYV, and together these taxa form a well-supported monophyletic group. Our results support the hypothesis that TuYV and BrYV belong to the same species and that the phylogenetic topologies of ORF 0, 3a and 5 are incongruent and may not be informative for species demarcation. A number of beet western yellow virus (BWYV)- and TuYV-associated RNAs (aRNA) were also identified by HTS for the first time in Australia.

Prevalence and Incidence of Yellow Dwarf Viruses Across a Climatic Gradient: A Four-Year Field Study in Southeastern Australia.

Yellow dwarf viruses (YDVs) form a complex of economically important pathogens that affect cereal production worldwide, reducing yield and quality. The prevalence and incidence of YDVs including barley yellow dwarf viruses (BYDV-PAV and BYDV-MAV) and cereal yellow dwarf virus (CYDV-RPV) in cereal fields in Victoria, Australia were measured. As temperature decreases and rainfall increases from north to south in Victoria, fields in three geographical regions were evaluated to determine potential differences in virus prevalence and incidence across the weather gradient. Cereal samples randomly collected from each field during spring for four consecutive years (2014-2017) were tested for BYDV-PAV, BYDV-MAV, and CYDV-RPV using tissue blot immunoassay. BYDV-PAV was the most prevalent YDV species overall and had the highest overall mean incidence. Higher temperature and lower rainfall were associated with reduced prevalence and incidence of YDVs as the northern region, which is hotter and drier, had a 17-fold decrease in virus incidence compared with the cooler and wetter regions. Considerable year-to-year variation in virus prevalence and incidence was observed. This study improves our understanding of virus epidemiology, which will aid the development of more targeted control measures and predictive models. It also highlights the need to monitor for YDVs and their vectors over multiple years to assess the level of risk and to make more informed and appropriate disease management decisions.

Virus disease in wheat predicted to increase with a changing climate.

Current atmospheric CO2 levels are about 400 µmol mol(-1) and are predicted to rise to 650 µmol mol(-1) later this century. Although the positive and negative impacts of CO2 on plants are well documented, little is known about interactions with pests and diseases. If disease severity increases under future environmental conditions, then it becomes imperative to understand the impacts of pathogens on crop production in order to minimize crop losses and maximize food production. Barley yellow dwarf virus (BYDV) adversely affects the yield and quality of economically important crops including wheat, barley and oats. It is transmitted by numerous aphid species and causes a serious disease of cereal crops worldwide. This study examined the effects of ambient (aCO2 ; 400 µmol mol(-1) ) and elevated CO2 (eCO2 ; 650 µmol mol(-1) ) on noninfected and BYDV-infected wheat. Using a RT-qPCR technique, we measured virus titre from aCO2 and eCO2 treatments. BYDV titre increased significantly by 36.8% in leaves of wheat grown under eCO2 conditions compared to aCO2 . Plant growth parameters including height, tiller number, leaf area and biomass were generally higher in plants exposed to higher CO2 levels but increased growth did not explain the increase in BYDV titre in these plants. High virus titre in plants has been shown to have a significant negative effect on plant yield and causes earlier and more pronounced symptom expression increasing the probability of virus spread by insects. The combination of these factors could negatively impact food production in Australia and worldwide under future climate conditions. This is the first quantitative evidence that BYDV titre increases in plants grown under elevated CO2 levels.

Diversity and composition of the bacterial communities associated with the Australian spittlebugs Bathyllus albicinctus and Philagra parva (Hemiptera: Aphrophoridae).

Spittlebugs and froghoppers (Hemiptera: Cercopoidea) are insects feeding on xylem, which potentially can cause significant economic damage worldwide by transmitting plant pathogenic bacteria such as Xylella fastidiosa. Australia and New Zealand are currently free from X. fastidiosa, but they are home to at least 45 native spittlebug species. Among these, the Australian natives Bathyllus albicinctus (Erichson, 1842) and Philagra parva (Donovan, 1805) are particularly widespread and can be found across southern and eastern Australia, with B. albicinctus also in New Zealand. The potential that both species might be capable of vectoring Xylella fastidiosa poses a substantial biosecurity risk if the bacterium were to invade these regions. In this study, we examined 87 spittlebug nymphs collected across 12 different host plant species, in five locations in Victoria, Australia. Our objective was to explore the factors influencing bacterial communities within and between these widespread spittlebug species, considering geographic location, insect phylogenetics, and host plant associations. We employed COI barcoding to assess insect genetic variation and 16S high throughput sequencing (HTS) metabarcoding to analyse bacterial microbiome diversity across various host plants. Our findings revealed minimal genetic divergence among spittlebug individuals in the same species, highlighting conspecificity despite conspicuous morphological divergences. On the other hand, we recorded significant variation in bacterial communities harboured by Bathyllus albicinctus nymphs feeding on different plants, even when these were collected within close proximity to each other. Therefore, host plant association appeared to shape the bacterial communities of spittlebugs more than insect genetic divergence or geographical location. These diverse bacterial communities could potentially facilitate transmission of plant pathogenic bacteria, underscoring the risk of widespread transmission among numerous plant hosts through insect-plant interactions. This study emphasizes the critical need to understand these complex interactions, particularly in the context of biosecurity.

Symptomless turnip yellows virus infection causes grain yield loss in lentil and field pea: A three-year field study in south-eastern Australia.

Turnip yellows virus (TuYV) is a damaging virus that is persistently transmitted by aphids and infects a wide range of grain hosts including lentil (Lens culinaris Medik), field pea (Pisum sativum L.) and canola (Brassica napus L., oilseed rape). Although information is available about the effects of TuYV infection on grain yield in canola, data about its impact on yield in pulses is lacking. In this study, field experiments quantifying the effects of TuYV infection on the grain yield of lentil and field pea were conducted over three consecutive years (2018-2020) with varying weather conditions. Plants artificially inoculated with TuYV using viruliferous green peach aphid (Myzus persicae, Sulzer) were grown under typical field conditions in south-eastern Australia. At maturity, grain yield, along with associated grain and plant growth parameters, were measured. Compared to the non-inoculated control treatment, early TuYV infection reduced grain yield by up to 36% in lentil and 45% in field pea, while late TuYV infection had no significant impact on yield. Despite a high incidence of TuYV infection and significant yield losses recorded in inoculated plots, no obvious symptoms of virus infection were observed in the inoculated plots in any of the six experiments; this lack of visible symptoms in lentil and field pea has significant implications for crop health assessments, demonstrating the importance of testing for virus instead of relying solely on the presence of visual symptoms, and may also be leading to an underestimation of the importance of TuYV in pulses in Australia.

Yield Losses Caused by Barley Yellow Dwarf Virus-PAV Infection in Wheat and Barley: A Three-Year Field Study in South-Eastern Australia.

Barley yellow dwarf virus (BYDV) is transmitted by aphids and significantly reduces the yield and quality of cereals worldwide. Four experiments investigating the effects of barley yellow dwarf virus-PAV (BYDV-PAV) infection on either wheat or barley were conducted over three years (2015, 2017, and 2018) under typical field conditions in South-Eastern Australia. Plants inoculated with BYDV-PAV using viruliferous aphids (Rhopalosiphum padi) were harvested at maturity then grain yield and yield components were measured. Compared to the non-inoculated control, virus infection severely reduced grain yield by up to 84% (1358 kg/ha) in wheat and 64% (1456 kg/ha) in barley. The yield component most affected by virus infection was grain number, which accounted for a large proportion of the yield loss. There were no significant differences between early (seedling stage) and later (early-tillering stage) infection for any of the parameters measured (plant height, biomass, yield, grain number, 1000-grain weight or grain size) for either wheat or barley. Additionally, this study provides an estimated yield loss value, or impact factor, of 0.91% (72 kg/ha) for each one percent increase in natural BYDV-PAV background infection. Yield losses varied considerably between experiments, demonstrating the important role of cultivar and environmental factors in BYDV epidemiology and highlighting the importance of conducting these experiments under varying conditions for specific cultivar-vector-virus combinations.

Updating the Quarantine Status of Prunus Infecting Viruses in Australia.

One hundred Prunus trees, including almond (P. dulcis), apricot (P. armeniaca), nectarine (P. persica var. nucipersica), peach (P. persica), plum (P. domestica), purple leaf plum (P. cerasifera) and sweet cherry (P. avium), were selected from growing regions Australia-wide and tested for the presence of 34 viruses and three viroids using species-specific reverse transcription-polymerase chain reaction (RT-PCR) or polymerase chain reaction (PCR) tests. In addition, the samples were tested using some virus family or genus-based RT-PCR tests. The following viruses were detected: Apple chlorotic leaf spot virus (ACLSV) (13/100), Apple mosaic virus (ApMV) (1/100), Cherry green ring mottle virus (CGRMV) (4/100), Cherry necrotic rusty mottle virus (CNRMV) (2/100), Cherry virus A (CVA) (14/100), Little cherry virus 2 (LChV2) (3/100), Plum bark necrosis stem pitting associated virus (PBNSPaV) (4/100), Prune dwarf virus (PDV) (3/100), Prunus necrotic ringspot virus (PNRSV) (52/100), Hop stunt viroid (HSVd) (9/100) and Peach latent mosaic viroid (PLMVd) (6/100). The results showed that PNRSV is widespread in Prunus trees in Australia. Metagenomic high-throughput sequencing (HTS) and bioinformatics analysis were used to characterise the genomes of some viruses that were detected by RT-PCR tests and Apricot latent virus (ApLV), Apricot vein clearing associated virus (AVCaV), Asian Prunus Virus 2 (APV2) and Nectarine stem pitting-associated virus (NSPaV) were also detected. This is the first report of ApLV, APV2, CGRMV, CNRNV, LChV1, LChV2, NSPaV and PBNSPaV occurring in Australia. It is also the first report of ASGV infecting Prunus species in Australia, although it is known to infect other plant species including pome fruit and citrus.

The Incidence and Genetic Diversity of Apple Mosaic Virus (ApMV) and Prune Dwarf Virus (PDV) in Prunus Species in Australia.

Apple mosaic virus (ApMV) and prune dwarf virus (PDV) are amongst the most common viruses infecting Prunus species worldwide but their incidence and genetic diversity in Australia is not known. In a survey of 127 Prunus tree samples collected from five states in Australia, ApMV and PDV occurred in 4 (3%) and 13 (10%) of the trees respectively. High-throughput sequencing (HTS) of amplicons from partial conserved regions of RNA1, RNA2, and RNA3, encoding the methyltransferase (MT), RNA-dependent RNA polymerase (RdRp), and the coat protein (CP) genes respectively, of ApMV and PDV was used to determine the genetic diversity of the Australian isolates of each virus. Phylogenetic comparison of Australian ApMV and PDV amplicon HTS variants and full length genomes of both viruses with isolates occurring in other countries identified genetic strains of each virus occurring in Australia. A single Australian Prunus infecting ApMV genetic strain was identified as all ApMV isolates sequence variants formed a single phylogenetic group in each of RNA1, RNA2, and RNA3. Two Australian PDV genetic strains were identified based on the combination of observed phylogenetic groups in each of RNA1, RNA2, and RNA3 and one Prunus tree had both strains. The accuracy of amplicon sequence variants phylogenetic analysis based on segments of each virus RNA were confirmed by phylogenetic analysis of full length genome sequences of Australian ApMV and PDV isolates and all published ApMV and PDV genomes from other countries.

Generic Amplicon Deep Sequencing to Determine Ilarvirus Species Diversity in Australian Prunus.

The distribution of Ilarvirus species populations amongst 61 Australian Prunus trees was determined by next generation sequencing (NGS) of amplicons generated using a genus-based generic RT-PCR targeting a conserved region of the Ilarvirus RNA2 component that encodes the RNA dependent RNA polymerase (RdRp) gene. Presence of Ilarvirus sequences in each positive sample was further validated by Sanger sequencing of cloned amplicons of regions of each of RNA1, RNA2 and/or RNA3 that were generated by species specific PCRs and by metagenomic NGS. Prunus necrotic ringspot virus (PNRSV) was the most frequently detected Ilarvirus, occurring in 48 of the 61 Ilarvirus-positive trees and Prune dwarf virus (PDV) and Apple mosaic virus (ApMV) were detected in three trees and one tree, respectively. American plum line pattern virus (APLPV) was detected in three trees and represents the first report of APLPV detection in Australia. Two novel and distinct groups of Ilarvirus-like RNA2 amplicon sequences were also identified in several trees by the generic amplicon NGS approach. The high read depth from the amplicon NGS of the generic PCR products allowed the detection of distinct RNA2 RdRp sequence variant populations of PNRSV, PDV, ApMV, APLPV and the two novel Ilarvirus-like sequences. Mixed infections of ilarviruses were also detected in seven Prunus trees. Sanger sequencing of specific RNA1, RNA2, and/or RNA3 genome segments of each virus and total nucleic acid metagenomics NGS confirmed the presence of PNRSV, PDV, ApMV and APLPV detected by RNA2 generic amplicon NGS. However, the two novel groups of Ilarvirus-like RNA2 amplicon sequences detected by the generic amplicon NGS could not be associated to the presence of sequence from RNA1 or RNA3 genome segments or full Ilarvirus genomes, and their origin is unclear. This work highlights the sensitivity of genus-specific amplicon NGS in detection of virus sequences and their distinct populations in multiple samples, and the need for a standardized approach to accurately determine what constitutes an active, viable virus infection after detection by molecular based methods.

Analysis of intra-host genetic diversity of Prunus necrotic ringspot virus (PNRSV) using amplicon next generation sequencing.

PCR amplicon next generation sequencing (NGS) analysis offers a broadly applicable and targeted approach to detect populations of both high- or low-frequency virus variants in one or more plant samples. In this study, amplicon NGS was used to explore the diversity of the tripartite genome virus, Prunus necrotic ringspot virus (PNRSV) from 53 PNRSV-infected trees using amplicons from conserved gene regions of each of PNRSV RNA1, RNA2 and RNA3. Sequencing of the amplicons from 53 PNRSV-infected trees revealed differing levels of polymorphism across the three different components of the PNRSV genome with a total number of 5040, 2083 and 5486 sequence variants observed for RNA1, RNA2 and RNA3 respectively. The RNA2 had the lowest diversity of sequences compared to RNA1 and RNA3, reflecting the lack of flexibility tolerated by the replicase gene that is encoded by this RNA component. Distinct PNRSV phylo-groups, consisting of closely related clusters of sequence variants, were observed in each of PNRSV RNA1, RNA2 and RNA3. Most plant samples had a single phylo-group for each RNA component. Haplotype network analysis showed that smaller clusters of PNRSV sequence variants were genetically connected to the largest sequence variant cluster within a phylo-group of each RNA component. Some plant samples had sequence variants occurring in multiple PNRSV phylo-groups in at least one of each RNA and these phylo-groups formed distinct clades that represent PNRSV genetic strains. Variants within the same phylo-group of each Prunus plant sample had ≥97% similarity and phylo-groups within a Prunus plant sample and between samples had less ≤97% similarity. Based on the analysis of diversity, a definition of a PNRSV genetic strain was proposed. The proposed definition was applied to determine the number of PNRSV genetic strains in each of the plant samples and the complexity in defining genetic strains in multipartite genome viruses was explored.

Virus incidence in wheat increases under elevated CO2: A 4-year study of yellow dwarf viruses from a free air carbon dioxide facility.

The complexities behind the mechanisms associated with virus-host-vector interactions of vector-transmitted viruses, and their consequences for disease development need to be understood to reduce virus spread and disease severity. Climate has a substantial effect on viruses, vectors, host plants and their interactions. Increased atmospheric carbon dioxide (CO2) is predicted to impact the interactions between them. This study, conducted under ambient and elevated CO2 (550µmolmol-1), in the Australian Grains Free Air Carbon Enrichment facility reports on natural yellow dwarf virus incidence on wheat (including Barley/Cereal yellow dwarf viruses (B/CYDV)). A range of wheat cultivars was tested using tissue blot immunoassay to determine the incidence of four yellow dwarf virus species from 2013 to 2016. In 2013, 2014 and 2016, virus incidence was high, reaching upwards of 50%, while in 2015 it was relatively low, with a maximum incidence of 3%. Across all years and most cultivars, BYDV-PAV was the most prevalent virus species. In the years with high virus incidence, a majority plots with the elevated levels of CO2 (eCO2) were associated with increased levels of virus relative to the plots with ambient CO2. In 2013, 2014 and 2016 the recorded mean percent virus incidence was higher under elevated CO2 when compared to ambient CO2 by 33%, 14% and 34%, respectively. The mechanism behind increased yellow dwarf virus incidence under elevated CO2 is not well understood. Potential factors involved in the higher virus incidence under elevated CO2 conditions are discussed.

The effect of elevated temperature on Barley yellow dwarf virus-PAV in wheat.

Barley yellow dwarf virus-PAV (BYDV-PAV) is associated with yellow dwarf disease, one of the most economically important diseases of cereals worldwide. In this study, the impact of current and future predicted temperatures for the Wimmera wheat growing district in Victoria, Australia on the titre of BYDV-PAV in wheat was investigated. Ten-day old wheat (Triticum aestivum, cv. Yitpi) seedlings were inoculated with BYDV-PAV and grown at ambient (5.0-16.1°C, night-day) or elevated (10.0-21.1°C, night-day) temperature treatments, simulating the current Wimmera average and future daily temperature cycles, respectively, during the wheat-growing season. Whole above-ground plant samples were collected from each temperature treatment at 0 (day of inoculation), 3, 6, 9, 12, 15, 18, 21 and 24 days after inoculation and the titre of BYDV-PAV was measured in each sample using a specific one-step multiplex normalised reverse transcription quantitative PCR (RT-qPCR) assay. Physical measurements, including plant height, dry weight and tiller number, were also taken at each sampling point. The titre of BYDV-PAV was significantly greater in plants grown in the elevated temperature treatment than in plants grown in the ambient treatment on days 6, 9 and 12. Plants grown at elevated temperature were significantly bigger and symptoms associated with BYDV-PAV were visible earlier than in plants grown at ambient temperature. These results may have important implications for the epidemiology of yellow dwarf disease under future climates in Australia.