AMAFRICA, a patient-navigator program for accompanying lymphoma patients during chemotherapy in Ivory Coast: a prospective randomized study.

BACKGROUND: Previous studies have indicated that accompanying socially underserved cancer patients through Patient Navigator (PN) or PN-derived procedures improves therapy management and reassurance. At the Cancer Institute of Toulouse-Oncopole (France), we have implemented AMA (Ambulatory Medical Assistance), a PN-based procedure adapted for malignant lymphoma (ML) patients under therapy. We found that AMA improves adherence to chemotherapy and safety. In low-middle income countries (LMIC), refusal and abandonment were documented as major adverse factors for cancer therapy. We reasoned that AMA could improve clinical management of ML patients in LMIC. METHODS: This study was set up in the Abidjan University Medical Center (Ivory Coast) in collaboration with Toulouse. One hundred African patients were randomly assigned to either an AMA or control group. Main criteria of judgment were refusal and abandonment of CHOP or ABVD chemotherapy. RESULTS: We found that AMA was feasible and had significant impact on refusal and abandonment. However, only one third of patients completed their therapy in both groups. No differences were noted in terms of complete response rate (CR) (16% based on intent-to-treat) and median overall survival (OS) (6 months). The main reason for refusal and abandonment was limitation of financial resources. CONCLUSION: Altogether, this study showed that PN may reduce refusal and abandonment of treatment. However, due to insufficient health care coverage, its ultimate impact on OS remains limited.

First Report of Xanthomonas oryzae pv. oryzicola Causing Bacterial Leaf Streak of Rice in Uganda.

In June 2013, symptoms reminiscent of bacterial leaf streak (BLS) caused by Xanthomonas oryzae pv. oryzicola were observed on rice plants at the booting stage in the Doho rice irrigation scheme, Butaleja district, and at the tillering stage in Nambale, Iganga district and Magada, Namutumba district of Uganda. In areas surveyed, disease incidence was about 80, 40, and 30% in Doho, Nambale, and Magada, respectively. Outside the irrigation schemes, it was lower but widespread. Affected leaves showed typical BLS symptoms, such as water-soaked lesions, translucent stripes, and yellow-brown to black streaks, sometimes with visible exudates at the leaf surfaces. To check for the presence of the bacteria, symptomatic leaves were ground in sterile water and the suspension obtained was subjected to a multiplex PCR assay for X. oryzae pathovars, leading to the three diagnostic DNA fragments for X. oryzae pv. oryzicola (3). In parallel, bacterial strains were isolated from surface-sterilized symptomatic leaves. To this end, rice leaves were ground in sterile distilled water and serial dilutions of the cell suspensions were plated on semi-selective PSA medium (4). Each of the three samples yielded yellow, mucoid Xanthomonas-like colonies that resembled the positive control strain MAI10 (1). These isolates were named Ug_1, Ug_10, and Ug_14, which originated from Doho, Magada, and Nambale, respectively. Multiplex PCR on the pure cultures strongly supported that these isolates corresponded to X. oryzae pv. oryzicola. Two isolates, Ug_1 and Ug_14, were further subjected to partial DNA sequence analysis of the gyrB gene upon PCR amplification using the primers XgyrB1F and XgyrB1R (5). The 467-bp DNA sequence was identical to the gyrB sequences from the X. oryzae pv. oryzicola strains BLS256 (Philippines), ICMP 12013 (China), and MAI3 (Mali) (2). The partial nucleotide sequence of the gyrB gene of strain Ug_1 was submitted to GenBank (KJ921786). Pathogenicity tests were performed on greenhouse-grown 4-week-old rice plants of the cultivars Nipponbare, Azucena, IRBB 1, IRBB 2, IRBB 3, FKR 14, PNA64F4-56, TCS 10, Gigante, and Adny 11. For this purpose, bacterial cultures were grown overnight in PSA medium and re-suspended in sterile water at a concentration of 1 × 108 CFU/ml. Bacterial suspensions were sprayed on leaves of rice seedlings. Four seedlings per accession and isolate were inoculated. Fifteen days after incubation in a BSL-3 containment facility (27 ± 1°C with a 12-h photoperiod), inoculated leaves exhibited typical water-soaked lesions with yellow exudates that were similar to the symptoms seen in the fields. Re-isolation of the bacteria from the diseased leaves yielded colonies with the typical morphology of Xanthomonas. Multiplex PCR and sequence analysis of portions of the gyrB gene confirmed that these isolates are X. oryzae pv. oryzicola, thus fulfilling Koch's postulates. One of the three isolates, Ug_1, has been deposited in the Collection Française de Bactéries Phytopathogènes (CFBP) as strain CFBP 8171 ( http://www.angers-nantes.inra.fr/cfbp/ ). Further surveys and strain collections in East and Central Africa will help assess the geographic distribution and importance of BLS. References: (1) C. Gonzalez et al. Mol. Plant Microbe Interact. 20:534, 2007. (2) A. Hajri et al. Mol. Plant Pathol. 13:288, 2012. (3) J. M. Lang et al. Plant Dis. 94:311, 2010. (4) L. Poulin et al. Plant Dis. 98:1423, 2014. (5) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.

Confirmation of Bacterial Leaf Streak Caused by Xanthomonas oryzae pv. oryzicola on Rice in Madagascar.

Bacterial leaf streak (BLS) caused by Xanthomonas oryzae pv. oryzicola is an important disease of rice. BLS is prevalent in Asia and West Africa, where it was first reported in Nigeria and Senegal in the early 1980s (4). Recently, molecular analysis of strains from Mali (2) and Burkina Faso (5) further confirmed the presence of BLS in West Africa. In Madagascar, BLS symptoms were first reported in the 1980s by Buddenhagen but the causal agent was not unequivocally determined (1). To confirm Buddenhagen's observations using modern molecular typing tools, we surveyed several rice fields in the Antananarivo and Antsirabe districts in March 2013. BLS symptoms were observed on cultivated Oryza sativa grown under both upland and lowland conditions, with a proportion of diseased individuals varying from 30% up to 80%. Symptomatic leaves presenting water-soaked lesions that developed into translucent, yellow streaks with visible exudates at the surface were sampled. One to four centimeter long pieces of diseased leaves were ground using the Qiagen TissueLyser system at 30 rps for 30 s (Qiagen, Courtaboeuf, France). The ground tissue was then macerated in 1 ml of sterile water for 1 h at 4°C. Non-diluted and 10-fold diluted tissue macerates were plated on semi-selective PSA medium (peptone 10 g/liter, sucrose 10 g/liter, glutamic acid 1 g/liter, bacto agar 16 g/liter, actidione 50 mg/liter, cephalexin 40 mg/liter, and kasugamycin 20 mg/liter) and incubated for 3 to 7 days at 28°C. Single, yellow, Xanthomonas-like colonies were isolated on non-selective PSA medium. Diagnostic multiplex PCR was performed on single colonies for pathovar identification (3). Five strains that produced three diagnostic bands corresponding to the X. oryzae pv. oryzicola pattern were further analyzed for pathogenicity on 3-week-old O. sativa cv. Nipponbare plants. Bacteria grown on PSA plates and adjusted to 1 × 108 CFU/ml were infiltrated into rice leaves with a needleless 1-ml syringe (2 × 3 infiltrations per plant and strain). Seven days after incubation in the greenhouse (27 ± 1°C with a 12-h photoperiod), inoculated leaves showed water-soaked lesions that produced yellow exudates corresponding to those initially observed in rice fields and observed for leaves challenged with the X. oryzae pv. oryzicola reference strain BLS256. Symptomatic leaf tissues were ground and plated on non-selective PSA medium, resulting in colonies with typical Xanthomonas morphology that were confirmed as X. oryzae pv. oryzicola by multiplex PCR typing (3), thus fulfilling Koch's postulates. Finally, the five strains were subjected to gyrB sequencing upon PCR amplification using the universal primers XgyrB1F (5'-ACGAGTACAACCCGGACAA-3') and XgyrB1R (5'-CCCATCARGGTGCTGAAGAT-3'). The 743-bp partial gyrB sequences were 100% identical to the gyrB sequence of strain BLS256. As expected, the gyrB sequence of strains KACC10331, MAFF311018, and PXO99A of the X. oryzae pv. oryzae pathovar respectively showed nine, 16, and 10 mismatches in comparison to the Malagasy strains, thus further supporting that they belong to the pathovar oryzicola. References: (1) I. W. Buddenhagen. Int. Rice Comm. Newsl. 34:74, 1985. (2) C. Gonzalez et al. Mol. Plant Microbe Interact. 20:534, 2007. (3) J. M. Lang et al. Plant Dis. 94:311, 2010. (4) D. O. Niño-Liu et al. Mol. Plant Pathol. 7:303, 2006. (5) I. Wonni et al. Plant Dis. 95:72, 2011.

First Report of Xanthomonas oryzae pv. oryzicola Causing Bacterial Leaf Streak of Rice in Burundi.

On May 9, 2013, symptoms reminiscent of bacterial leaf streak (BLS) caused by Xanthomonas oryzae pv. oryzicola were observed on rice plants at the panicle emergence stage at Musenyi, Gihanga, and Rugombo fields in Burundi. Affected leaves showed water-soaked translucent lesions and yellow-brown to black streaks, sometimes with visible exudates on leaf surfaces. Symptomatic leaves were ground in sterile water and the suspensions obtained were subjected to a multiplex PCR assay diagnostic for X. oryzae pathovars (3). Three DNA fragments (331, 691, and 945 bp) corresponding to X. oryzae pv. oryzicola were observed after agarose gel electrophoresis. Single bacterial colonies were then isolated from surface-sterilized, infected leaves after grinding in sterile water and plating of 10-fold dilutions of the cell suspension on semi-selective PSA medium (4). After incubation at 28°C for 5 days, each of four independent cultures yielded single yellow, mucoid Xanthomonas-like colonies (named Bur_1, Bur_2, Bur_6, and Bur_7) that resembled the positive control strain MAI10 (1). These strains originated from Musenyi (Bur_1), Gihanga (Bur_2), and Rugumbo (Bur_6 and Bur_7). Multiplex PCR assays on the four putative X. oryzae pv. oryzicola strains yielded the three diagnostic DNA fragments mentioned above. All strains were further analyzed by sequence analysis of portions of the gyrB gene using the universal primers gyrB1-F and gyrB1-R for PCR amplification (5). The 762-bp DNA fragment was identical to gyrB sequences from the Asian X. oryzae pv. oryzicola strains BLS256 (Philippines), ICMP 12013 (China), LMG 797 and NCPPB 2921 (both Malaysia), and from the African strain MAI3 (Mali) (2). The partial nucleotide sequence of the gyrB gene of Bur_1 was submitted to GenBank (Accession No. KJ801400). Pathogenicity tests were performed on greenhouse-grown 4-week-old rice plants of the cvs. Nipponbare, Azucena, IRBB 1, IRBB 2, IRBB 3, IRBB 7, FKR 14, PNA64F4-56, TCS 10, Gigante, and Adny 11. Bacterial cultures were grown overnight in PSA medium and re-suspended in sterile water (1 × 108 CFU/ml). Plants were inoculated with bacterial suspensions either by spraying or by leaf infiltration (1). For spray inoculation, four plants per accession and strain were used while three leaves per plant and four plants per accession and strain were inoculated by tissue infiltration. After 15 days of incubation in a BSL-3 containment facility (27 ± 1°C with a 12-h photoperiod), the spray-inoculated plants showed water-soaked lesions with yellow exudates identical to those seen in the field. For syringe-infiltrated leaves, the same symptoms were observed at the infiltrated leaf area. Re-isolation of bacteria from symptomatic leaves yielded colonies with the typical Xanthomonas morphology that were confirmed by multiplex PCR to be X. oryzae pv. oryzicola, thus fulfilling Koch's postulates. Bur_1 has been deposited in the Collection Française de Bactéries Phytopathogènes as strain CFBP 8170 ( http://www.angers-nantes.inra.fr/cfbp/ ). To our knowledge, this is the first report of X. oryzae pv. oryzicola causing bacterial leaf streak on rice in Burundi. Further surveys will help to assess its importance in the country. References: (1) C. Gonzalez et al., Mol. Plant Microbe Interact. 20:534, 2007. (2) A. Hajri et al. Mol. Plant Pathol. 13:288, 2012. (3) J. M. Lang et al. Plant Dis. 94:311, 2010. (4) L. Poulin et al. Plant Dis. 98:1423, 2014. (5) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.

First Report of Rice yellow mottle virus on Rice in the Democratic Republic of Congo.

Rice yellow mottle virus (RYMV), genus Sobemovirus, is a widespread rice pathogen reported in nearly all rice-growing countries of Africa. Although the virus was detected in Cameroon, Chad, Tanzania, Rwanda, Burundi, and Uganda (2,3), RYMV has never been described in the Democratic Republic of Congo (DRC). In July 2012, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes 30 km south of Bukavu, in eastern DRC, and in lowland subsistence fields in the surroundings of Bukavu. Several dozen hectares affected by the disease were abandoned by the farmers. Symptomatic leaf samples were collected in different farmer fields. Back-inoculations to susceptible rice variety IR64 resulted in the same yellowing and mottling symptoms 7 to 9 days post-inoculation. Infected leaves gave positive results using double antibody sandwich (DAS)-ELISA tests with polyclonal antisera (as described in [1]), indicating for the first time the presence of RYMV in DRC. Triple antibody sandwich (TAS)-ELISA tests with discriminant monoclonal antibodies (1) revealed that they all belong to serotype 4 found in the neighboring region in Rwanda. Total RNA of three samples from South Kivu was extracted with the RNeasy Plant Mini kit (Qiagen, Germany). The 720 nucleotide coat protein (CP) gene was amplified by reverse transcription (RT)-PCR with primers 5'CTCCCCCACCCATCCCGAGAATT3' and 5'CAAAGATGGCCAGGAA3' (1). The sequences were deposited in GenBank (Accessions KC788208, KC788209, and KC788210). A set of CP sequences of 45 isolates representative of the RYMV diversity in Africa, including the sequences of the DRC samples, were used for phylogenetic reconstruction by maximum-likelihood method. The isolates from South Kivu belonged to strain S4-lv, mainly found around Lake Victoria. Specifically, within the S4-lv strain, the South Kivu isolates clustered with isolates from eastern and southern provinces of Rwanda and Burundi, respectively (2), suggesting a recent spread from these countries. Recently, efforts have been directed to shift from the traditional upland system to lowland and irrigated systems in which water availability allows sequential planting and maintenance of higher crop intensity. This agricultural change may increase insect vectors and alternate host plant populations which may result in higher RYMV incidence in DRC (3). Similar yellowing and mottling symptoms have been observed in Bas-Congo and Equateur provinces of the country, which would justify further surveys and characterisation of RYMV in the DRC. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) I. Ndikumana et al. Plant Dis. 96:1230, 2012. (3) O. Traoré et al. Mol. Ecol. 14:2097, 2005.

Randomized, double-blind, placebo-controlled trial of oral artemether for the prevention of patent Schistosoma haematobium infections.

Artemether is an efficacious antimalarial drug that also displays antischistosomal properties. Laboratory studies have found that artemether curtails the development of adult worms of Schistosoma japonicum, S. mansoni and S. haematobium, and thus prevents morbidity. These findings have been confirmed in clinical trials for the former two parasites; administered orally once every 2-3 weeks, artemether significantly reduced the incidence and intensity of patent infections. Here, we present the first randomized, double-blind, placebo-controlled trial of artemether against S. haematobium, done in a highly endemic area of Côte d'Ivoire. Urine specimens from 440 schoolchildren were examined over 4 consecutive days, followed by two systematic praziquantel treatments 4 weeks apart. S. haematobium-negative children were randomized to receive 6 mg/kg artemether (N = 161) or placebo (N = 161). Medication was administered orally for a total of six doses once every 4 weeks. Adverse events were assessed 72 hours after medication, and perceived illness episodes were monitored throughout the study period. Incidence and intensity of S. haematobium infections, and microhematuria and macrohematuria were assessed 3 weeks after the final dosing. We also monitored malaria parasitemia and treated positive cases with sulfadoxine-pyrimethamine (SP). Oral artemether was well tolerated. The incidence of patent S. haematobium infections in artemether recipients was significantly lower than in placebo recipients (49% versus 65%, protective efficacy: 0.25, 95% CI: 0.08-0.38, P = 0.007). The geometric mean infection intensity in the artemether group was less than half that of the placebo recipients (3.4 versus 7.4 eggs/10 mL urine, P < 0.001). Heavy S. haematobium infections, microhematuria and macrohematuria, and the incidence of malaria parasitemia were all significantly lower in artemether recipients. In conclusion, previous findings of efficacy of artemether against S. japonicum and S. mansoni were confirmed for S. haematobium, although the protective efficacy was considerably lower. These findings enlarge the scope and potential of artemether and further contribute to discussions of its role as an additional tool for integrated schistosomiasis control.