State of art in the chemistry of nucleoside-based Pt(II) complexes.

After the fortuitous discovery of the anticancer properties of cisplatin, many Pt(II) complexes have been synthesized, to obtain less toxic leads which could overcome the resistance phenomena. Given the importance of nucleosides and nucleotides as antimetabolites, studying their coordinating properties towards Pt(II) ions is challenging for bioorganic and medicinal chemistry. This review aims to describe the results achieved so far in the aforementioned field, paying particular attention to the synthetic aspects, the chemical-physical characterization, and the biological activities of the nucleoside-based Pt(II) complexes.

ZnO Tetrapods for Label-Free Optical Biosensing: Physicochemical Characterization and Functionalization Strategies.

In this study, we fabricated three different ZnO tetrapodal nanostructures (ZnO-Ts) by a combustion process and studied their physicochemical properties by different techniques to evaluate their potentiality for label-free biosensing purposes. Then, we explored the chemical reactivity of ZnO-Ts by quantifying the available functional hydroxyl groups (-OH) on the transducer surface necessary for biosensor development. The best ZnO-T sample was chemically modified and bioconjugated with biotin as a model bioprobe by a multi-step procedure based on silanization and carbodiimide chemistry. The results demonstrated that the ZnO-Ts could be easily and efficiently biomodified, and sensing experiments based on the streptavidin target detection confirmed these structures' suitability for biosensing applications.

Development of Surface Chemical Strategies for Synthesizing Redox-Responsive Diatomite Nanoparticles as a Green Platform for On-Demand Intracellular Release of an Antisense Peptide Nucleic Acid Anticancer Agent.

Redox-responsive silica drug delivery systems are synthesized by aeco-friendly diatomite source to achieve on-demand release of peptide nucleic acid (PNA) in tumor reducing microenvironment, aiming to inhibit the immune checkpoint programmed cell death 1 receptor/programmed cell death receptor ligand 1 (PD-1/PD-L1) in cancer cells. The nanoparticles (NPs) are coated with polyethylene glycol chains as gatekeepers to improve their physicochemical properties and control drug release through the cleavable disulfide bonds (S-S) in a reductive environment. This study describes different chemical conditions to achieve the highest NPs' surface functionalization yield, exploring both multistep and one-pot chemical functionalization strategies. The best formulation is used for covalent PNA conjugation via the S-S bond reaching a loading degree of 306 ± 25 µg PNA mg-1 DNPs . These systems are used for in vitro studies to evaluate the kinetic release, biocompatibility, cellular uptake, and activity on different cancer cells expressing high levels of PD-L1. The obtained results prove the safety of the NPs up to 200 µg mL-1 and their advantage for controlling and enhancing the PNA intracellular release as well as antitumor activity. Moreover, the downregulation of PD-L1 observed only with MDA-MB-231 cancer cells paves the way for targeted immunotherapy.

Structure- and Interaction-Based Design of Anti-SARS-CoV-2 Aptamers.

Aptamer selection against novel infections is a complicated and time-consuming approach. Synergy can be achieved by using computational methods together with experimental procedures. This study aims to develop a reliable methodology for a rational aptamer in silico et vitro design. The new approach combines multiple steps: (1) Molecular design, based on screening in a DNA aptamer library and directed mutagenesis to fit the protein tertiary structure; (2) 3D molecular modeling of the target; (3) Molecular docking of an aptamer with the protein; (4) Molecular dynamics (MD) simulations of the complexes; (5) Quantum-mechanical (QM) evaluation of the interactions between aptamer and target with further analysis; (6) Experimental verification at each cycle for structure and binding affinity by using small-angle X-ray scattering, cytometry, and fluorescence polarization. By using a new iterative design procedure, structure- and interaction-based drug design (SIBDD), a highly specific aptamer to the receptor-binding domain of the SARS-CoV-2 spike protein, was developed and validated. The SIBDD approach enhances speed of the high-affinity aptamers development from scratch, using a target protein structure. The method could be used to improve existing aptamers for stronger binding. This approach brings to an advanced level the development of novel affinity probes, functional nucleic acids. It offers a blueprint for the straightforward design of targeting molecules for new pathogen agents and emerging variants.

Nucleic Acids as Biotools at the Interface between Chemistry and Nanomedicine in the COVID-19 Era.

The recent development of mRNA vaccines against the SARS-CoV-2 infection has turned the spotlight on the potential of nucleic acids as innovative prophylactic agents and as diagnostic and therapeutic tools. Until now, their use has been severely limited by their reduced half-life in the biological environment and the difficulties related to their transport to target cells. These limiting aspects can now be overcome by resorting to chemical modifications in the drug and using appropriate nanocarriers, respectively. Oligonucleotides can interact with complementary sequences of nucleic acid targets, forming stable complexes and determining their loss of function. An alternative strategy uses nucleic acid aptamers that, like the antibodies, bind to specific proteins to modulate their activity. In this review, the authors will examine the recent literature on nucleic acids-based strategies in the COVID-19 era, focusing the attention on their applications for the prophylaxis of COVID-19, but also on antisense- and aptamer-based strategies directed to the diagnosis and therapy of the coronavirus pandemic.

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin.

Trans-polydatin (tPD), the 3-ß-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins' CD spectra starting from their ".pdb" file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands' profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.

Probing the Ca2+ mobilizing properties on primary cortical neurons of a new stable cADPR mimic.

Cyclic adenosine diphosphate ribose (cADPR) is a second messenger involved in the Ca2+ homeostasis. Its chemical instability prompted researchers to tune point by point its structure, obtaining stable analogues featuring interesting biological properties. One of the most challenging derivatives is the cyclic inosine diphosphate ribose (cIDPR), in which the hypoxanthine isosterically replaces the adenine. As our research focuses on the synthesis of N1 substituted inosines, in the last few years we have produced new flexible cIDPR analogues, where the northern ribose has been replaced by alkyl chains. Interestingly, some of them mobilized Ca2+ ions in PC12 cells. To extend our SAR studies, herein we report on the synthesis of a new stable cIDPR derivative which contains the 2″S,3″R dihydroxypentyl chain instead of the northern ribose. Interestingly, the new cyclic derivative and its open precursor induced an increase in intracellular calcium concentration ([Ca2+]i) with the same efficacy of the endogenous cADPR in rat primary cortical neurons.

Nucleoside Analogs and Nucleoside Precursors as Drugs in the Fight against SARS-CoV-2 and Other Coronaviruses.

Coronaviruses (CoVs) are positive-sense RNA enveloped viruses, members of the family Coronaviridae, that cause infections in a broad range of mammals including humans. Several CoV species lead to mild upper respiratory infections typically associated with common colds. However, three human CoV (HCoV) species: Severe Acute Respiratory Syndrome (SARS)-CoV-1, Middle East Respiratory Syndrome (MERS)-CoV, and SARS-CoV-2, are responsible for severe respiratory diseases at the origin of two recent epidemics (SARS and MERS), and of the current COronaVIrus Disease 19 (COVID-19), respectively. The easily transmissible SARS-CoV-2, emerging at the end of 2019 in China, spread rapidly worldwide, leading the World Health Organization (WHO) to declare COVID-19 a pandemic. While the world waits for mass vaccination, there is an urgent need for effective drugs as short-term weapons to combat the SARS-CoV-2 infection. In this context, the drug repurposing approach is a strategy able to guarantee positive results rapidly. In this regard, it is well known that several nucleoside-mimicking analogs and nucleoside precursors may inhibit the growth of viruses providing effective therapies for several viral diseases, including HCoV infections. Therefore, this review will focus on synthetic nucleosides and nucleoside precursors active against different HCoV species, paying great attention to SARS-CoV-2. This work covers progress made in anti-CoV therapy with nucleoside derivatives and provides insight into their main mechanisms of action.

Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures.

ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.

Peptide Nucleic Acid-Functionalized Adenoviral Vectors Targeting G-Quadruplexes in the P1 Promoter of Bcl-2 Proto-Oncogene: A New Tool for Gene Modulation in Anticancer Therapy.

The B-cell lymphoma 2 (Bcl-2) gene encodes for an antiapoptotic protein associated with the onset of many human tumors. Several oligonucleotides (ONs) and ON analogues are under study as potential tools to counteract the Bcl-2 expression. Among these are Peptide Nucleic Acids (PNAs). The absence of charges on PNA backbones allows the formation of PNA/DNA complexes provided with higher stability than the corresponding natural DNA/DNA counterparts. To date, the use of PNAs in antigene or antisense strategies is strongly limited by their inability to efficiently cross the cellular membranes. With the aim of downregulating the expression of Bcl-2, we propose here a novel antigene approach which uses oncolytic adenoviral vectors (OAds) as a new cancer cell-targeted PNA delivery system. The ability of oncolytic Ad5D24 vectors to selectively infect and kill cancer cells was exploited to transfect with high efficiency and selectivity a short cytosine-rich PNA complementary to the longest loop of the main G-quadruplex formed by the 23-base-long bcl2midG4 sequence located 52-30 bp upstream of the P1 promoter of Bcl-2 gene. Physico-chemical and biological investigations confirmed the ability of the PNA-conjugated Ad5D24 vectors to load and transfect their PNA cargo into human A549 and MDA-MB-436 cancer cell lines, as well as the synergistic (OAd+PNA) cytotoxic effect against the same cell lines. This approach holds promise for safer chemotherapy because of reduced toxicity to healthy tissues and organs.

New Linear Precursors of cIDPR Derivatives as Stable Analogs of cADPR: A Potent Second Messenger with Ca2+-Modulating Activity Isolated from Sea Urchin Eggs.

Herein, we report on the synthesis of a small set of linear precursors of an inosine analogue of cyclic ADP-ribose (cADPR), a second messenger involved in Ca2+ mobilization from ryanodine receptor stores firstly isolated from sea urchin eggs extracts. The synthesized compounds were obtained starting from inosine and are characterized by an N1-alkyl chain replacing the "northern" ribose and a phosphate group attached at the end of the N1-alkyl chain and/or 5'-sugar positions. Preliminary Ca2+ mobilization assays, performed on differentiated C2C12 cells, are reported as well.

Porous Silicon-Based Aptasensors: The Next Generation of Label-Free Devices for Health Monitoring.

Aptamers are artificial nucleic acid ligands identified and obtained from combinatorial libraries of synthetic nucleic acids through the in vitro process SELEX (systematic evolution of ligands by exponential enrichment). Aptamers are able to bind an ample range of non-nucleic acid targets with great specificity and affinity. Devices based on aptamers as bio-recognition elements open up a new generation of biosensors called aptasensors. This review focuses on some recent achievements in the design of advanced label-free optical aptasensors using porous silicon (PSi) as a transducer surface for the detection of pathogenic microorganisms and diagnostic molecules with high sensitivity, reliability and low limit of detection (LoD).

New G-Quadruplex-Forming Oligodeoxynucleotides Incorporating a Bifunctional Double-Ended Linker (DEL): Effects of DEL Size and ODNs Orientation on the Topology, Stability, and Molecularity of DEL-G-Quadruplexes.

G-quadruplexes (G4s) are unusual secondary structures of DNA occurring in guanosine-rich oligodeoxynucleotide (ODN) strands that are extensively studied for their relevance to the biological processes in which they are involved. In this study, we report the synthesis of a new kind of G4-forming molecule named double-ended-linker ODN (DEL-ODN), in which two TG4T strands are attached to the two ends of symmetric, non-nucleotide linkers. Four DEL-ODNs differing for the incorporation of either a short or long linker and the directionality of the TG4T strands were synthesized, and their ability to form G4 structures and/or multimeric species was investigated by PAGE, HPLC⁻size-exclusion chromatography (HPLC⁻SEC), circular dichroism (CD), and NMR studies in comparison with the previously reported monomeric tetra-ended-linker (TEL) analogues and with the corresponding tetramolecular species (TG4T)4. The structural characterization of DEL-ODNs confirmed the formation of stable, bimolecular DEL-G4s for all DEL-ODNs, as well as of additional DEL-G4 multimers with higher molecular weights, thus suggesting a way towards the obtainment of thermally stable DNA nanostructures based on reticulated DEL-G4s.

Synthesis and Biological Evaluation of a New Structural Simplified Analogue of cADPR, a Calcium-Mobilizing Secondary Messenger Firstly Isolated from Sea Urchin Eggs.

Herein, we reported on the synthesis of cpIPP, which is a new structurally-reduced analogue of cyclic ADP-ribose (cADPR), a potent Ca2+-releasing secondary messenger that was firstly isolated from sea urchin eggs extracts. To obtain cpIPP the "northern" ribose of cADPR was replaced by a pentyl chain and the pyrophosphate moiety by a phophono-phosphate anhydride. The effect of the presence of the new phosphono-phosphate bridge on the intracellular Ca2+ release induced by cpIPP was assessed in PC12 neuronal cells in comparison with the effect of the pyrophosphate bridge of the structurally related cyclic N1-butylinosine diphosphate analogue (cbIDP), which was previously synthesized in our laboratories, and with that of the linear precursor of cpIPP, which, unexpectedly, revealed to be the only one provided with Ca2+ release properties.

Synthesis and label free characterization of a bimolecular PNA homo quadruplex.

BACKGROUND: G-quadruplex DNA is involved in many physiological and pathological processes. Both clinical and experimental studies on DNA G-quadruplexes are slowed down by their enzymatic instability. In this frame, more stable chemically modified analogs are needed. METHODS: The bis-end-linked-(gggt)2 PNA molecule (BEL-PNA) was synthesized using in solution and solid phase synthetic approaches. Quadruplex formation was assessed by circular dichroism (CD) and surface enhanced Raman scattering (SERS). RESULTS: An unprecedented bimolecular PNA homo quadruplex is here reported. To achieve this goal, we developed a bifunctional linker that once functionalized with gggt PNA strands and annealed in K+ buffer allowed the obtainment of a PNA homo quadruplex. The identification of the strong SERS band at ~1481cm-1, attributable to vibrations involving the quadruplex diagnostic Hoogsteen type hydrogen bonds, confirmed the formation of the PNA homo quadruplex. CONCLUSIONS: By tethering two G-rich PNA strands to the two ends of a suitable bifunctional linker it is possible to obtain bimolecular PNA homo quadruplexes after annealing in K+-containing buffers. The formation of such CD-unfriendly complexes can be monitored, even at low concentrations, by using the SERS technique. GENERAL SIGNIFICANCE: Given the importance of DNA G-quadruplexes in medicine and nanotechnology, the obtainment of G-quadruplex analogs provided with enhanced enzymatic stability, and their monitoring by highly sensitive label-free techniques are of the highest importance. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio.

Peptide Nucleic Acids as miRNA Target Protectors for the Treatment of Cystic Fibrosis.

Cystic Fibrosis (CF) is one of the most common life shortening conditions in Caucasians. CF is caused by mutations in the CF Transmembrane Conductance Regulator (CFTR) gene which result in reduced or altered CFTR functionality. Several microRNAs (miRNAs) downregulate the expression of CFTR, thus causing or exacerbating the symptoms of CF. In this context, the design of anti-miRNA agents represents a valid functional tool, but its translation to the clinic might lead to unpredictable side effects because of the interference with the expression of other genes regulated by the same miRNAs. Herein, for the first time, is proposed the use of peptide nucleic acids (PNAs) to protect specific sequences in the 3'UTR (untranslated region) of the CFTR messenger RNA (mRNA) by action of miRNAs. Two PNAs (7 and 13 bases long) carrying the tetrapeptide Gly-SerP-SerP-Gly at their C-end, fully complementary to the 3'UTR sequence recognized by miR-509-3p, have been synthesized and the structural features of target PNA/RNA heteroduplexes have been investigated by spectroscopic and molecular dynamics studies. The co-transfection of the pLuc-CFTR-3´UTR vector with different combinations of PNAs, miR-509-3p, and controls in A549 cells demonstrated the ability of the longer PNA to rescue the luciferase activity by up to 70% of the control, thus supporting the use of suitable PNAs to counteract the reduction in the CFTR expression.

Screening Platform toward New Anti-HIV Aptamers Set on Molecular Docking and Fluorescence Quenching Techniques.

By using a new rapid screening platform set on molecular docking simulations and fluorescence quenching techniques, three new anti-HIV aptamers targeting the viral surface glycoprotein 120 (gp120) were selected, synthesized, and assayed. The use of the short synthetic fluorescent peptide V35-Fluo mimicking the V3 loop of gp120, as the molecular target for fluorescence-quenching binding affinity studies, allowed one to measure the binding affinities of the new aptamers for the HIV-1 gp120 without the need to obtain and purify the full recombinant gp120 protein. The almost perfect correspondence between the calculated Kd and the experimental EC50 on HIV-infected cells confirmed the reliability of the platform as an alternative to the existing methods for aptamer selection and measuring of aptamer-protein equilibria.

New synthetic AICAR derivatives with enhanced AMPK and ACC activation.

5-Aminoimidazole-4-carboxamide riboside (AICAR) has an important role in the regulation of the cellular metabolism showing a broad spectrum of therapeutic activities against different metabolic processes. Due to these proven AICAR properties, we have designed, synthesized and tested the biological activity of two ribose-modified AICAR derivatives, named A3 and A4, in comparison to native AICAR and its 5'-phosphorylated counterpart ZMP. Our findings have shown that A3 and A4 derivatives induce the phosphorylation of 5'-AMP activated protein kinase α (AMPKα), which leads to the inhibition of acetyl-CoA carboxylase (ACC), and down-regulate the activity of the extracellular signal-regulated kinases (ERK1/2). Cytotoxicity tests demonstrated that A3 and A4 do not significantly reduce cell viability up to 24 h. Taken together our results indicate that A3 and A4 have a comparable activity to AICAR and ZMP at 0.5 and 1 mM suggesting their potential use in future pharmacological strategies relating to metabolic diseases.

Synthesis of cyclic N (1)-pentylinosine phosphate, a new structurally reduced cADPR analogue with calcium-mobilizing activity on PC12 cells.

Cyclic N (1)-pentylinosine monophosphate (cpIMP), a novel simplified inosine derivative of cyclic ADP-ribose (cADPR) in which the N (1)-pentyl chain and the monophosphate group replace the northern ribose and the pyrophosphate moieties, respectively, was synthesized. The role played by the position of the phosphate group in the key cyclization step, which consists in the formation of a phosphodiester bond, was thoroughly investigated. We have also examined the influence of the phosphate bridge on the ability of cpIMP to mobilize Ca(2+) in PC12 neuronal cells in comparison with the pyrophosphate bridge present in the cyclic N (1)-pentylinosine diphosphate analogue (cpIDP) previously synthesized in our laboratories. The preliminary biological tests indicated that cpIMP and cpIDP induce a rapid increase of intracellular Ca(2+) concentration in PC12 neuronal cells.

Synthesis and pharmacological evaluation of modified adenosines joined to mono-functional platinum moieties.

The synthesis of four novel platinum complexes, bearing N6-(6-amino-hexyl)adenosine or a 1,6-di(adenosin-N6-yl)-hexane respectively, as ligands of mono-functional cisplatin or monochloro(ethylendiamine)platinum(II), is reported. The chemistry exploits the high affinity of the charged platinum centres towards the N7 position of the adenosine base system and a primary amine of an alkyl chain installed on the C6 position of the purine. The cytotoxic behaviour of the synthesized complexes has been studied in A549 adenocarcinomic human alveolar basal epithelial and MCF7 human breast adenocarcinomic cancer cell lines, in order to investigate their effects on cell viability and proliferation.