[Immunotherapy advances for lung cancer combined with chronic obstructive pulmonary disease].

Lung cancer is a major public health problem worldwide, with high rates of morbidity and mortality. It often coexists with chronic obstructive pulmonary disease (COPD), the diagnosis and management of which often receives insufficient attention. In particular, the presence of COPD has significant implications for the clinical management of lung cancer patients. This review systematically assesses the influence of COPD on the efficacy of immunotherapy and the occurrence of immune-related adverse events in patients with lung cancer, identifies existing challenges and proposes avenues for future research in this field.

[Investigate of the etiology and prevention status of liver cirrhosis].

Objective: To investigate the etiology, prevention and treatment status, and their corresponding regional differences of the patients with liver cirrhosis in China, in order to provide scientific basis for the development of diagnosis and control strategies in China. Methods: Clinical data of patients diagnosed with liver cirrhosis for the first time through January 1, 2018 to December 31, 2020 from 50 hospitals in seven different regions of China were collected and analyzed retrospectively, and the difference of etiology, treatment, and their differences in various regions were analyzed. Results: A total of 11 861 cases with liver cirrhosis were included in the study. Thereinto, 5 093 cases (42.94%) were diagnosed as compensated cirrhosis, and 6 768 cases (57.06%) had decompensated cirrhosis. Notably, 8 439 cases (71.15%) were determined as chronic hepatitis B-caused cirrhosis, 1 337 cases (11.27%) were alcoholic liver disease, 963 cases (8.12%) were chronic hepatitis C, 698 cases (5.88%) were autoimmune liver disease, 367 cases (3.09%) were schistosomiasis, 177 cases (1.49%) were nonalcoholic fatty liver, and 743 cases (6.26%) of other types of liver disease. There were significant differences in the incidence of chronic hepatitis B, chronic hepatitis C, alcoholic liver disease, fatty liver, schistosomiasis liver disease, and autoimmune liver disease among the seven regions (P<0.001). Only 1 139 cases (9.60%) underwent endoscopic therapy, thereinto, 718 cases (6.05%) underwent surgical therapy, and 456 cases (3.84%) underwent interventional therapy treatment. In patients with compensated liver cirrhosis, 60 cases (0.51%) underwent non-selective ß receptor blockers(NSBB), including 59 cases (0.50%) underwent propranolol and 1 case (0.01%) underwent carvedilol treatment. In patients with decompensated liver cirrhosis, 310 cases (2.61%) underwent NSBB treatment, including 303 cases (2.55%) underwent propranolol treatment and 7 cases (0.06%) underwent carvedilol treatment. Interestingly, there were significant differences in receiving endoscopic therapy, interventional therapy, NSBB therapy, splenectomy and other surgical treatments among the seven regions (P<0.001). Conclusion: Currently, chronic hepatitis B is the main cause (71.15%) of liver cirrhosis in several regions of China, and alcoholic liver disease has become the second cause (11.27%) of liver cirrhosis in China. The three-level prevention and control of cirrhosis in China should be further strengthened.

Downregulated FGFR3 Expression Inhibits In Vitro Osteogenic Differentiation of Bone Marrow Mesenchymal Stem Cells of Mice with TBXT Gene Mutation.

We studied the effect of fibroblast growth factor receptor 3 (FGFR3) inhibitor BGJ-398 on the differentiation of bone marrow mesenchymal stem cells (BM MSC) into osteoblasts in wild type (wt) mice and in animals with mutation in TBXT gene (mt) and possible differences in the pluripotency of these cells. Cytology tests showed that the cultured BM MSC could differentiate into osteoblasts and adipocytes. The effect of different BGJ-398 concentrations on the expression of FGFR3, RUNX2, SMAD1, SMAD4, SMAD5, SMAD6, SMAD7, and SMAD8 were studied by quantitative reverse transcription PCR. The expression of RUNX2 protein was evaluated by Western blotting. BM MSC of mt and wt mice did not differ in pluripotency and expressed the same membrane marker antigens. BGJ-398 inhibitor reduced the expression of FGFR3 and RUNX2. In BM MSC from mt and wt mice have similar gene expression (and its changing) in FGFR3, RUNX2, SMAD1, SMAD4, SMAD5, SMAD6, SMAD7, and SMAD8 genes. Thus, our experiments confirmed the effect of decreased expression of FGFR3 on osteogenic differentiation of BM MSC from wt and mt mice. However, BM MSC from mt and wt mice did not differ in pluripotency and are an adequate model for laboratory research.

Biological Characteristics and Molecular Mechanisms of Fludioxonil Resistance in Fusarium graminearum in China.

Fusarium graminearum is the primary causal agent of Fusarium head blight (FHB) of wheat. The phenylpyrrole fungicide fludioxonil is not currently registered for the management of FHB in China. The current study assessed the fludioxonil sensitivity of a total of 53 F. graminearum isolates collected from the six most important wheat-growing provinces of China during 2018 and 2019. The baseline fludioxonil sensitivity distribution indicated that all of the isolates were sensitive, exhibiting a unimodal cure with a mean effective concentration for 50% inhibition value of 0.13 ± 0.12 µg/ml (standard deviation). Five fludioxonil-resistant mutants were subsequently induced by exposure to fludioxonil under laboratory conditions. Ten successive rounds of subculture in the absence of the selection pressure indicated that the mutation was stably inherited. However, the fludioxonil-resistant mutants were found to have reduced pathogenicity, higher glycerol accumulation, and higher osmotic sensitivity than the parental wild-type isolates, indicating that there was a fitness cost associated with fludioxonil resistance. In addition, the study also found a positive cross resistance between fludioxonil, procymidone, and iprodione, but not with other fungicides such as boscalid, carbendazim, tebuconazole, and fluazinam. Sequence analysis of four candidate target genes (FgOs1, FgOs2, FgOs4, and FgOs5) revealed that the HBXT2R mutant contained two point mutations that resulted in amino acid changes at K223T and K415R in its FgOs1 protein, and one point mutation at residue 520 of its FgOs5 protein that resulted in a premature stop codon. Similarly, the three other mutants contained point mutations that resulted in changes at the K192R, K293R, and K411R residues of the FgOs5 protein but none in the FgOs2 and FgOs4 genes. However, it is important to point out that the FgOs2 and FgOs4 expression of all the fludioxonil-resistant mutants was significantly (P < 0.05) downregulated compared with the sensitive isolates (except for the SQ1-2 isolate). It was also found that one of the resistant mutants did not have changes in any of the sequenced target genes, indicating that an alternative mechanism could also lead to fludioxonil resistance.

[Effect of adipose-derived mesenchymal stem cells and liraglutide on acute lung injury].

Objective: To explore the protective effect of human adipose-derived mesenchymal stem cells (AD-MSCs) and liraglutide on lipopolysaccharide (LPS) -induced acute lung injury (ALI) . Methods: AD-MSCs were cultured in vitro and randomly divided into 3 groups: control group, LPS group (30 mg/L) , and LPS (30 mg/L) +liraglutide (10 nM) group. MTT assay was used to detect the proliferation of AD-MSCs at 6, 24, 48 and 72 h. Annexin V-FITC / PI double staining flow cytometry was used to detect the apoptosis of the cells. Western blot was used to detect the expression of apoptotic proteins cleaved caspase-3, Bax and Bcl-2 at 72 h in vitro. For the in vivo experiment, 60 male SPF BALB/c mice were randomly divided into 5 groups: control group, ALI group, ALI+AD-MSCs group, ALI+Liraglutide group, and ALI+AD-MSCs+Lraglutide group. The mice were sacrificed on day 2 and day 7 after LPS treatment. HE staining was used to examine the pathological changes of the lungs of mice, and the scores of lung injury were measured. The lung tissues of mice were examined by immunohistochemistry, and the expression of the marker protein Nanog of mesenchymal stem cells was observed. BALF was collected, and the number of BALF neutrophils was counted by Rayleigh Giemsa staining. The wet/dry specific gravity of mouse lung tissue was recorded. Results: The apoptosis of AD-MSCs stimulated by LPS was significantly higher than that of the control group (P<0.05) , and the proliferation of AD-MSCs at 6, 24, 48 and 72 h was significantly lower than that of the control group (all P<0.05) . The addition of Liraglutide reduced the apoptosis of AD-MSCs (P<0.05) , and promoted the proliferation of AD-MSC at 6, 24, 48 and 72 h. Compared with the control group, in the 2 d and 7 d model groups, the lung injury pathology of ALI group had lung injury, increased number of neutrophils in BALF (65.63±1.34 vs 1.74±0.17, 51.67±1.35 vs 1.55±0.13) ×10(4)/ml (all P<0.05) , and increased W/D of lung tissues. The expression level of Nanog protein was low in the 7 d model group. Compared with the ALI group, in 2 d and 7 d model groups, the ALI+AD-MSCs group, the ALI+liraglutide group, and the ALI+AD-MSCs+liraglutide group showed reduced lung injury pathology, and the number of neutrophils was decreased, (37.04±1.23, 29.17±0.68) ×10(4) / ml (all P<0.05) in the ALI+AD -MSCs group, (39.58±1.67, 35.42±0.25) ×10(4) / ml in the ALI+Liraglutide group (all P<0.05) and (28.54±0.37, 21.46±0.89) ×10(4)/ml (all P<0.05) in the ALI+AD-MSCs+Liraglutide group. Lung tissue W/D in the ALI+AD-MSCs group, ALI+Liraglutide group and ALI+AD-MSCs+Liraglutide group showed the same trend. Nanog protein expression increased in the 7 d model group. Conclusions: AD-MSCs play a protective role in acute lung injury in mice under the synergistic effect of liraglutide.

[Clinical manifestations analysis of patients diagnosed with primary pulmonary mucosa-associated lymphoid tissue lymphoma].

Objective: To analyze the clinical features of pulmonary mucosa-associated lymphoid tissue (MALT) lymphoma. Methods: A total of 14 cases diagnosed with primary pulmonary MALT lymphoma were collected from May 2007 to May 2017 in Zhongshan Hospital, Fudan University. The clinical features, pathological characteristics, diagnosis, treatment and prognosis were retrospectively analyzed. Results: All 14 cases were pathologically diagnosed with primary pulmonary MALT lymphoma. The biopsy tissues were obtained through the Video-assisted Thoracoscopic Surgery (VATS) (4 cases), percutaneous puncture (2 cases), and bronchoscopy (8 cases). Cell types of these tumors were centrocyte-like cells (10 cases), lymphocytoid cells (2 cases), and monocytoid B cells (2 cases). The B cell clonality was detected by IgH cloning test in 4 cases and 3 of them were demonstrated with monoclonal strips. MALT1 breakup gene was positive in 3 out of 6 examined cases using fluorescence in situ hybridization (FISH). As for the treatment, 8 patients underwent chemotherapy, 5 patients underwent surgical resection and 1 patient abandoned treatment. Twelve patients were followed up to 9 years. The tumor recurrence occurred in 2 patients and resulted their death. Conclusions: The clinical manifestations of primary pulmonary MALT lymphoma are lack of specificity. The pathology, immunohistochemistry, IgH cloning test and MALT1 breakup gene tested by FISH are the criteria for diagnosis.

Ghrelin level negatively predicts quality of life in obese women.

A cross-sectional cohort study was conducted to investigate whether ghrelin level in obese women predicts the quality of life (QOL). A total of 307 subjects fulfilled the criteria: (1) age between 20 and 65 years old, (2) body mass index ≥27 kg/m2 (3) waist circumference ≥80 cm were enrolled in the study. All subjects were assigned to one of the plasma ghrelin level categories according to the quartiles. The median of age and BMI of the 307 obese women were 45 ± 18 years and 29.9 ± 4.1 kg/m2, respectively. The main outcome evaluated is the associations of plasma ghrelin level and QOL, which were evaluated using multiple linear regression analysis. Results of linear trend test show significant statistical difference in plasma lipoproteins (triglyceride, cholesterol, HDL-cholestero and LDL-cholesterol = and levels of obesity-related hormone peptides, including leptin, adiponectin, insulin among quartiles of ghrelin. Multiple liner regression analysis of serum obesity-related hormone peptide level and QOL using stepwise method shows ghrelin concentration was the only predictor of QOL, including PCS-12 level (ß = -0.18, p = 0.001), MCS-12 level (ß = -0.14, p = 0.009), WHOQOL-BREF scores: physical (ß = -0.13, p = 0.03), psychological (ß = -0.16, p = 0.007), social (ß = -0.21, p =  < 0.001), and environmental (ß = -0.22, p =  <0.001), after adjusting other factors for obese female subjects. This study demonstrated that ghrelin concentration is strongly associated with QOL level among obese women. Hence, ghrelin concentration might be a valuable marker to be monitored in obese women.

[Preoperative dynamic contrast-enhanced MRI can reduce the rate of tumor-positive resection margins after breast conserving surgery in patients with early non-mass breast carcinoma].

Objective: To investigate the value of preoperative dynamic contrast-enhanced MRI in reducing the rate of tumor-positive resection margins after breast conserving surgery in patients with early non-mass breast carcinoma. Methods: Seventy-two patients with early non-mass breast carcinoma received ultrasonographic and mammographic examination and subsequently underwent dynamic contrast-enhanced MRI examination before breast conserving surgery. The control group consisted of 74 patients who had early non-mass breast carcinoma. They only received ultrasonographic and mammographic examination and didn't undergo contrast-enhanced MRI examination. The comparison of the rate of tumor-positive resection margins between two groups was performed. The MRI findings that had the significant influence on the rate of tumor-positive resection margins were analyzed using Logistic regression model. Results: In 28 patients (28/72, 38.9%), dynamic contrast-enhanced MRI could correct or supplement the ultrasonographic and mammographic findings and resulted in the reasonable change of surgical program. The preoperative MRI examination group (n=30) had lower rate of tumor-positive resection margins than control group for invasive ductal carcinoma (23.3% vs 40.0%, P=0.02), but there was no significant difference (21.4% vs 26.9%, P=0.10) between two groups for ductal carcinoma in situ (n=28). The preoperative MRI examination group (n=14) had lower rate of tumor-positive resection margins than control group for the other pathologic types of breast carcinoma (14.3% vs 38.9%, P=0.02). The statistical analysis on the basis of Logistic regression model showed that some main MRI findings, including change surrounding the tumor, distance between tumor and nipple and tumor size, had the significant influence on the rate of tumor-positive resection margins. Conclusion: Preoperative dynamic contrast-enhanced MRI significantly increased the accuracy of resection margins evaluation, and greatly reduced the rate of tumor-positive resection margins after breast conserving surgery in patients with early non-mass breast carcinoma.

CYP1A2-163C/A (rs762551) polymorphism and bladder cancer risk: a case-control study.

To date, no study has investigated the association between CYP1A2-163C/A polymorphism and bladder cancer risk in a Chinese population. Here, we extracted genomic DNA from peripheral white blood cells, and differentiated CYP1A2 alleles by polymerase chain reaction-based restriction fragment length polymorphism methods. Differences in genotype frequencies between the cases and controls were evaluated using a chi-square test. The odds ratio (OR) and its 95% confidence interval (CI) were calculated using an unconditional logistic regression model. This revealed that the -163A allele was present at a significantly increased frequency in bladder cancer patients compared to healthy controls (44.10 vs 22.25%, P < 0.001). The prevalence of CC genotype, CA genotype, and AA genotype was 34.91, 41.98, and 23.11% in bladder cancer patients, and 64.00, 27.50, and 8.5% in the controls, respectively. Therefore, significant differences in the frequencies of -163 genotypes were found between bladder cancer patients and controls (P < 0.001). We found that the AA genotype was significantly associated with increased bladder cancer risk (OR = 3.72; 95%CI = 1.55-7.16; P = 0.02), and the -163A carriers were at increased risk of bladder cancer in a multivariate COX regression model (OR = 4.89, 95%CI = 2.78-10.87, P = 0.01). We conclude that the CYP1A2-163C/A polymorphism is associated with increased susceptibility to bladder cancer in the Chinese population.

Diagnostic and Treatment Monitoring Potential of Serum Vascular Endothelial Growth Factor-D in Lymphangioleiomyomatosis.

Lymphangioleiomyomatosis (LAM) is a rare multisystem disease occurring almost exclusively in premenopausal women and characterized by cystic lung destruction, abdominal tumors (renal angiomyolipomas (AML)), and involvement of the axial lymphatics (adenopathy, lymphangioleiomyomas). Serum vascular endothelial growth factor-D (VEGF-D), a lymphangiogenic factor, has been recently considered as a novel marker for LAM. Herein we report the diagnostic and differential diagnostic value of serum VEGF-D in LAM patients and evaluate the change of serum VEGF-D levels before and after treatment with sirolimus. The study group included 66 patients with LAM (47 definite LAM and 19 probable LAM based on European Respiratory Society guidelines), 14 patients with other polycystic lung diseases, and 20 healthy female controls. Serum VEGF-D levels were quantified by enzyme-linked immunoassay (ELISA). Serum VEGF-D levels were significantly increased in definite LAM patients compared with healthy controls (3890.3±373.3 pg/ml vs. 413.3±33.2 pg/ml, p<0.05). The optimal cutoff point for LAM diagnosis was 692.5 pg/ml with sensitivity of 97.9% and specificity of 100%. In probable LAM patients, serum VEGF-D levels were all greater than 692.5 pg/ml. Serum VEGF-D levels were significantly increased in definite LAM patients who had chylothorax compared with those without chylothorax (5153.9±598.3 pg/ml vs. 2869.8±372.8 pg/ml, p<0.05). But serum VEGF-D levels in LAM patients with/without pneumothorax, AML, and lymphangioleiomyomas were not significantly changed. Serum VEGF-D levels in definite LAM patients and patients with other cystic lung diseases were 3890.3±373.3 pg/ml and 412.6±27.5 pg/ml, respectively (p <0.05). We determined an optimal cutoff value of 688.5pg/ml, resulting in sensitivity of 97.9% and specificity of 100%. Following a median of 12-month treatment with sirolimus, serum VEGF-D levels decreased from 3135.0±909.4 pg/ml to 1731.8±621.2 pg/ml and symptoms improved. Our study found that serum VEGF-D levels were significantly higher in LAM patients compared with healthy controls and patients with other polycystic lung diseases and that the levels were further increased when complicated by chylothorax. Serum VEGF-D levels may be useful for diagnosis and differential diagnosis with high specificity and sensitivity as well as for following treatment response with sirolimus.

Molecular cloning and characterization of a proliferating cell nuclear antigen gene by chemically induced male sterility in wheat (Triticum aestivum L.).

Although a number of studies have shown that chemical hybridizing agents (CHAs) affect anther growth and regulate cell-cycle progression, little is known about the molecular and cellular mechanisms involved. Proliferating cell nuclear antigen (PCNA) is an essential factor in DNA replication, and in many other processes in eukaryotic cells. In this study, the open reading frame of TaPCNA, the PCNA in wheat (Triticum aestivum L.), was cloned by reverse transcription polymerase chain reaction (RT-PCR). Sequence analysis revealed that this gene was 792-bp long and encoded a protein with 234 amino acids. Alignment of the TaPCNA-predicted sequence revealed a high degree of identity with PCNAs from other plant species. A subcellular localization assay indicated that TaPCNA was localized in the nucleus. The TaPCNA was cloned into the prokaryotic expression plasmid pET32a, and the recombinant plasmid was transformed into BL21 (DE3). TaPCNA expression was induced by 0.5 mM isopropyl-beta-D-thiogalactopyranoside and verified using sodium dodecyl sulfate polyacrylamide gel electrophoresis and western blot assays, which indicated that the fusion protein was successfully expressed. The gene involved in the G1-to-S transition, Histone H4, was downregulated by 1376- CIMS, which is a chemically induced male sterility line. However, a semi-quantitative RT-PCR revealed that TaPCNA expression was upregulated in 1376-CIMS. Our results suggest that CHAs (SQ-1) induce DNA damage in wheat anthers. DNA damage results in either the delay or arrest of cell-cycle progression, which affects anther development. This study will help to elucidate the mechanisms of SQ-1-induced male sterility.

First Report of Fusarium pseudograminearum from Wheat Heads with Fusarium Head Blight in North China Plain.

Wheat (Triticum aestivum L.), the most widely grown winter cereal crop in China, was grown on 24.3 million hectares in 2012. There was an outbreak of Fusarium head blight in 2012, and it was prevalent in 2013 in North China Plain, the largest area producing winter wheat in China. In 2013, a total of 213 Fusarium graminearum-like isolates were collected from diseased wheat heads in 33 fields in 17 counties in Henan province. The pathogen was isolated from the base of Fusarium-damaged spikelets on potato dextrose agar (PDA) after being surface-sterilized (70% EtOH for 30 s and 3% NaClO for 1.5 min) and rinsed three times in sterilized distilled water. After 3 days, the mycelia were transferred to fresh PDA and purified by the single-spore isolation method. Species were identified based on morphological characteristics (2), and sequence analysis of the translation elongation factor-1α (TEF) and trichothecene 3-O-acetyltransferase (Tri 101) gene (3). The results indicated that F. graminearum species complex (97.2%) is the main causal agent of Fusarium head blight in this region. However, four strains (2%) from the two fields in Jiao Zuo and Xin Xiang counties were found to be identical to F. pseudograminearum. The four (13JZ3-1, 13JZ3-2, 13XX1-2, and 13XX1-6) isolates of F. pseudograminearum were transferred onto carnation leaf agar (CLA) and incubated at 20°C under black light blue illumination. On CLA, macroconidia were abundant, relatively slender, curved to almost straight, commonly six- to seven-septate, and averaged 49.7 × 5.0 µm. Microconidia were not observed. Chlamydospores were observed after 4 weeks. The fungus was initially identified as F. graminearum on the basis of morphology of the asexual stage (2). However, the TEF sequences (Accession nos. KJ863322 to KJ863325) showed 99 to 100% similarity with several F. pseudograminearum sequences (e.g., AF212468, AF212469, and AF212470); the Tri 101 sequences (KJ863326 to KJ863329) showed 99 to 100% similarity with accession nos. AF212615 and AF212616 of F. pseudograminearum. The identification was further confirmed by the F. pseudograminearum species-specific PCR primers (Fp1-1: CGGGGTAGTTTCACATTTCCG and Fp1-2: GAGAATGTGATGACGACAATA) (1). To complete Koch's postulates, the pathogenicity of the fungus was tested by spraying five healthy inflorescences (average of 19 spikelets per spike) of wheat cultivar Zhoumai 18 with a 5-ml suspension (5 × 104 conidia per milliliter). Another five healthy inflorescences were sprayed with sterile distilled water. Plants were placed in a growth chamber with a 12-h photoperiod at 22°C, covered with polyethylene bags that were removed after 2 days. Seven days later, while control inflorescences were asymptomatic, inoculated inflorescences showed a mean of 10 bleached spikelets per spike. By using the methodology described above, the fungus was re-isolated from infected spikelets of inoculated wheat heads but not from the controls. To our knowledge, this is the first report of F. pseudograminearum from diseased wheat heads in China. Further investigation is needed to gain a better understanding of the spatial and temporal dynamics of this new pathogen. References: (1) T. Aoki and K. O'Donnell. Mycologia 91:597, 1999. (2) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Oxford, UK, 2006. (3) R. H. Proctor et al. Mol. Microbiol. 74:1128, 2009.

[Recognition on dentin dysplasia type â ¡].

Dentin dysplasia type Ⅱ (DD-Ⅱ) is a subtype of hereditary dentin disorders. The dentin sialophosphoprotein (DSPP) gene has been revealed to be the causative gene, whose mutations could affect the normal tooth development process. The lesions involve both deciduous and permanent dentition, mainly manifested as tooth discoloration, attrition and even the subsequent malocclusion. If not treated in time, it will significantly affect the physical and psychological health of patients. The disease is difficult to be diagnosed in clinic accurately as its low incidence and hidden manifestations. The present article aims to discuss the clinical and radiographic characteristics, diagnosis, treatment of DD-Ⅱ, in order to improve the overall understanding on DD-Ⅱ for clinicians.

[Effects of circadian rhythm on the development of dental hard tissues].

Circadian rhythm is regulated by circadian clock, which is formed by the body response to external cyclic stimuli through the endogenous circadian clock. Circadian rhythm disturbance is closely related to the risks of a variety of diseases, and its impact on oral health cannot be ignored. Exploring the relationship and related molecular mechanism between circadian rhythm and dental hard tissues development are helpful to deeply understand the pathogenesis of developmental defects on these tissues, which could provide a theoretical basis for prevention and treatment on disorders of dental hard tissues. In order to provide guidance for the disease prevention and treatment, based on the summarization of current research progress, this paper focuses on the involvement of biorhythm in the development of tooth hard tissues as well as the disturbance of circadian rhythm on the formation of enamel and dentin, and analyzes the related regulating mechanism of circadian rhythm and genes during the development of tooth hard tissues.

[Expert consensus on the biobank development of oral genetic diseases and rare diseases and storage codes of related biological samples from craniofacial and oral region].

The biological samples of oral genetic diseases and rare diseases are extremely precious. Collecting and preserving these biological samples are helpful to elucidate the mechanisms and improve the level of diagnose and treatment of oral genetic diseases and rare diseases. The standardized construction of biobanks for oral genetic diseases and rare diseases is important for achieving these goals. At present, there is very little information on the construction of these biobanks, and the standards or suggestions for the classification and coding of biological samples from oral and maxillofacial sources, and this is not conducive to the standardization and information construction of biobanks for special oral diseases. This consensus summarizes the background, necessity, principles, and key points of constructing the biobank for oral genetic diseases and rare diseases. On the base of the group standard "Classification and Coding for Human Biomaterial" (GB/T 39768-2021) issued by the National Technical Committee for Standardization of Biological Samples, we suggest 76 new coding numbers for different of biological samples from oral and maxillofacial sources. We hope the consensus may promote the standardization, and smartization on the biobank construction as well as the overall research level of oral genetic diseases and rare diseases in China.

Molecular characterization of amelogenesis imperfecta in Chinese patients.

BACKGROUND: Mutations in 6 genes have been identified as being part of the etiology of amelogenesis imperfecta (AI) with various phenotypes in an isolated condition. Among them the FAM83H gene is the major contributor to the etiology of AI with unknown function. OBJECTIVE: This study aims to determine the phenotypic and molecular characterization of Chinese AI patients and to analyze the structure and function of the FAM83H protein. METHODS: We enrolled 6 hypocalcified AI and 3 hypoplastic AI families from the Chinese population. Mutation analysis was performed by amplifying and sequencing all exons including intron-exon borders for FAM83H and ENAM genes. Structural modeling and function analysis on the FAM83H protein were carried out by bioinformatic processing. RESULTS: No obvious anterior open bite was observed in all the investigated individuals. Five mutations (c.906T>G, c.924dupT, c.973C>T, c.1354C>T and c.2029C>T) in the C-terminal of the FAM83H gene were revealed, respectively, in 5 out of 6 hypocalcified AI families, and a splicing mutation c.534 + 1G>A in the ENAM gene was identified in 1 out of 3 hypoplastic AI families. Structural models of the N- and C-terminal regions of FAM83H were generated by homology modeling. The predicted structure of the FAM83H N-terminal shows resemblance to that of glycosyltransferases with GT-A folds, and the predicted structure of the FAM83H C-terminal possesses similarity to type I collagen protein. CONCLUSIONS: To our knowledge, this is the first report of AI with specific molecular variations in families of Chinese descent. Our study provides new insights into the structure and function of the FAM83H protein.

Stereoselective metabolism of (±)-praeruptorin A, a calcium channel blocker from Peucedani Radix, in pooled liver microsomes of rats and humans.

(±)-Praeruptorin A (PA) is the major component of Peucedani Radix. The present study investigated stereoselectivity in PA metabolism in liver microsomes of rats (RLMs) and humans (HLMs), for the first time. PA was enantioseparated by semi-preparative chiral HPLC. Metabolic profiles of the dextrorotatory (dPA) and the levorotatory (lPA) forms in HLMs and RLMs were determined using LC-MS/MS. (-)-cis-Khellactone (D1) prepared from basic hydrolysis of dPA, and (3'R, 4'R)-4'-angeloyl-khellactone (L8) and (3'R, 4'R)-3'-angeloyl-khellactone (L9) isolated from a scale-up incubation of lPA with rat plasma were unambiguously identified by LC-MS/MS and NMR analysis. Other metabolites were tentatively identified using LC-MS/MS. In the absence of NADPH-regenerating system, dPA remained intact, however, lPA yielded L8 and L9 via a carboxylesterase(s)-mediated process. In the presence of NADPH-regenerating system, lPA produced 9 (L1-9) metabolites in both species, while dPA generated 12 (D1-12) and 6 (D1-3, 6, 9 and 10) metabolites in RLMs and HLMs, respectively. Hydrolysis, oxidation and acyl migration were demonstrated to be the predominant pathways for both enantiomers. Both enantiomers were eliminated faster in RLMs than in HLMs, while lPA showed greater species difference. PA enantiomers exhibited stereoselective metabolism in RLMs and HLMs, implying chiral discrimination in their actions.

Ipr1 gene mediates RAW 264.7 macrophage cell line resistance to Mycobacterium bovis.

Tuberculosis caused by Mycobacterium bovis (M. bovis) seriously affects efficiency of animal production with impacts on public health as well. Effective programmes of prevention and eradication of M. bovis infection therefore are urgently needed. Intracellular pathogen resistance gene 1 (Ipr1) is well known to mediate innate immunity to Mycobacterium tuberculosis (MTB), but there are no reports as to whether Ipr1 can enhance the phagocytic ability of macrophage against M. bovis. In this investigation, RAW 264.7 macrophage was transduced with lentiviral vector carrying Ipr1 (named Lenti-Ipr1); transgenic cells were identified by RT-PCR and western blotting. Transgenic positive cells (R-Ipr1) were then infected with an M. bovis virulent strain, with non-transduced cells used as control. When cell proliferation, viability and apoptosis of the two groups were investigated, it was found that infected RAW 264.7 died by necrosis whereas R-Ipr1 underwent apoptosis. Furthermore, the numbers of intracellular bacteria in R-Ipr1 were lower than those in control cells (P < 0.05). To identify the role of Ipr1, we measured the genes of Casp3, Mcl-1 and NOS2A which associated with macrophage activation and apoptosis by real-time quantitative PCR. The results demonstrated that Ipr1 gene expression can enhance anti-M. bovis infection of macrophage. This establishes a basis for the future production of Ipr1-transgenic cattle to strengthen the tuberculosis resistance.