Assessment of the potential for in-plume sulphur dioxide gas-ash interactions to influence the respiratory toxicity of volcanic ash.

BACKGROUND: Volcanic plumes are complex environments composed of gases and ash particles, where chemical and physical processes occur at different temperature and compositional regimes. Commonly, soluble sulphate- and chloride-bearing salts are formed on ash as gases interact with ash surfaces. Exposure to respirable volcanic ash following an eruption is potentially a significant health concern. The impact of such gas-ash interactions on ash toxicity is wholly un-investigated. Here, we study, for the first time, whether the interaction of volcanic particles with sulphur dioxide (SO2) gas, and the resulting presence of sulphate salt deposits on particle surfaces, influences toxicity to the respiratory system, using an advanced in vitro approach. METHODS: To emplace surface sulphate salts on particles, via replication of the physicochemical reactions that occur between pristine ash surfaces and volcanic gas, analogue substrates (powdered synthetic volcanic glass and natural pumice) were exposed to SO2 at 500 °C, in a novel Advanced Gas-Ash Reactor, resulting in salt-laden particles. The solubility of surface salt deposits was then assessed by leaching in water and geochemical modelling. A human multicellular lung model was exposed to aerosolised salt-laden and pristine (salt-free) particles, and incubated for 24 h. Cell cultures were subsequently assessed for biological endpoints, including cytotoxicity (lactate dehydrogenase release), oxidative stress (oxidative stress-related gene expression; heme oxygenase 1 and NAD(P)H dehydrogenase [quinone] 1) and its (pro-)inflammatory response (tumour necrosis factor α, interleukin 8 and interleukin 1ß at gene and protein levels). RESULTS: In the lung cell model no significant effects were observed between the pristine and SO2-exposed particles, indicating that the surface salt deposits, and the underlying alterations to the substrate, do not cause acute adverse effects in vitro. Based on the leachate data, the majority of the sulphate salts from the ash surfaces are likely to dissolve in the lungs prior to cellular uptake. CONCLUSIONS: The findings of this study indicate that interaction of volcanic ash with SO2 during ash generation and transport does not significantly affect the respiratory toxicity of volcanic ash in vitro. Therefore, sulphate salts are unlikely a dominant factor controlling variability in in vitro toxicity assessments observed during previous eruption response efforts.

Curcumin ameliorates oxaliplatin-induced chemoresistance in HCT116 colorectal cancer cells in vitro and in vivo.

The aims of this study were to determine potency of oxaliplatin in combination with curcumin in oxaliplatin-resistant cell lines in vitro and to evaluate the efficacy of a novel curcumin formulation (Meriva®) alone and in combination with oxaliplatin in colorectal tumor-bearing mice, exploring relevant pharmacodynamic markers in vivo. Oxaliplatin-resistant HCT116 p53wt and p53(-/-) cell lines were generated, and the effects of oxaliplatin in combination with curcumin on resistance- and proliferation-associated proteins investigated. Eighty nude mice were implanted with HCT116 p53wt colorectal cancer cells before randomization into the following treatment groups: control; Meriva only; oxaliplatin only; Meriva + oxaliplatin. Tumor volume was assessed, as was the expression of Ki-67, cleaved caspase-3 and Notch-1. Curcumin in combination with oxaliplatin was able to decrease proliferative capacity of oxaliplatin-resistant p53 wildtype and p53(-/-) cell lines more effectively than oxaliplatin alone. It also decreased markers associated with proliferation. After 21 days of treatment in the xenograft model, the order of efficacy was combination > Meriva > oxaliplatin > control. The decrease in tumor volume when compared to vehicle-treated animals was 53, 35 and 16%, respectively. Ki-67 and Notch-1 immunoreactivity was decreased by the combination when compared to vehicle-treated animals, with cleaved caspase-3 rising by 4.4-fold. Meriva did not adversely affect the DNA-platinating ability of oxaliplatin. Curcumin enhanced the cytotoxicity of oxaliplatin in models of oxaliplatin resistance in vitro. In vivo, Meriva greatly enhanced oxaliplatin efficacy, without affecting the mode of action of oxaliplatin. Addition of formulated curcumin to oxaliplatin-based chemotherapy regimens has the potential for clinical benefit.

Development of a simulated lung fluid leaching method to assess the release of potentially toxic elements from volcanic ash.

Freshly erupted volcanic ash contains a range of soluble elements, some of which can generate harmful effects in living cells and are considered potentially toxic elements (PTEs). This work investigates the leaching dynamics of ash-associated PTEs in order to optimize a method for volcanic ash respiratory hazard assessment. Using three pristine (unaffected by precipitation) ash samples, we quantify the release of PTEs (Al, Cd, Co, Cr, Cu, Fe, Mn, Ni, Pb, V, Zn) and major cations typical of ash leachates (Mg, Na, Ca, K) in multiple simulated lung fluid (SLF) preparations and under varying experimental parameters (contact time and solid to liquid ratio). Data are compared to a standard water leach (WL) to ascertain whether the WL can be used as a simple proxy for SLF leaching. The main findings are: PTE concentrations reach steady-state dissolution by 24 h, and a relatively short contact time (10 min) approximates maximum dissolution; PTE dissolution is comparatively stable at low solid to liquid ratios (1:100 to 1:1000); inclusion of commonly used macromolecules has element-specific effects, and addition of a lung surfactant has little impact on extraction efficiency. These observations indicate that a WL can be used to approximate lung bioaccessible PTEs in an eruption response situation. This is a useful step towards standardizing in vitro methods to determine the soluble-element hazard from inhaled ash.

Lilypad aggregation: localised self-assembly and metal sequestration at a liquid-vapour interface.

Spatially resolved soft materials, such as vesicles and microgels, have shown promise as selective adsorbents and microscale reaction vessels. However, spatiotemporal control of aggregation can be difficult to achieve. In this study, nickel(ii) chloride and a dipyridyl oligo(urea) ligand were combined in a vapour-diffusion setup to produce a localised spheroidal aggregate at the liquid-vapour interface. This aggregate forms via the self-assembly and fusion of monodisperse colloids and grows until its weight is no longer counterbalanced by surface tension. A simple physical model reveals that this process, termed lilypad aggregation, is possible only for surface energies that favour neither bulk aggregation nor the growth of an interfacial film. These surface energies dictate the final size and shape of the aggregate and may be estimated through visual monitoring of its changing morphology. Lilypad aggregates sequester metal from the surrounding sol and can be collected manually from the surface of the liquid.

Capture and Release Recyclable Dimethylaminomethyl-Calixarene Functional Cloths for Point-of-Use Removal of Highly Toxic Chromium Water Pollutants.

Chromium(VI) contamination of drinking water arises from industrial activity wherever there is a lack of environmental legislation enforcement regarding the removal of such pollutants. Although it is possible to remove such harmful metal ions from drinking water through large-scale facilities, there currently exists no safe and simple way to filter chromium(VI) oxoanions at the point of use (which is potentially safer and necessary in remote locations or humanitarian scenarios). High-surface-area cloth substrates have been functionalized with calixarene molecules for the selective capture of aqueous chromium(VI) oxoanions in the presence of structurally similar anions. This is accomplished by pulsed plasmachemical deposition of a linker layer and subsequent functionalization with dimethylaminomethyl-calixarene (5,11,17,23-tetrakis[(dimethylamino)methyl]-25,26,27,28-tetrahydroxycalix[4]arene). Chromium(VI) oxoanions are captured by simply passing polluted water through the functionalized cloth, while other ions not harmful/beneficial to human health remain in the water. These cloth filters are simple to use, highly selective, and easily recyclable-thus making them attractive for point-of-use application in geographic regions lacking appropriate wastewater treatment plants or flawed environmental monitoring systems. Chromium(VI) pollutants have been successfully removed from real-world contaminated industrial wastewater streams using the dimethylaminomethyl-calixarene functionalized cloths.

Tracing the natural and anthropogenic influence on the trace elemental chemistry of estuarine macroalgae and the implications for human consumption.

Macroalgae (seaweed) has been shown to be an effective environmental indicator. We investigate the trace element chemistry of macroalgae samples from locations along the Firth of Forth and Forth Estuary in Scotland. The overall trend in elemental abundance (Os ≪ Re < Ag < U < Cd < Co < Ni < Pb < Cu < As < Zn ≪ I), and changes along the estuary (seawards: increase As, I, Cd, U, Re, Os; decrease Pb, Cu; mid-estuary peak Zn; based on certain species), are controlled by a number of factors, including: salinity, mixing and macroalgal species differences. Within the same macroalgal species, some elemental abundances (As, I, Pb, Cu, Cd and U) are affected by mixing between freshwater riverine and North Sea marine saltwater. Additional mixing of natural and anthropogenic inputs from the surrounding geology and industry are also observed, affecting Zn, Ni, Co, Re and Os. Macroalgae is also an increasingly popular food, with some species harvested in the Firth of Forth. Iodine (67-5061 ppm), lead (0.047-4.1 ppm) and cadmium (0.006-0.93 ppm) macroalgal abundances are at safe levels for human consumption (WHO limits). However, many samples exceed the American (3 ppm) and Australian (1 ppm) limits for inorganic arsenic in macroalgae, with values ranging 0-67 ppm. In most of the samples, soaking and cooking the macroalgae reduced the inorganic arsenic content to within the American and Australian limits. However, this has further implications if the macroalgae is used to cook soups (e.g., Dashi), as the leached elements become a significant component of the soup.

Substituted beta-cyclodextrin and calix[4]arene as encapsulatory vehicles for platinum(II)-based DNA intercalators.

The encapsulation of three platinum(II)-based anticancer complexes, [(5,6-dimethyl-1,10-phenanthroline)(1 S,2 S-diaminocyclohexane)platinum(II)] (2+) ( 56MESS), [(5,6-dimethyl-1,10-phenanthroline)(1 R,2 R-diaminocyclohexane)platinum(II)] (2+) ( 56MERR), and [(5,6-dimethyl-1,10-phenanthroline)(ethylenediamine)platinum(II)] (2+) ( 56MEEN), with carboxylated-beta-cyclodextrin (c-beta-CD) and p-sulfonatocalix[4]arene (s-CX[4]) has been examined by one- and two-dimensional (1)H nuclear magnetic resonance (NMR) spectroscopy, pulsed gradient spin-echo NMR, ultraviolet spectrophotometry, glutathione degradation experiments, and growth inhibition assays. Titration of any of the three metal complexes with c-beta-CD resulted in 1:1 encapsulation complexes with the cyclodextrin located over the intercalating ligand of the metal complexes, with a binding constant of 10 (4)-10 (5) M (-1). In addition to binding over the phenanthroline ligand of 56MEEN, c-beta-CD was also found to portal bind to the ethylenediamine ligand, with fast exchange kinetics on the NMR timescale between the two binding sites. In contrast, the three metal complexes all formed 2:2 inclusion complexes with s-CX[4] where the two metal complexes stacked in a head-to-tail configuration and were capped by the s-CX[4] molecules. Interestingly, the 56MEEN-s-CX[4] complex appeared to undergo a thermodynamically controlled rearrangement to a less soluble complex over time. Encapsulation of the metal complexes in either c-beta-CD or s-CX[4] significantly decreased the metal complexes' rate of diffusion, consistent with the formation of larger particle volumes. Encapsulation of 56MESS within s-CX[4] or c-beta-CD protected the metal complex from degradation by reduced L-glutathione, with a reaction half-life greater than 9 days. In vitro growth inhibition assays using the LoVo human colorectal cancer cell line showed no significant change in the cytotoxicity of 56MESS when encapsulated by either s-CX[4] or c-beta-CD.

Specific adducts recognised by a monoclonal antibody against cisplatin-modified DNA.

Numerous clinical or experimental studies have employed monoclonal antibody CP9/19 for quantification of cisplatin DNA adducts. The nature of adducts recognised by CP9/19 on polymeric DNA were defined using synthetic deoxynucleotides reacted with cisplatin. Total adduct levels were determined by atomic absorption spectrometry. The nature of adducts formed were confirmed by analysis of enzymatic hydrolysates using an established ion-exchange chromatography method combined with inductively coupled plasma mass spectrometry. Of the Pt bound to oligonucleotide A (TTTTTGGTTTTTGGTTTTTGGTTTTTGGTTTTT), 77% was recovered in a product consistent with the expected 1,2 intra-strand cross-link between GG. For oligonucleotide B (TTTTTAGTTTTTAGTTTTTAGTTTTTAGTTTTT), 62% of the bound Pt was recovered in a product consistent with the 1,2 intra-strand cross-link between AG. Of Pt bound to oligothymydylic acid, 65% was recovered in a product not previously described, small quantities of which were also formed on oligonucleotides A and B. The concentrations of adducts required to cause 50% reduction of signal in a competitive enzyme-linked immunosorbant assay (ELISA) (K-values) were determined. Adducts on sequences containing no guanine or only non-adjacent guanine residues, including sequences containing adenines adjacent to guanines, exhibited low or undetectable immunoreactivities (K-values = from 1 to >100 pmoles Pt per assay well). Adducts formed on oligodeoxynucleotides containing guanine doublets interspersed amongst thymine residues were the most immunoreactive (K-values: 2-7 fmoles adduct per assay well), comparable to adducts on calf-thymus DNA. The only cisplatin-DNA adducts recognised with high sensitivity by antibody CP9/19 were those involving adjacent guanine residues but immunorecognition of these was influenced by the surrounding DNA sequence.

Therapy-induced carboplatin-DNA adduct levels in human ovarian tumours in relation to assessment of adduct measurement in mouse tissues.

Despite an increasing understanding of the molecular mechanisms by which platinum drug DNA adducts interact with cellular processes, the relationship between adduct formation in tumours and clinical response remains unclear. We have determined carboplatin-DNA adduct levels in biopsies removed from ovarian cancer patients following treatment. Reliability of DNA adduct measurements in tissues samples were assessed using experimental animals. Platinum-DNA adduct levels were measured using inductively coupled plasma mass spectrometry (ICP-MS) and plasma drug concentrations determined by atomic absorption spectrometry (AAS). Adduct levels in tissues and plasma pharmacokinetics were determined in Balb/c mice exposed to platinum drugs. Comparisons of adduct levels in tumour and normal tissue were made in nu/nu mice carrying human neuroblastoma xenografts. At 30 min post-cisplatin administration, adduct levels in DNA from kidney and liver were approximately 10- and 6-fold higher than spleen or tumour. By 60 min, levels in liver and kidney, but not spleen or tumour, had fallen considerably. Carboplatin showed high adduct levels only in kidney. Adduct levels in tumour xenografts were comparable to those induced in vitro with similar drug exposures. In clinical samples removed 6h after drug administration, adduct levels ranged from 1.9 to 4.3 and 0.2 to 3.6 nmol Pt/g DNA for tumour biopsies and peripheral blood mononuclear cells, respectively. No correlation was apparent between these two data sets. The present results demonstrate that reliable measurements of adducts in clinical tumours are feasible. Future results should provide insight into drug resistance.

Cellular and molecular mechanisms for the synergistic cytotoxicity elicited by oxaliplatin and pemetrexed in colon cancer cell lines.

PURPOSE: Oxaliplatin effect in the treatment of colorectal cancer is improved upon combination with thymidylate synthase (TS) inhibitors. Pemetrexed is polyglutamated by the folylpolyglutamate synthase (FPGS) and blocks folate metabolism and DNA synthesis by inhibiting TS, dihydrofolate reductase (DHFR) and glycinamide ribonucleotide formyltransferase (GARFT). The present study evaluates the pharmacological interaction between oxaliplatin and pemetrexed in colorectal cancer cells. METHODS: Human HT29, WiDr, SW620 and LS174T cells were treated with oxaliplatin and pemetrexed. Drug interaction was studied using the combination index method, while cell cycle was investigated with flow cytometry. The effects of drugs on Akt phosphorylation and apoptosis were studied with ELISA and fluorescence microscopy, respectively. RT-PCR analysis was performed to assess whether drugs modulated the expression of pemetrexed targets and of genes involved in DNA repair (ERCC1 and ERCC2). Finally, platinum-DNA adduct levels were detected by ultra-sensitive multi-collector inductively coupled plasma mass spectrometry (ICP-MS). RESULTS: A dose-dependent inhibition of cell growth was observed after drug exposure, while a synergistic interaction was detected preferentially with sequential combinations. Oxaliplatin enhanced cellular population in the S-phase. Drug combinations increased apoptotic indices with respect to single agents, and both drugs inhibited Akt phosphorylation. RT-PCR analysis showed a correlation between the FPGS/(TS x DHFR x GARFT) ratio and pemetrexed sensitivity, as well as a downregulation of ERCC1, ERCC2, TS, DHFR and GARFT after drug exposure. In addition, pretreatment with pemetrexed resulted in an increase of oxaliplatin-DNA adducts. CONCLUSION: These data demonstrate that oxaliplatin and pemetrexed synergistically interact against colon cancer cells, through modulation of cell cycle, inhibition of Akt phosphorylation, induction of apoptosis and modulation of gene expression.

The kinase inhibitor O6-cyclohexylmethylguanine (NU2058) potentiates the cytotoxicity of cisplatin by mechanisms that are independent of its effect upon CDK2.

O(6)-Cyclohexylmethylguanine (NU2058) was developed as an inhibitor of CDK2 and was previously shown to potentiate cisplatin cytotoxicity in vitro. The aim of this study was to investigate the mechanism of cisplatin potentiation by NU2058. SQ20b, head and neck cancer cells were treated for 2h with NU2058 (100 microM) and then for a further 2h with cisplatin and NU2058. NU2058 increased cisplatin cytotoxicity, by clonogenic assay, with a dose modification factor (DMF) of 3.1. NU2058 increased total intracellular platinum levels 1.5-fold, and platinum-DNA adduct levels twofold. Furthermore, the cisplatin-DNA adducts formed were more toxic in the presence of NU2058. To investigate whether the effects of NU2058 on cisplatin adduct levels and toxicity were dependent on CDK2 activity, additional CDK2 inhibitors were tested. NU6230 (CDK2 IC(50) 18 microM) was equipotent to NU2058 (CDK2 IC(50) 17 microM) as a CDK2 inhibitor in cell-free and cell-based assays, yet did not potentiate cisplatin cytotoxicity. Furthermore, NU6102 was >1000-fold more potent than NU2058 as a CDK2 inhibitor (CDK2 IC(50) 5 nM) yet was no more active than NU2058 in potentiating cisplatin. NU2058 also potentiated melphalan (DMF 2.3), and monohydroxymelphalan (1.7), but not temozolomide or ionising radiation. Whilst NU2058 increased melphalan cytotoxicity, it did not increase melphalan-DNA adduct formation. These studies demonstrate that NU2058 alters the transport of cisplatin, causing more Pt-DNA adducts, as well as sensitizing cells to cisplatin- and melphalan-induced DNA damage. However, the effects of NU2058 are independent of CDK2 inhibition.

Expression of kinase-defective mutants of c-Src in human metastatic colon cancer cells decreases Bcl-xL and increases oxaliplatin- and Fas-induced apoptosis.

Tumor resistance to current drugs prevents curative treatment of human colon cancer. A pressing need for effective, tumor-specific chemotherapies exists. The non-receptor-tyrosine kinase c-Src is overexpressed in >70% of human colon cancers and represents a tractable drug target. KM12L4A human metastatic colon cancer cells were stably transfected with two distinct kinase-defective mutants of c-src. Their response to oxaliplatin, to SN38, the active metabolite of irinotecan (drugs active in colon cancer), and to activation of the death receptor Fas was compared with vector control cells in terms of cell cycle arrest and apoptosis. Both kinase-defective forms of c-Src co-sensitized cells to apoptosis induced by oxaliplatin and Fas activation but not by SN38. Cells harboring kinase-defective forms of c-Src carrying function blocking point mutations in SH3 or SH2 domains were similarly sensitive to oxaliplatin, suggesting that reduction in kinase activity and not a Src SH2-SH3 scaffold function was responsible for the observed altered sensitivity. Oxaliplatin-induced apoptosis, potentiated by kinase-defective c-Src mutants, was dependent on activation of caspase 8 and associated with Bid cleavage. Each of the stable cell lines in which kinase-defective mutants of c-Src were expressed had reduced levels of Bcl-x(L.) However, inhibition of c-Src kinase activity by PP2 in vector control cells did not alter the oxaliplatin response over 72 h nor did it reduce Bcl-x(L) levels. The data suggest that longer term suppression of Src kinase activity may be required to lower Bcl-x(L) levels and sensitize colon cancer cells to oxaliplatin-induced apoptosis.