Phytochromes and cryptochromes in the entrainment of the Arabidopsis circadian clock.

Circadian clocks are synchronized by environmental cues such as light. Photoreceptor-deficient Arabidopsis thaliana mutants were used to measure the effect of light fluence rate on circadian period in plants. Phytochrome B is the primary high-intensity red light photoreceptor for circadian control, and phytochrome A acts under low-intensity red light. Cryptochrome 1 and phytochrome A both act to transmit low-fluence blue light to the clock. Cryptochrome 1 mediates high-intensity blue light signals for period length control. The presence of cryptochromes in both plants and animals suggests that circadian input pathways have been conserved throughout evolution.

Identification of specific transducin alpha subunits in retinal rod and cone photoreceptors.

Transducin is a guanyl nucleotide-binding protein that couples rhodopsin photolysis to hydrolysis of guanosine 3',5'-monophosphate in rod photoreceptor cells of vertebrate retinas. Several complementary DNA clones encoding transducin subunits have recently been characterized. One clone, isolated from a bovine retina complementary DNA library, encodes a previously unidentified polypeptide with an amino acid sequence 78% identical to the sequence of the alpha subunit of bovine rod outer segment transducin. Antibodies to a synthetic peptide with amino acid sequence derived specifically from this novel polypeptide recognize a 41-kilodalton polypeptide in homogenates of bovine retina. Localization of this polypeptide in bovine retina by indirect immunofluorescence demonstrates that it is expressed only in cone outer segments. Antibodies to specific sequences found only in the rod transducin alpha subunit recognize a polypeptide localized only in the rod outer segment. Therefore, bovine rod and cone cells each express structurally related yet significantly different forms of transducin.

Conditional circadian dysfunction of the Arabidopsis early-flowering 3 mutant.

Photoperiodic responses, such as the daylength-dependent control of reproductive development, are associated with a circadian biological clock. The photoperiod-insensitive early-flowering 3 (elf3) mutant of Arabidopsis thaliana lacks rhythmicity in two distinct circadian-regulated processes. This defect was apparent only when plants were assayed under constant light conditions. elf3 mutants retain rhythmicity in constant dark and anticipate light/dark transitions under most light/dark regimes. The conditional arrhythmic phenotype suggests that the circadian pacemaker is intact in darkness in elf3 mutant plants, but the transduction of light signals to the circadian clock is impaired.

Control of circadian rhythms and photoperiodic flowering by the Arabidopsis GIGANTEA gene.

Photoperiodic responses in plants include flowering that is day-length-dependent. Mutations in the Arabidopsis thaliana GIGANTEA (GI) gene cause photoperiod-insensitive flowering and alteration of circadian rhythms. The GI gene encodes a protein containing six putative transmembrane domains. Circadian expression patterns of the GI gene and the clock-associated genes, LHY and CCA1, are altered in gi mutants, showing that GI is required for maintaining circadian amplitude and appropriate period length of these genes. The gi-1 mutation also affects light signaling to the clock, which suggests that GI participates in a feedback loop of the plant circadian system.

Cloning of the Arabidopsis clock gene TOC1, an autoregulatory response regulator homolog.

The toc1 mutation causes shortened circadian rhythms in light-grown Arabidopsis plants. Here, we report the same toc1 effect in the absence of light input to the clock. We also show that TOC1 controls photoperiodic flowering response through clock function. The TOC1 gene was isolated and found to encode a nuclear protein containing an atypical response regulator receiver domain and two motifs that suggest a role in transcriptional regulation: a basic motif conserved within the CONSTANS family of transcription factors and an acidic domain. TOC1 is itself circadianly regulated and participates in a feedback loop to control its own expression.

The hy3 Long Hypocotyl Mutant of Arabidopsis Is Deficient in Phytochrome B.

The six long hypocotyl (hy) complementation groups of Arabidopsis (hy1, hy2, hy3, hy4, hy5, and hy6) share the common feature of an elongated hypocotyl when grown in white light. The varied responses of these mutants to irradiations of differing wavelengths have suggested that some of the lines may lack elements of the phytochrome signal transduction pathway. We have performed immunoblot and RNA gel blot analyses of the multiple types of phytochrome present in wild-type and mutant Arabidopsis and provide evidence that mutations at the HY3 locus cause a specific deficiency in phytochrome B. Using an Escherichia coli overexpression system, we have developed and identified monoclonal antibodies that selectively recognize phytochromes A, B, and C from Arabidopsis. In wild-type plants, phytochrome A is highly abundant in etiolated tissue, but rapidly decreases about 200-fold upon illumination. Phytochromes B and C are present at much lower levels in etiolated tissue but are unaffected by up to 24 hr of red light illumination, and together predominate in green seedlings. These data establish that phytochromes B and C are "type 2" or photostable phytochromes. Levels of phytochromes A, B, and C similar to those of the wild type are observed in strains containing mutations at the HY4 and HY5 loci. In contrast, all four hy3 mutant alleles tested here exhibit a modest (twofold to threefold) reduction in phyB transcript and a severe (20- to 50-fold) deficiency in phyB-encoded protein, relative to levels in wild-type plants. The levels of phyA- and phyC-encoded mRNA and protein, however, are indistinguishable from the wild type in these mutants. We conclude that the phenotype conferred by hy3 is due to the reduced levels of the light-stable phytochrome B.

Phytochrome-Mediated Light Regulation of PHYA- and PHYB-GUS Transgenes in Arabidopsis thaliana Seedlings.

Phytochrome wild-type gene-[beta]-glucuronidase (PHY-GUS) gene fusions were used in transgenic Arabidopsis to compare the activity levels and light regulation of the PHYA and PHYB promoters and to identify the photoreceptors mediating this regulation. In dark-grown seedlings, both promoters are 4-fold more active in shoots than in roots,but the PHYA promoter is nearly 20-fold more active than that of PHYB in both organs. In shoots, white light represses the activities of the PHYA and PHYB promoters 10- and 2-fold, respectively, whereas in roots light has no effect on the PHYA promoter but increases PHYB promoter activity 2-fold. Consequently, PHYA promoter activity remains higher than that of PHYB in light in both shoots (5-fold) and roots (11-fold). Experiments with narrow-waveband light and photomorphogenic mutants suggest that no single photoreceptor is necessary for full white-light-directed PHYA repression in shoots, but that multiple, independent photoreceptor pathways are sufficient alone or in combination. In contrast, phytochrome B appears both necessary and sufficient for a light-mediated decrease in PHYB activity in shoots, and phytochrome A mediates a far-red-light-stimulated increase in PHYB promoter activity. Together, the data indicate that the PHYA and PHYB genes are regulated in divergent fashion at the transcriptional level, both developmentally and by the spectral distribution of the prevailing light, and that this regulation may be important to the photosensory function of the two photoreceptors.

The Arabidopsis phytochrome A gene has multiple transcription start sites and a promoter sequence motif homologous to the repressor element of monocot phytochrome A genes.

We have determined the sequence of the phytochrome A gene (PHYA) and its flanking DNA from Arabidopsis thaliana and have identified transcription start sites for three nested transcripts of increasing length. The overall structure of the gene is similar as regards exon/intron organization to other angiosperm PHY genes characterized. The triple transcription start site arrangement is similar to that of pea PHYA but different from the single start site of oat, rice and maize PHYA genes, indicating a possible monocot-dicot difference. Comparison of the Arabidopsis PHYA promoter sequence with others available indicates that both pea and Arabidopsis promoters contain a DNA element with a core sequence motif identical to one conserved in all existing monocot PHYA sequences and defined by functional assay in the oat PHYA gene as repressor element, RE1, responsible for negative light regulation.

Posttranslational photomodulation of circadian amplitude.

The transcription-translation feedback loops that form our current view of how the core mechanism of the clock operates is being challenged, as more and more posttranslational events are seen as essential to a full understanding of oscillator function. But in addition to phosphorylation, other processes may be involved. Here, a novel mechanism of posttranslational photomodulation of circadian amplitude is described that uniquely ties together light perception, protein stabilization, and proteolysis. In the process, the waveform of a core clock component is sharpened or "sculpted," resulting in appropriately high amplitude and proper phasing to obtain normal clock function.

Clock-associated genes in Arabidopsis: a family affair.

The identification of components of the plant circadian clock has been advanced recently with the success of two forward genetics approaches. The ZEITLUPE and TOC1 loci were cloned and each was found to be part of two separate, larger gene families with intriguing domain structures. The ZTL family of proteins contains a subclass of the PAS domain coupled to an F box and kelch motifs, suggesting that they play a role in a novel light-regulated ubiquitination mechanism. TOC1 shares similarity to the receiver domain of the well-known two-component phosphorelay signalling systems, combined with a strong similarity to a region of the CONSTANS transcription factor, which is involved in controlling flowering time. When added to the repertoire of previously identified clock-associated genes, it is clear that both similarities and differences with other circadian systems will emerge in the coming years.

Temporal and spatial expression patterns of PHYA and PHYB genes in Arabidopsis.

Phytochromes A and B have discrete photosensory functions in Arabidopsis. To determine whether differential temporal or spatial expression patterns of the PHYA and PHYB genes contribute to this phenomenon the expression of PHYA-GUS and PHYB-GUS reporter genes has been examined in transgenic Arabidopsis. Histochemical and quantitative biochemical analyses indicate that both transgenes are expressed extensively throughout the plant, including roots, shoots and flowers, during the entire life cycle, but with strong differences between the two in expression level and photoregulation, and more limited differences in spatial expression patterns. The data indicate that regulation is at the transcriptional level. In dry seed, PHYB-GUS is expressed throughout the embryo at three-fold higher levels than PHYB-GUS, which is confined primarily to the embryonic root tip. By contrast, PHYA promoter activity, despite strong negative regulation in shoots by light, is consistently higher than PHYB (two- to 20-fold) in both the light and dark in most tissues during all subsequent developmental phases, from seedling to mature adult. At the tissue level, most cells appear to express both transgenes at some level at all stages examined, with highest apparent activity in vascular tissue and root tips. With the notable exception of pollen, where high PHYB-GUS but not PHYA-GUS expression occurs, few major differences are observed in the quantitative spatial distribution pattern between the two transgenes. The strongly similar spatial and temporal expression patterns of PHYA-GUS and PHYB-GUS transgenes suggest that the differential photosensory activity of these two phytochromes occurs largely through differences in their (i) intrinsic biochemical activities, (ii) relative abundances, and/or (iii) independent and separate reaction partners, rather than through discrete, developmentally controlled expression patterns.

A Drosophila melanogaster G protein alpha subunit gene is expressed primarily in embryos and pupae.

A G protein alpha subunit gene has been isolated from a Drosophila melanogaster genomic library using a combination of bovine rod and cone transducin alpha subunit cDNAs as a probe under reduced stringency conditions. The gene, DG alpha 1, encodes a protein with an amino acid sequence 78% identical to bovine Gi alpha 1. However, unlike all reported Gi alpha subunit the DG alpha 1-encoded protein is not expected to be a pertussis toxin substrate, because it lacks a cysteine at the appropriate site. The protein coding region of the gene is split by four introns. The sequence of a head tissue cDNA clone, as well as amino acid similarities to mammalian G proteins, confirms this exon/intron structure. Northern blots of total cellular RNA reveal a major 2.3-kilobase transcript and a less abundant 1.7-kilobase transcript. These transcripts are most abundant in RNA from embryos and pupae. The DG alpha 1 gene is located on band 65C on the left arm of the third chromosome, on the basis of in situ hybridizations to Drosophila salivary gland polytene chromosomes.

Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana.

We report the cloning and characterization of an Arabidopsis thaliana (L.) Heynh. (Columbia ecotype) ferredoxin gene (Fed A). Sequence analysis of a genomic clone shows an intron-free, 444-base pair open reading frame which encodes a 96 amino acid mature ferredoxin polypeptide preceded by a 52 amino acid transit peptide. Comparison with other plant ferredoxin proteins suggests that Fed A encodes a leaf ferredoxin. Genomic Southern blot analysis indicates the presence of a second, weakly related gene, consistent with other reports of at least two ferredoxins in plants. The Fed A gene promoter contains two regions, ACGCCACGTGGTAGATAGGATT (G-I box) and CCACGCCATTTCCACAAGC (CCAC box), which are strongly conserved in both sequence and position between the Arabidopsis and pea ferredoxin genes. Similarities with other better characterized plant promoter elements are also discussed.

ZEITLUPE encodes a novel clock-associated PAS protein from Arabidopsis.

We have conducted genetic screens for period length mutants in Arabidopsis using a transgenic bioluminescence phenotype. This screen identified mutations at a locus, ZEITLUPE (ZTL), that lengthen the free-running period of clock-controlled gene transcription and cell expansion, and alter the timing of the daylength-dependent transition from vegetative to floral development. Map-based cloning of ZTL identified a novel 609 amino acid polypeptide consisting of an amino-terminal PAS domain, an F box and six carboxy-terminal kelch repeats. The PAS region is highly similar to the PAS domain of the Arabidopsis blue-light receptor NPH1, and the Neurospora circadian-associated protein WHITE COLLAR-1 (WC-1). The striking fluence rate-dependent effect of the ztl mutations suggests that ZTL plays a primary role in the photocontrol of circadian period in higher plants.

Transgenic complementation of the hy3 phytochrome B mutation and response to PHYB gene copy number in Arabidopsis.

A recombinant PHYB minigene (mPHYB) consisting of the complete Arabidopsis PHYB cDNA sequence fused to 2.3 kb of upstream PHYB promoter sequence has been introduced into wild-type Arabidopsis and into a strain containing the Bo64 allele of the hy3 mutation. The Bo64 mutant has previously been shown to contain a nonsense mutation in the PHYB coding sequence. Transformation of this strain with the mPHYB gene results in complementation of all of the mutant phenotypic characteristics tested including hypocotyl length and hypocotyl cell size, response to end-of-day far-red light, leaf morphology, chlorophyll level, and flowering time. Presence of the mPHYB transgene in a wild-type genetic background causes exaggeration of this same set of phenotypic characteristics, indicating that these diverse photo-morphogenic responses are sensitive to the copy number of the PHYB gene. The transgene inserts in the Bo64(mPHYB) and WT(mPHYB) lines are shown to be single locus and single copy and the immunologically detectable level of phytochrome B is shown to vary linearly with PHYB gene copy number. These results demonstrate a complex role for phytochrome B in Arabidopsis photo-morphogenesis and suggest that the expression level of this phytochrome gene is an important determinant of the intensity of light-induced plant responses.

The Brassica rapa elongated internode (EIN) gene encodes phytochrome B.

The elongated internode (ein) mutation of Brassica rapa leads to a deficiency in immunochemically detectable phytochrome B. Molecular analysis of the PHYB gene from ein indicates a deletion in the flanking DNA 5' of the ATG start codon, which could interfere either with PHYB transcription or processing of the PHYB transcript. Restriction fragment length polymorphisms and inverse PCR fragments generated from the PHYB gene of wild-type and ein seedlings demonstrate the deletion to be 500 bp in length. Seedlings of heterozygote, EIN/ein, contain about 50% of the level of immunochemically detectable phytochrome B of equivalent wild-type EIN/EIN seedlings. Etiolated seedlings of EIN/ein show a responsiveness to red light almost intermediate between that of ein/ein and EIN/EIN homozygotes. Furthermore, whereas the ein/ein homozygote is poorly responsive to low red/far-red ratio light, the presence of one functional allele of EIN in the heterozygote confers an elongation response intermediate between that of the homozygotes EIN/EIN and ein/ein in these light conditions. The partial dominance of ein indicates a close relationship between phytochrome B level and phenotype.

The short-period mutant, toc1-1, alters circadian clock regulation of multiple outputs throughout development in Arabidopsis thaliana.

The coordination of developmental and physiological events with environmental signals is facilitated by the action of the circadian clock. Here we report a new set of circadian clock-controlled phenotypes for Arabidopsis thaliana. We use these markers together with the short-period mutant, toc1-1, and the clock-controlled cab2::luciferase reporter gene to assess the nature of the circadian clock throughout development and to suggest the position of TOC1 within the circadian clock system. In dark-grown seedlings, the toc1-1 lesion conferred a short period to the cycling of cab2::luciferase luminescence, as previously found in light-grown plants, indicating that the circadian clocks in these two divergent developmental states share at least one component. Stomatal conductance rhythms were similarly approximately 3 hours shorter than wild type in toc1-1, suggesting that a cell-autonomous clockwork may be active in guard cells in 5- to 6-week-old leaves. The effect of daylength on flowering time in the C24 ecotype was diminished by toc1-1, and was nearly eliminated in the Landsberg erecta background where the plants flowered equally early in both short and long days. Throughout a 500-fold range of red light intensities, both the wild type and the mutant showed an inverse log-linear relationship of fluence rate to period, with a 2-3 hour shorter period for the mutant at all intensities. These results indicate that TOC1 acts on or within the clock independently of light input. Temperature entrainment appears normal in toc1-1, and the period-shortening effects of the mutant remain unchanged over a 20 degrees C temperature range. Taken together our results are consistent with the likelihood that TOC1 codes for an oscillator component rather than for an element of an input signaling pathway. In addition, the pervasive effect of toc1-1 on a variety of clock-controlled processes throughout development suggests that a single circadian system is primarily responsible for controlling most, if not all, circadian rhythms in the plant.

Attenuation of phytochrome A and B signaling pathways by the Arabidopsis circadian clock.

In higher plants, environmental cues such as light signals are integrated with circadian clock signals to control precisely the daily rhythms observed for many biological functions. We have used a fusion of the promoter of a chlorophyll a/b binding protein gene, CAB2, with firefly luciferase (cab2::luc) to monitor the detailed kinetics of transcription in response to photoreceptor activation in Arabidopsis. Using this marker in phototransduction and circadian-dysfunctional mutants, we studied how signals from phytochrome and the circadian clock are integrated for the regulation of CAB2 transcription. Results from these mutant studies demonstrate that similar expression features, namely, the acute and circadian responses, are present in both etiolated and green seedlings and that the acute and circadian responses are genetically separable. We also demonstrate that persistent Pfr signaling occurs in red light-pulsed etiolated seedlings, which suggests that the circadian clock antagonizes Pfr-mediated signal transduction. Based on these genetic studies, we propose a model for the regulation of CAB2 transcription in which individual photoreceptors and phototransduction components have been assigned to specific pathways for the regulation of discrete kinetic components of the CAB2 expression pattern.

Photophysiology of the Elongated Internode (ein) Mutant of Brassica rapa: ein Mutant Lacks a Detectable Phytochrome B-Like Polypeptide.

Several phytochrome-controlled processes have been examined in etiolated and light-grown seedlings of a normal genotype and the elongated internode (ein/ein) mutant of rapid-cycling Brassica rapa. Although etiolated ein seedlings displayed normal sensitivity to prolonged far-red light with respect to inhibition of hypocotyl elongation, expansion of cotyledons, and synthesis of anthocyanin, they displayed reduced sensitivity to prolonged red light for all three of these deetiolation responses. In contrast to normal seedlings, light-grown ein seedlings did not show a growth promotion in response to end-of-day far-red irradiation. Additionally, whereas the first internode of light-grown normal seedlings showed a marked increase in elongation in response to reduced ratio of red to far-red light, ein seedlings showed only a small elongation response. When blots of protein extracts from etiolated and light-treated ein and normal seedlings were probed with monoclonal antibody to phytochrome A, an immunostaining band at about 120 kD was observed for both extracts. The immunostaining intensity of this band was substantially reduced for extracts of light-treated normal and ein seedlings. A mixture of three monoclonal antibodies directed against phytochrome B from Arabidopsis thaliana immunostained a band at about 120 kD for extracts of etiolated and light-treated normal seedlings. This band was undetectable in extracts of ein seedlings. We propose that ein is a photoreceptor mutant that is deficient in a light-stable phytochrome B-like species.