A comprehensive regulatory and industry review of modeling and simulation practices in oncology clinical drug development.

Exposure-response (E-R) analyses are an integral component in the development of oncology products. Characterizing the relationship between drug exposure metrics and response allows the sponsor to use modeling and simulation to address both internal and external drug development questions (e.g., optimal dose, frequency of administration, dose adjustments for special populations). This white paper is the output of an industry-government collaboration among scientists with broad experience in E-R modeling as part of regulatory submissions. The goal of this white paper is to provide guidance on what the preferred methods for E-R analysis in oncology clinical drug development are and what metrics of exposure should be considered.

First report of Grapevine asteroid mosaic associated virus in grapevine in Spain.

Grapevine asteroid mosaic associated virus (GAMaV) is a member of the genus Marafivirus, family Tymoviridae. GAMaV was initially found to infect grapevine (Vitis vinifera) in California and was also reported in Japan, Canada, Uruguay, France, Hungary and Italy (Nakaune et al. 2008; Vargas-Asencio et al. 2017; Candresse et al. 2017; Porceddu et al. 2018). In July 2019 a grapevine sample from cv. Tempranillo (TS1), collected in a random survey from a vineyard in a Spanish grapevine growing area (D.O. Utiel-Requena), showing chlorotic mottling and leaf deformations, was analyzed by high throughput sequencing (HTS). Total RNA extracted from leaves was sequenced after ribo-depletion (Ribo-Zero Plant kit, Illumina) using TrueSeq Illumina technology (150 nt pair-end reads). Data analysis was performed by CLC Genomics Workbench 10.1.1. After quality control and host genome subtraction 2,410,654 reads were used for de novo assembly. BLAST analysis of the 13,303 contigs obtained revealed the presence of four contigs (2736, 1448, 1285 and 954 nt in size) related to GAMaV, indicating the presence of this virus in TS1 sample. Contigs related to other viruses/viroids were also found, in particular Grapevine rupestris stem pitting-associated virus, Grapevine leafroll-associated virus 3, Grapevine virus A, Grapevine fleck virus, Grapevine red globe virus, Grapevine rupestris vein feathering virus and Hop stunt viroid. For the assembly of the full-length GAMaV genome, contigs were extended by mapping the reads against the contigs using Geneious Prime 2020 software. This mapping step allowed the recovery of the GAMaV genomic sequence (635 reads, average coverage per nucleotide 10.0) with the exception of a small gap of 147 nt in the helicase region of the polyprotein. The gap in the genomic region was covered by RT-PCR using two newly designed primers overlapping the flanking regions (GAMaV-3755-F, 5'ATCCTCACCAACTCCC3' and GAMaV-3985-R, 5'GTTGGAAGTGGTGTG3'). Nearly complete sequence of the isolate TS1 (6,692 nt, MT459830) showed 87.7% nucleotide identity with the isolate 16GVP031 (MK253012) from France. The phylogenetic analysis performed on the available GAMaV full-length genomes showed that the Spanish isolate was positioned in a distinct clade (Supp. Fig. 1). The presence of GAMaV in Spain was further evaluated by reverse transcription-polymerase chain reaction (RT-PCR). Specific GAMaV primers, GAMaV-F3 and GAMaV-R3 previously reported by Candresse et al. (2017) were used without any success, due to primer mismatching. Based on TS1 sequence, two primers (GAMaV-6010F, 5'CCCTCCTCCTAGCGACGACC3' and GAMaV-6426R, 5'GGGTTGAGACGGCGGAGATC3') were designed and used to amplify a fragment of 417 nt in the CP region. Sanger sequencing of the obtained RT-PCR product confirmed the HTS recovered sequence. A total of 52 randomly collected samples from the same grapevine growing area were analyzed by RT-PCR using the newly designed primers. One sample bearing similar symptoms, TS7 (MT770919, cv. Tempranillo), and eight symptomless samples, MS1, MS2 and MS3 (MT770911, MT770917 and MT770918, cv. Macabeo), and TS2, TS3, TS4, TS5 and TS6 (MT770912, MT770913, MT770914, MT770915 and MT770916, cv. Tempranillo), tested positive for GAMaV, thus confirming its presence in Spanish vineyards. The nucleotide identity between these partial sequences and the homologous region of TS1 ranged from 94.7% to 98.8%, 0.04 being the mean diversity among isolates at the CP genomic region estimated by MEGA X software. To our knowledge, this is the first report of GAMaV in grapevine in Spain. The presence of other viruses/viroids in TS1 sample and the finding of asymptomatic GAMaV infected plants make difficult to associate this virus to the observed symptomatology. Other latent or semilatent GAMaV infections have been previously reported (Martelli 2014; Candresse et al. 2017).

Virus Detection by High-Throughput Sequencing of Small RNAs: Large-Scale Performance Testing of Sequence Analysis Strategies.

Recent developments in high-throughput sequencing (HTS), also called next-generation sequencing (NGS), technologies and bioinformatics have drastically changed research on viral pathogens and spurred growing interest in the field of virus diagnostics. However, the reliability of HTS-based virus detection protocols must be evaluated before adopting them for diagnostics. Many different bioinformatics algorithms aimed at detecting viruses in HTS data have been reported but little attention has been paid thus far to their sensitivity and reliability for diagnostic purposes. Therefore, we compared the ability of 21 plant virology laboratories, each employing a different bioinformatics pipeline, to detect 12 plant viruses through a double-blind large-scale performance test using 10 datasets of 21- to 24-nucleotide small RNA (sRNA) sequences from three different infected plants. The sensitivity of virus detection ranged between 35 and 100% among participants, with a marked negative effect when sequence depth decreased. The false-positive detection rate was very low and mainly related to the identification of host genome-integrated viral sequences or misinterpretation of the results. Reproducibility was high (91.6%). This work revealed the key influence of bioinformatics strategies for the sensitive detection of viruses in HTS sRNA datasets and, more specifically (i) the difficulty in detecting viral agents when they are novel or their sRNA abundance is low, (ii) the influence of key parameters at both assembly and annotation steps, (iii) the importance of completeness of reference sequence databases, and (iv) the significant level of scientific expertise needed when interpreting pipeline results. Overall, this work underlines key parameters and proposes recommendations for reliable sRNA-based detection of known and unknown viruses.

Population pharmacokinetics of inotuzumab ozogamicin in relapsed/refractory acute lymphoblastic leukemia and non-Hodgkin lymphoma.

This population pharmacokinetics analysis evaluated the target-mediated drug disposition of inotuzumab ozogamicin (InO) through an empirical time-dependent clearance (CLt) term and identified potential covariates that may be important predictors of variability in InO distribution and elimination. This analysis was conducted by pooling data from 2 studies of single-agent InO in patients with relapsed or refractory (R/R) B cell acute lymphoblastic leukemia (ALL), 3 studies of single-agent InO, 5 studies of InO plus rituximab (R-InO), and 1 study of R-InO plus chemotherapy in patients with R/R B-cell non-Hodgkin lymphoma (NHL). Pharmacokinetic data included 8361 InO concentration-time observations that were modeled using nonlinear mixed-effects analysis. Covariate relations were identified using generalized additive modeling on base model parameters and then tested in a stepwise manner via covariate modeling. InO concentration was described with a 2-compartment model with linear and time-dependent clearance components. Based on the final model, baseline body surface area was a covariate of the linear and time-dependent clearance components and volume of distribution in the central compartment; baseline percentage of blasts in the peripheral blood was a covariate of the decay coefficient of the time-dependent clearance term (CLt); and concomitant rituximab treatment was a covariate of the linear clearance component (CL1). The magnitude of change of each pharmacokinetic parameter due to these covariates was not considered clinically relevant. Therefore, no dose adjustment of InO for the treatment of patients with R/R B-cell ALL or NHL is needed on the basis of selected covariates.

Palbociclib has no clinically relevant effect on the QTc interval in patients with advanced breast cancer.

The aim of this study was to assess the potential effects of palbociclib in combination with letrozole on QTc. PALOMA-2, a phase 3, randomized, double-blind, placebo-controlled trial, compared palbociclib plus letrozole with placebo plus letrozole in postmenopausal women with estrogen receptor-positive, human epidermal growth factor receptor 2-negative advanced breast cancer. The study included a QTc evaluation substudy carried out as a definitive QT interval prolongation assessment for palbociclib. Time-matched triplicate ECGs were performed at 0, 2, 4, 6, and 8 h at baseline (Day 0) and on Cycle 1 Day 14. Additional ECGs were collected from all patients for safety monitoring. The QT interval was corrected for heart rate using Fridericia's correction (QTcF), Bazett's correction (QTcB), and a study-specific correction factor (QTcS). In total, 666 patients were randomized 2 : 1 to palbociclib plus letrozole or placebo plus letrozole. Of these, 125 patients were enrolled in the QTc evaluation substudy. No patients in the palbociclib plus letrozole arm of the substudy (N=77) had a maximum postbaseline QTcS or QTcF value of ≥ 480 ms, or a maximum increase from clock time-matched baseline for QTcS or QTcF values of ≥ 60 ms. The upper bounds of the one-sided 95% confidence interval for the mean change from time-matched baseline for QTcS, QTcF, and QTcB at all time points and at steady-state Cmax following repeated administration of 125 mg palbociclib were less than 10 ms. Palbociclib, when administered with letrozole at the recommended therapeutic dosing regimen, did not prolong the QT interval to a clinically relevant extent.

Grapevine virus T is relatively widespread in Slovakia and Czech Republic and genetically diverse.

A recently described putative foveavirus, grapevine virus T (GVT), was detected in a Slovak grapevine accession (SK704) using high-throughput sequencing, prompting further studies. Full-length genome sequence of isolate GVT-SK704 was determined. Analyses revealed 86.1% nucleotide identity with the Italian GVT isolate, currently the only available nearly complete sequence of GVT in GenBank. A virus-specific RT-PCR assay was developed, which enabled a survey of GVT incidence in grapevine samples from Slovakia and Czech Republic. Unexpectedly, GVT was present in ~ 30% of tested samples. Analysis of complete CP gene sequences of 20 Slovak and Czech GVT isolates detected in the survey revealed relatively high intra-species variability (up to 11.2% nucleotide divergence), suggesting multiple introductions from different sources, possibly over an extended period of time.

Modeling the Accuracy of Three Detection Methods of Grapevine leafroll-associated virus 3 During the Dormant Period Using a Bayesian Approach.

Grapevine leafroll-associated virus 3 (GLRaV-3) has a worldwide distribution and is the most economically important virus that causes grapevine leafroll disease. Reliable, sensitive, and specific methods are required for the detection of the pathogen in order to assure the production of healthy plant material and control of the disease. Although different serological and nucleic acid-based methods have been developed for the detection of GLRaV-3, diagnostic parameters have not been established, and there is no gold standard method. Therefore, the main aim of this work was to determine the sensitivity, specificity, and likelihood ratios of three commonly used methods, including one serological test (double-antibody sandwich enzyme-linked immunosorbent assay [DAS-ELISA]) and two nucleic acid-based techniques (spot and conventional real-time reverse transcription-polymerase chain reaction [RT-PCR]). Latent class models using a Bayesian approach have been applied to determine diagnostic test parameters and to facilitate decision-making regarding diagnostic test selection. Statistical analysis has been based on the results of a total of 281 samples, which were collected during the dormant period from three different populations. The best-fit model out of the 49 implemented models revealed that DAS-ELISA was the most specific method (value = 0.99) and provided the highest degree of confidence in positive results. Conversely, conventional real-time RT-PCR was the most sensitive method (value = 0.98) and produced the highest degree of confidence in negative results. Furthermore, the estimation of likelihood ratios showed that in populations with low GLRaV-3 prevalence the most appropriate method could be DAS-ELISA, while conventional real-time RT-PCR could be the most appropriate method in medium or high prevalence populations. Combining both techniques significantly increases detection accuracy. The flexibility and power of Bayesian latent class models open new possibilities for the evaluation of diagnostic tests for plant viruses.

Methods and strategies for assessing uncontrolled drug-drug interactions in population pharmacokinetic analyses: results from the International Society of Pharmacometrics (ISOP) Working Group.

The purpose of this work was to present a consolidated set of guidelines for the analysis of uncontrolled concomitant medications (ConMed) as a covariate and potential perpetrator in population pharmacokinetic (PopPK) analyses. This white paper is the result of an industry-academia-regulatory collaboration. It is the recommendation of the working group that greater focus be given to the analysis of uncontrolled ConMeds as part of a PopPK analysis of Phase 2/3 data to ensure that the resulting outcome in the PopPK analysis can be viewed as reliable. Other recommendations include: (1) collection of start and stop date and clock time, as well as dose and frequency, in Case Report Forms regarding ConMed administration schedule; (2) prespecification of goals and the methods of analysis, (3) consideration of alternate models, other than the binary covariate model, that might more fully characterize the interaction between perpetrator and victim drug, (4) analysts should consider whether the sample size, not the percent of subjects taking a ConMed, is sufficient to detect a ConMed effect if one is present and to consider the correlation with other covariates when the analysis is conducted, (5) grouping of ConMeds should be based on mechanism (e.g., PGP-inhibitor) and not drug class (e.g., beta-blocker), and (6) when reporting the results in a publication, all details related to the ConMed analysis should be presented allowing the reader to understand the methods and be able to appropriately interpret the results.

A phase 2 trial of dacomitinib (PF-00299804), an oral, irreversible pan-HER (human epidermal growth factor receptor) inhibitor, in patients with advanced non-small cell lung cancer after failure of prior chemotherapy and erlotinib.

BACKGROUND: This phase 2 trial (ClinicalTrials.gov identifier NCT00548093) assessed the efficacy, safety, and impact on health-related quality of life of dacomitinib (PF-00299804), an irreversible tyrosine kinase inhibitor (TKI) of human epidermal growth factor receptors (EGFR)/HER1, HER2, and HER4, in patients with KRAS wild-type non-small cell lung cancer (NSCLC). METHODS: Patients with advanced NSCLC, progression on 1 or 2 regimens of chemotherapy and erlotinib, KRAS wild-type or known EGFR-sensitizing mutant tumor, and Eastern Cooperative Oncology Group performance status of 0 to 2 received 45 mg of dacomitinib once daily continuously in 21-day cycles. RESULTS: A total of 66 patients enrolled (adenocarcinoma, n = 50; those without adenocarcinoma [nonadenocarcinoma], n = 16). The objective response rate (ORR) for patients with adenocarcinoma (primary endpoint) was 5% (2 partial responses; 1-sided P = .372 for null hypothesis [H0 ]: ORR ≤ 5%) and 6% (1 partial response) for patients with nonadenocarcinoma. Responders included: 2 of 25 EGFR mutation-positive tumors; 1 of 3 EGFR wild-type with HER2 amplification. Median progression-free survival was 12 weeks overall (n = 66) and 18 weeks (n = 26) for patients with EGFR mutation-positive tumors. Common treatment-related adverse events were of grade 1 or 2 severity, manageable with standard supportive care, and included diarrhea (grade 3 [G3], 12%), acneiform dermatitis (G3, 6%), exfoliative rash (G3, 3%), dry skin (G3, 0%), fatigue (G3, 3%), and stomatitis (G3, 2%). Six patients (9%) discontinued due to treatment-related adverse events. By patient report, NSCLC symptoms of dyspnea, cough, and pain (chest, arm/shoulder) showed improvement first observed after 3 weeks on therapy. CONCLUSIONS: Dacomitinib demonstrated preliminary activity and acceptable tolerability in heavily pretreated patients, and may offer benefit in molecularly defined patient subsets.

Pharmacokinetics and Metabolism of Melflufen, an Alkylating Peptide-Drug Conjugate, in Patients with Relapsed Refractory Multiple Myeloma.

Melphalan flufenamide (melflufen) is a novel lipophilic peptide-drug conjugate recently approved in the European Union and the United Kingdom for the treatment of relapsed refractory multiple myeloma. Melflufen rapidly crosses the cell membrane, and inside tumor cells, melflufen utilizes peptidases and esterases to release entrapped hydrophilic metabolites with alkylating activity. In vitro, in whole blood, melflufen was rapidly distributed into blood cells and quickly converted to its main metabolite melphalan, with maximum cellular concentrations of noncovalently bound melflufen and melphalan after 1 and 6 minutes, respectively. Melphalan outflow from blood cells was slow, with peak concentrations in plasma after 25 minutes. The pharmacokinetics of melflufen was best described by a 2-compartment model. Following a 30-minutes intravenous infusion of 40 mg in 27 patients with relapsed refactory multiple myeloma, mean half-life in the α phase of the curve was 1.24 minutes, half-life in the ß phase of the curve 26.7 minutes, and clearance 13.4 L/min. Desethyl-melflufen exposure was below 20% compared to melflufen. Based on population analysis (298 patients with relapsed refactory multiple myeloma), the melphalan pharmacokinetics were well characterized by a 3-compartment model with melflufen dosing into a peripheral compartment, assuming instantaneous distribution of melflufen into cells and subsequent rapid metabolism to melphalan. Mean clearance and central and deep peripheral volumes of distribution were 22.4 L/h, 2.70 L, and 51.3 L, respectively. Clearance increased and maximum concentration decreased with increasing body weight and estimated glomerular filtration rate. In conclusion, melflufen administration differs from melphalan administration by a more rapid distribution into cells, which, in conjunction with a rapid intracellular metabolism, allows for higher maximum concentrations of alkylating agents, and by a more extensive distribution of melphalan to peripheral tissues.

Sunitinib combined with pemetrexed and carboplatin in patients with advanced solid malignancies--results of a phase I dose-escalation study.

OBJECTIVES: The maximum tolerated dose (MTD) and overall safety of sunitinib plus pemetrexed and carboplatin was determined in patients with advanced solid malignancies. METHODS: In this phase I dose-escalation study, patients received oral sunitinib on a continuous daily dosing (CDD) schedule (37.5 mg/day) or Schedule 2/1 (2 weeks on treatment, 1 week off treatment; 37.5 or 50 mg/day). Pemetrexed (400-500 mg/m(2) IV) and carboplatin (AUC = 5 mg·min/ml IV) were administered q3w. At the MTD for the chosen schedule, a cohort of patients with non-small cell lung cancer (NSCLC) or mesothelioma was further evaluated. RESULTS: Twenty-one patients were enrolled on Schedule 2/1 (expansion cohort included) and 3 patients on the CDD schedule. The MTD on Schedule 2/1 was sunitinib 37.5 mg/day with pemetrexed 500 mg/m(2) and carboplatin AUC = 5 mg·min/ml; MTD on the CDD schedule was not established. Dose-limiting toxicities included grade 3/4 neutropenia, grade 3 thrombocytopenia, and grade 3 hand-foot syndrome. The most common grade 3/4 drug-related non-hematologic adverse events at Schedule 2/1 MTD were fatigue/asthenia and diarrhea (both n = 4). Grade 3/4 hematologic abnormalities included neutropenia (83%) and leukopenia (83%). Pharmacokinetic data revealed no clinically significant drug-drug interactions. Best response at the Schedule 2/1 MTD was stable disease ≥8 weeks in 3/5 evaluable patients (60%). CONCLUSIONS: With this combination, in patients with advanced solid malignancies, sunitinib MTD on Schedule 2/1 was 37.5 mg/day. Sunitinib plus pemetrexed and carboplatin were tolerable at the MTD, although sunitinib dose delays and reductions were often required due to myelosuppression.

[Assessment of knowledge in Transfusional Medicine in residents in Bajío]. / Evaluación de conocimientos en Medicina Transfusional en médicos residentes del Bajío.

Background: Despite the existence of national and international guidelines, multiple studies show that the clinical use of blood components is not based on scientific evidence; this situation replicates, therefore it was necessary to apply an assessment tool in our medical unit. Objective: Assessment the knowledge in transfusion medicine in medical residents who have high requirements of blood hemocomponentes in Unidad Médica de Alta Especialidad Hospital de Especialidades No.1 Centro Médico Nacional Bajío. Material and methods: A descriptive cross-sectional study was designed, and through a validated test the knowledge in transfusional medicine of residents of the unit was evaluated. Results: 100 residents participated in the research, most of them from the anesthesiology department; as a result, the evaluation tool showed a "Fair" performance in 75% of the participants. No specialty achieved a "Satisfactory" result. Conclusions: The application of this tool is the first step to develop and implement strategies to reduce unjustified transfusions of blood components and thus continue to provide excellent care to beneficiaries, minimizing risks and optimizing institutional resources.

Introducción: a pesar de la existencia de guías tanto nacionales como internacionales, múltiples estudios han puesto de manifiesto que el uso clínico de hemocomponentes no está basado en la evidencia científica; esta situación se replica y es necesario modificarla. Por ello, se planteó aplicar una herramienta de evaluación de conocimientos en medicina transfusional para tal fin en nuestra unidad. Objetivo: evaluar el conocimiento sobre medicina transfusional en médicos residentes de las especialidades con más demandas de hemocomponentes del Hospital de Especialidades No.1 del Centro Médico Nacional Bajío. Material y métodos: se diseñó un estudio transversal descriptivo y, por medio de un examen validado, se evaluó el conocimiento en medicina transfusional de médicos residentes de las especialidades que indican el mayor número de transfusiones en la unidad. Resultados: se contó con la participación de 100 residentes; la mayor participación fue de la especialidad de Anestesiología. El 75% de los participantes obtuvieron un desempeño "Regular" en la herramienta de evaluación. Ninguna especialidad alcanzó un resultado "Satisfactorio". Conclusiones: la aplicación de esta herramienta es el primer paso para desarrollar e implementar estrategias que permitan disminuir las transfusiones de hemocomponentes injustificadas y de esta manera seguir brindando una atención de excelencia a los derechohabientes, minimizando riesgos y optimizando recursos institucionales.

Complete Genome Characterization of Penicillimonavirus gammaplasmoparae, a Bipartite Member of the Family Mymonaviridae.

In this study, we identified Plasmopara-viticola-lesion-associated mononegaambi virus 3 (recently classified as Penicillimonavirus gammaplasmoparae), a fungi-associated mymonavirus, in grapevine plants showing an unusual upward curling symptomatology on the leaves and premature decline. Mymonaviridae is a family comprising nine genera of negative-sense single-stranded RNA viruses infecting filamentous fungi, although few of them have been associated with oomycetes, plants, and insects. Although the first mymonavirus genome description was reported a decade ago, the genome organization of several genera in the family, including the genus Penicillimonavirus, has remained unclear to date. We have determined the complete genome of P. gammaplasmoparae, which represents the first complete genomic sequence for this genus. Moreover, we provide strong evidence that P. gammaplasmoparae genome is bipartite and comprises two RNA molecules of around 6150 and 4560 nt. Our results indicate that the grapevine powdery mildew pathogen, Erysiphe necator, was also present in the analyzed plants and suggest P. gammaplasmoparae could be infecting this fungus. However, whether the fungus and/or the mycovirus are associated with the symptomatology that initially prompted these efforts remains to be determined.

A Novel and Highly Inclusive Quantitative Real-Time RT-PCR Method for the Broad and Efficient Detection of Grapevine Leafroll-Associated Virus 1.

Grapevine (Vitis vinifera L.) is one of the most important crops in the world due to its economic and social impact. Like many other crops, grapevine is susceptible to different types of diseases caused by pathogenic microorganisms. Grapevine leafroll-associated virus 1 (GLRaV-1) is a virus associated with grapevine leafroll disease and it is considered at the national and European level as a pathogen that must be absent in propagative plant material. For this reason, the availability of specific, sensitive and reliable detection techniques to ascertain the sanitary status of the plants is of great importance. The objective of this research was the development of a new GLRaV-1 detection method based on a TaqMan quantitative real-time RT-PCR targeted to the coat protein genomic region and including a host internal control in a duplex reaction. To this end, three new GLRaV-1 full genomes were recovered by HTS and aligned with all sequences available in the databases. The method has been validated following EPPO standards and applied for the diagnosis of field plant material and transmission vectors. The new protocol designed has turned out to be highly sensitive as well as much more specific than the current available methods for the detection and absolute quantitation of GLRaV-1 viral titer.

Impact of Drug Exposure on Resistance Selection Following Artemether-Lumefantrine Treatment for Malaria in Children With and Without HIV in Uganda.

Artemisinin-based combination therapies (ACTs) are the primary treatment for malaria. It is essential to characterize the pharmacokinetics (PKs) and pharmacodynamics (PDs) of ACTs in vulnerable populations at risk of suboptimal dosing. We developed a population PK/PD model using data from our previous study of artemether-lumefantrine in HIV-uninfected and HIV-infected children living in a high-transmission region of Uganda. HIV-infected children were on efavirenz-, nevirapine-, or lopinavir-ritonavir-based antiretroviral regimens, with daily trimethoprim-sulfamethoxazole prophylaxis. We assessed selection for resistance in two key parasite transporters, pfcrt and pfmdr1, over 42-day follow-up and incorporated genotyping into a time-to-event model to ascertain how resistance genotype in relation to drug exposure impacts recurrence risk. Two hundred seventy-seven children contributed 364 episodes to the model (186 HIV-uninfected and 178 HIV-infected), with recurrent microscopy-detectable parasitemia detected in 176 episodes by day 42. The final model was a two-compartment model with first-order absorption and an estimated age effect on bioavailability. Systemic lumefantrine exposure was highest with lopinavir-ritonavir, lowest with efavirenz, and equivalent with nevirapine and HIV-uninfected children. HIV status and lumefantrine concentration were significant factors associated with recurrence risk. Significant selection was demonstrated for pfmdr1 N86 and pfcrt K76 in recurrent infections, with no evidence of selection for pfmdr1 Y184F. Less sensitive parasites were able to tolerate lumefantrine concentrations ~ 3.5-fold higher than more sensitive parasites. This is the first population PK model of lumefantrine in HIV-infected children and demonstrates selection for reduced lumefantrine susceptibility, a concern as we confront the threat to ACTs posed by emerging artemisinin resistance in Africa.

Development and Validation of a Duplex RT-qPCR for Detection of Peach Latent Mosaic Viroid and Comparison of Different Nucleic-Acid-Extraction Protocols.

Peach latent mosaic viroid (PLMVd) is an important pathogen that causes disease in peaches. Control of this viroid remains problematic because most PLMVd variants are symptomless, and although there are many detection tests in use, the reliability of PCR-based methods is compromised by the complex, branched secondary RNA structure of the viroid and its genetic diversity. In this study, a duplex RT-qPCR method was developed and validated against two previously published single RT-qPCRs, which were potentially able to detect all known PLMVd variants when used in tandem. In addition, in order to simplify the sample preparation, rapid-extraction protocols based on the use of crude sap or tissue printing were compared with commercially available RNA purification kits. The performance of the new procedure was evaluated in a test performance study involving five participant laboratories. The new method, in combination with rapid-sample-preparation approaches, was demonstrated to be feasible and reliable, with the advantage of detecting all different PLMVd isolates/variants assayed in a single reaction, reducing costs for routine diagnosis.

Phase I and pharmacokinetic study of dacomitinib (PF-00299804), an oral irreversible, small molecule inhibitor of human epidermal growth factor receptor-1, -2, and -4 tyrosine kinases, in Japanese patients with advanced solid tumors.

BACKGROUND: Dacomitinib (PF-00299804) is an oral, irreversible, small molecule inhibitor of human epidermal growth factor receptor-1, -2, and -4 tyrosine kinases. METHODS: This phase I, open-label, dose-escalation study (clinicaltrials.gov: NCT00783328) primarily evaluated the safety and tolerability of dacomitinib by dose-limiting toxicity (DLT), and determined the clinically recommended phase II dose (RP2D) in Japanese patients with advanced solid tumors. Dacomitinib was administered orally at three dose levels (15, 30, or 45 mg once daily [QD]). Patients initially received a single dose, and after 9 days of follow-up, continuously QD in 21-day cycles. Endpoints included pharmacokinetics (PK) and antitumor activity. RESULTS: Thirteen patients were assigned to the three dose levels (15 mg cohort: n = 3; 30 mg cohort: n = 3; 45 mg cohort: n = 7) according to a traditional '3 + 3' design. None of the treated patients experienced a DLT. Toxicities were manageable and similar in type to those observed in other studies. PK concentration parameters increased with dose over the range evaluated, with no evidence of accumulation over time. Of 13 evaluable patients, one with NSCLC (adenocarcinoma) had a partial response and nine patients had stable disease. CONCLUSIONS: Dacomitinib 45 mg QD was defined as the RP2D and demonstrated preliminary activity in Japanese patients with advanced solid tumors.

Role of the equilibrative and concentrative nucleoside transporters in the intestinal absorption of the nucleoside drug, ribavirin, in wild-type and Ent1(-/-) mice.

Ribavirin is frontline treatment for hepatitis C virus infection. To determine the role of nucleoside transporters in the intestinal absorption of orally administered ribavirin, we perfused the intestines of Ent1(-/-) and wild-type mice, in situ, with [(3)H] ribavirin (20, 200, and 5000 µM) in the presence and absence of sodium. The decrease in luminal ribavirin concentration over 30 min was measured at 5 min intervals. Blood samples were collected approximately every 10 min. Ribavirin plus phosphorylated metabolite concentrations (hereafter referred to as ribavirin) were determined in tissue, blood, and plasma by HPLC fractionation and scintillation counting. There was no significant difference between wild-type and Ent1(-/-) mice in intestinal loss of ribavirin at any ribavirin concentration studied. Perfusions without sodium drastically reduced the intestinal loss of ribavirin in both wild-type and Ent1(-/-) mice. After 20 µM ribavirin perfusions, Ent1(-/-) intestinal tissue contained 8-fold greater ribavirin than wild-type mice (p < 0.01). Ribavirin concentrations in the wild-type intestinal tissue were 70-fold higher after 200 vs 20 µM perfusions (p < 0.001), indicating saturation of intestinal ribavirin efflux and possibly other processes as well. Ribavirin plasma concentrations were significantly higher in wild-type mice (2.7-fold) vs Ent1(-/-) mice at 30 min after the 20 µM perfusion (p < 0.01). These results suggest that, at lower intestinal concentrations of ribavirin, concentrative and equilibrative nucleoside transporters are important in the intestinal absorption of ribavirin. At higher intestinal concentrations, these transporters are saturated and other processes in the intestine (transport and/or metabolism) play an important role in the absorption of ribavirin.

Natural Infection of Pomegranate (Punica Granatum) by Apple Dimple Fruit Viroid.

The analysis by high throughput sequencing (HTS) and RT-PCR of Spanish pomegranate fruits showing yellow rings revealed the presence of viroid isolates closely related to fig isolates of apple dimple fruit viroid (ADFVd). The analysis of pomegranate public RNASeq data (Sequence Reads Archives, SRAs) from Israel provided evidence for the presence of similar ADFVd isolates in pomegranate trees in this country. In addition, reads or contigs of plum viroid I (PVd-I) isolates were also identified in two of the analyzed SRA datasets from Israel, suggesting the presence of this second viroid in pomegranate. Full length ADFVd genomic sequences have been recovered, increasing knowledge on the diversity of this viroid and on the pomegranate virome in which only four viruses and one viroid had previously been reported.

High-Throughput Sequencing Discloses the Cucumber Mosaic Virus (CMV) Diversity in Slovakia and Reveals New Hosts of CMV from the Papaveraceae Family.

Cucumber mosaic virus (CMV; Cucumovirus, Bromoviridae) is an omnipresent virus characterized by a large host range and high genetic variability. Using high-throughput sequencing, we have characterized near complete genomes of 14 Slovak CMV variants from different plant hosts. Of these, three variants originated from the Papaveraceae species (oilseed poppy, common poppy and great celandine), previously poorly described as CMV natural hosts. Based on a BLAST search and phylogenetic analysis, the Slovak CMV isolates can be divided into two genetically different Groups, Ia and II, respectively. The SL50V variant, characterized by a divergent RNA2 sequence, potentially represents a reassortant variant. In four samples (T101, SL50V, CP2, MVU2-21), the presence of satellite CMV RNA was identified along with CMV. Although mechanically transmitted to experimental cucumber plants, the role of satellite RNA in the symptomatology observed could not be established due to a complex infection of original hosts with different viruses.