RESUMO
Kupffer cells, the liver tissue resident macrophages, are critical in the detection and clearance of cancer cells. However, the molecular mechanisms underlying their detection and phagocytosis of cancer cells are still unclear. Using in vivo genome-wide CRISPR-Cas9 knockout screening, we found that the cell-surface transmembrane protein ERMAP expressed on various cancer cells signaled to activate phagocytosis in Kupffer cells and to control of liver metastasis. ERMAP interacted with ß-galactoside binding lectin galectin-9 expressed on the surface of Kupffer cells in a manner dependent on glycosylation. Galectin-9 formed a bridging complex with ERMAP and the transmembrane receptor dectin-2, expressed on Kupffer cells, to induce the detection and phagocytosis of cancer cells by Kupffer cells. Patients with low expression of ERMAP on tumors had more liver metastases. Thus, our study identified the ERMAP-galectin-9-dectin-2 axis as an 'eat me' signal for Kupffer cells.
Assuntos
Citofagocitose , Células de Kupffer , Humanos , Fagocitose/genética , Galectinas/genética , Galectinas/metabolismo , Proteínas de Membrana/genética , Proteínas de Membrana/metabolismoRESUMO
We have reported previously that during hypoxia exposure, the expression of mature miR-17â¼92 was first upregulated and then downregulated in pulmonary artery smooth muscle cells (PASMC) and in mouse lungs in vitro and in vivo. Here, we investigated the mechanisms regulating this biphasic expression of miR-17â¼92 in PASMC in hypoxia. We measured the level of primary miR-17â¼92 in PASMC during hypoxia exposure and found that short-term hypoxia exposure (3% O2, 6 h) induced the level of primary miR-17â¼92, whereas long-term hypoxia exposure (3% O2, 24 h) decreased its level, suggesting a biphasic regulation of miR-17â¼92 expression at the transcriptional level. We found that short-term hypoxia-induced upregulation of miR-17â¼92 was hypoxia-inducible factor 1α (HIF1α) and E2F1 dependent. Two HIF1α binding sites on miR-17â¼92 promoter were identified. We also found that long-term hypoxia-induced suppression of miR-17â¼92 expression could be restored by silencing of p53. Mutation of the p53-binding sites in the miR-17â¼92 promoter increased miR-17â¼92 promoter activity in both normoxia and hypoxia. Our findings suggest that the biphasic transcriptional regulation of miR-17â¼92 during hypoxia is controlled by HIF1/E2F1 and p53 in PASMC: during short-term hypoxia exposure, stabilization of HIF1 and induction of E2F1 induce the transcription of miR-17â¼92, whereas during long-term hypoxia exposure, hyperphosphorylation of p53 suppresses the expression of miR-17â¼92.NEW & NOTEWORTHY We showed that the biphasic transcriptional regulation of miR-17â¼92 during hypoxia is controlled by two distinct mechanisms: during short-term hypoxia exposure, induction of HIF1 and E2F1 upregulates miR-17â¼92. Longer hypoxia exposure induces hyperphosphorylation of p53 at ser15, which leads to its binding to miR-17â¼92 promoter and inhibition of its expression. Our findings provide novel insights into the spatiotemporal regulation of miR-17â¼92 that may play a role in the development of human lung diseases including pulmonary hypertension (PH).
Assuntos
Fator de Transcrição E2F1 , Subunidade alfa do Fator 1 Induzível por Hipóxia , MicroRNAs , Artéria Pulmonar , Proteína Supressora de Tumor p53 , MicroRNAs/genética , MicroRNAs/metabolismo , Proteína Supressora de Tumor p53/metabolismo , Proteína Supressora de Tumor p53/genética , Subunidade alfa do Fator 1 Induzível por Hipóxia/metabolismo , Subunidade alfa do Fator 1 Induzível por Hipóxia/genética , Fosforilação , Humanos , Animais , Fator de Transcrição E2F1/metabolismo , Fator de Transcrição E2F1/genética , Artéria Pulmonar/metabolismo , Artéria Pulmonar/patologia , Transcrição Gênica , Hipóxia Celular/genética , Miócitos de Músculo Liso/metabolismo , Regiões Promotoras Genéticas/genética , Camundongos , Hipóxia/metabolismo , Hipóxia/genética , Serina/metabolismo , Regulação da Expressão Gênica , Células CultivadasRESUMO
BACKGROUND: The molecular mechanisms driving hepatocellular carcinoma (HCC) remain largely unclear. As one of the major epitranscriptomic modifications, N6-methyladenosine (m6A) plays key roles in HCC. The aim of this study was to investigate the expression, roles, and mechanisms of action of the RNA methyltransferase methyltransferase-like protein 16 (METTL16) in HCC. METHODS: The expression of METTL16 and RAB11B-AS1 was determined by RT-qPCR. The regulation of RAB11B-AS1 by METTL16 was investigated by RNA immunoprecipitation (RIP), methylated RIP (MeRIP), and RNA stability assays. In vitro and in vivo gain- and loss-of-function assays were performed to investigate the roles of METTL16 and RAB11B-AS1. RESULTS: METTL16 was upregulated in HCC, and its increased expression was correlated with poor prognosis of HCC patients. METTL16 promoted HCC cellular proliferation, migration, and invasion, repressed HCC cellular apoptosis, and promoted HCC tumoral growth in vivo. METTL16 directly bound long noncoding RNA (lncRNA) RAB11B-AS1, induced m6A modification of RAB11B-AS1, and decreased the stability of RAB11B-AS1 transcript, leading to the downregulation of RAB11B-AS1. Conversely to METTL16, RAB11B-AS1 is downregulated in HCC, and its decreased expression was correlated with poor prognosis of patients with HCC. Furthermore, the expression of RAB11B-AS1 was negatively correlated with METTL16 in HCC tissues. RAB11B-AS1 repressed HCC cellular proliferation, migration, and invasion, promoted HCC cellular apoptosis, and inhibited HCC tumoral growth in vivo. Functional rescue assays revealed that overexpression of RAB11B-AS1 reversed the oncogenic roles of METTL16 in HCC. CONCLUSIONS: This study identified the METTL16/RAB11B-AS1 regulatory axis in HCC, which represented novel targets for HCC prognosis and treatment.
Assuntos
Carcinoma Hepatocelular , Regulação Neoplásica da Expressão Gênica , Metiltransferases , MicroRNAs , RNA Longo não Codificante , Carcinoma Hepatocelular/genética , Carcinoma Hepatocelular/patologia , Linhagem Celular Tumoral , Proliferação de Células/genética , Regulação Neoplásica da Expressão Gênica/genética , Humanos , Neoplasias Hepáticas/genética , Neoplasias Hepáticas/patologia , Metiltransferases/genética , Metiltransferases/metabolismo , MicroRNAs/genética , MicroRNAs/metabolismo , RNA Longo não Codificante/genética , RNA Longo não Codificante/metabolismoRESUMO
BACKGROUND: Many molecular alterations are shared by embryonic liver development and hepatocellular carcinoma (HCC). Identifying the common molecular events would provide a novel prognostic biomarker and therapeutic target for HCC. METHODS: Expression levels and clinical relevancies of SLC38A4 and HMGCS2 were investigated by qRT-PCR, western blot, TCGA and GEO datasets. The biological roles of SLC38A4 were investigated by functional assays. The downstream signalling pathway of SLC38A4 was investigated by qRT-PCR, western blot, immunofluorescence, luciferase reporter assay, TCGA and GEO datasets. RESULTS: SLC38A4 silencing was identified as an oncofetal molecular event. DNA hypermethylation contributed to the downregulations of Slc38a4/SLC38A4 in the foetal liver and HCC. Low expression of SLC38A4 was associated with poor prognosis of HCC patients. Functional assays demonstrated that SLC38A4 depletion promoted HCC cellular proliferation, stemness and migration, and inhibited HCC cellular apoptosis in vitro, and further repressed HCC tumorigenesis in vivo. HMGCS2 was identified as a critical downstream target of SLC38A4. SLC38A4 increased HMGCS2 expression via upregulating AXIN1 and repressing Wnt/ß-catenin/MYC axis. Functional rescue assays showed that HMGCS2 overexpression reversed the oncogenic roles of SLC38A4 depletion in HCC. CONCLUSIONS: SLC38A4 downregulation was identified as a novel oncofetal event, and SLC38A4 was identified as a novel tumour suppressor in HCC.
Assuntos
Sistema A de Transporte de Aminoácidos/genética , Sistema A de Transporte de Aminoácidos/metabolismo , Carcinoma Hepatocelular/patologia , Regulação para Baixo , Hidroximetilglutaril-CoA Sintase/metabolismo , Neoplasias Hepáticas/patologia , Fígado/embriologia , Animais , Biomarcadores Tumorais/genética , Biomarcadores Tumorais/metabolismo , Carcinoma Hepatocelular/genética , Carcinoma Hepatocelular/metabolismo , Linhagem Celular Tumoral , Regulação Neoplásica da Expressão Gênica , Humanos , Fígado/metabolismo , Neoplasias Hepáticas/genética , Neoplasias Hepáticas/metabolismo , Masculino , Camundongos , Transplante de Neoplasias , Prognóstico , Proteínas Proto-Oncogênicas c-myc/metabolismo , Via de Sinalização WntRESUMO
Recently, long noncoding RNAs (lncRNAs) were found to be dysregulated in a variety of tumors. However, it remains unknown how and through what molecular mechanisms the expression of lncRNAs is controlled. In this study, we found that the lncRNA Low Expression in Tumor (lncRNA-LET) was generally downregulated in hepatocellular carcinomas, colorectal cancers, and squamous-cell lung carcinomas. We demonstrated that hypoxia-induced histone deacetylase 3 repressed lncRNA-LET by reducing the histone acetylation-mediated modulation of the lncRNA-LET promoter region. Interestingly, the downregulation of lncRNA-LET was found to be a key step in the stabilization of nuclear factor 90 protein, which leads to hypoxia-induced cancer cell invasion. Moreover, the relationship among hypoxia, histone acetylation disorder, low lncRNA-LET expression level, and metastasis was found in clinical hepatocellular carcinoma samples. These results advance our understanding of the role of lncRNA-LET as a regulator of hypoxia signaling and offer new avenues for therapeutic intervention against cancer progression.
Assuntos
Carcinoma Hepatocelular/secundário , Regulação Neoplásica da Expressão Gênica , Histona Desacetilases/fisiologia , Neoplasias Hepáticas/patologia , Neoplasias Pulmonares/secundário , RNA Longo não Codificante/genética , Acetilação , Animais , Sequência de Bases , Carcinoma Hepatocelular/enzimologia , Carcinoma Hepatocelular/genética , Hipóxia Celular , Linhagem Celular Tumoral , Movimento Celular , Regulação para Baixo , Feminino , Expressão Gênica , Histonas/metabolismo , Humanos , Neoplasias Hepáticas/enzimologia , Neoplasias Hepáticas/genética , Neoplasias Pulmonares/enzimologia , Neoplasias Pulmonares/genética , Masculino , Camundongos , Camundongos Nus , Pessoa de Meia-Idade , Dados de Sequência Molecular , Transplante de Neoplasias , Proteínas do Fator Nuclear 90/genética , Proteínas do Fator Nuclear 90/metabolismo , Processamento de Proteína Pós-Traducional , RNA Longo não Codificante/metabolismoRESUMO
To explore whether plasma circular RNAs (circRNAs) can diagnose hepatitis B virus (HBV)-related hepatocellular carcinoma (HCC), microarray and qPCR were used to identify plasma circRNAs that were increased in HBV-related HCC patients compared to controls (including healthy controls, chronic hepatitis B and HBV-related liver cirrhosis). A logistic regression model was constructed using a training set (n = 313) and then validated using another two independent sets (n = 306 and 526, respectively). Area under the receiver operating characteristic curve (AUC) was used to evaluate diagnostic accuracy. We identified a plasma circRNA panel (CircPanel) containing three circRNAs (hsa_circ_0000976, hsa_circ_0007750 and hsa_circ_0139897) that could detect HCC. CircPanel showed a higher accuracy than AFP (alpha-fetoprotein) to distinguish individuals with HCC from controls in all three sets (AUC, 0.863 [95% confidence interval, CI: 0.819-0.907] vs. 0.790 [0.738-0.842], p = 0.036 in training set; 0.843 [0.796-0.890] vs. 0.747 [0.691-0.804], p = 0.011 in validation set 1 and 0.864 [0.830-0.898] vs. 0.769 [0.728-0.810], p < 0.001 in validation set 2). CircPanel also performed well in detecting Small-HCC (solitary, ≤3 cm), AFP-negative HCC and AFP-negative Small-HCC.
Assuntos
Carcinoma Hepatocelular/diagnóstico , Carcinoma Hepatocelular/etiologia , Vírus da Hepatite B , Hepatite B/complicações , Neoplasias Hepáticas/diagnóstico , Neoplasias Hepáticas/etiologia , RNA Circular/sangue , Biomarcadores Tumorais , Feminino , Perfilação da Expressão Gênica , Hepatite B/virologia , Humanos , Masculino , Reação em Cadeia da Polimerase , Curva ROC , Reprodutibilidade dos TestesRESUMO
BACKGROUND & AIMS: Genetic variability in the hepatitis B virus X gene (HBx) is frequently observed and is associated with hepatocellular carcinoma (HCC) progression. However, a genotype classification based on the full-length HBx sequence and the impact of genotypes on hepatitis B virus (HBV)-related HCC prognosis remain unclear. We therefore aimed to perform this genotype classification and assess its clinical impact. METHODS: We classified the genotypes of the full-length HBx gene through sequencing and a cluster analysis of HBx DNA from a cohort of patients with HBV-related HCC, which served as the primary cohort (nâ¯=â¯284). Two independent HBV-related HCC cohorts, a validation cohort (nâ¯=â¯171) and a serum cohort (nâ¯=â¯168), were used to verify the results. Protein microarray assay analysis was performed to explore the underlying mechanism. RESULTS: In the primary cohort, the HBx DNA was classified into 3 genotypes: HBx-EHBH1, HBx-EHBH2, and HBx-EHBH3. HBx-EHBH2 (HBx-E2) indicated better recurrence-free survival and overall survival for patients with HCC. HBx-E2 was significantly correlated with the absence of liver cirrhosis, a small tumor size, a solitary tumor, complete encapsulation and Barcelona Clinic Liver Cancer (BCLC) stage A-0 tumors. Additionally, HBx-E2 served as a significant prognostic factor for patients with BCLC stage B HCC after hepatectomy. Mechanistically, HBx-E2 is unable to promote proliferation in HCC cells and normal hepatocytes. It also fails to activate the Janus kinase 1 (JAK1)/signal transducer and activator of transcription 3 (STAT3)/STAT5 pathway. CONCLUSION: Our study identifies a novel HBx genotype that is unable to promote the proliferation of HCC cells and suggests a potential marker to preoperatively predict the prognosis of patients with BCLC stage B, HBV-associated, HCC. LAY SUMMARY: We classified a novel genotype of the full-length hepatitis B virus X gene (HBx), HBx-E2. This genotype was identified in tumor and nontumor tissues from patients with hepatitis B virus-related hepatocellular carcinoma. HBx-E2 could preoperatively predict the prognosis of patients with intermediate stage hepatocellular carcinoma, after resection.
Assuntos
Carcinoma Hepatocelular/genética , Janus Quinase 1/fisiologia , Neoplasias Hepáticas/genética , Fatores de Transcrição STAT/fisiologia , Transativadores/genética , Proteínas Virais Reguladoras e Acessórias/genética , Carcinoma Hepatocelular/mortalidade , Carcinoma Hepatocelular/patologia , Carcinoma Hepatocelular/cirurgia , Linhagem Celular Tumoral , Genótipo , Humanos , Neoplasias Hepáticas/mortalidade , Neoplasias Hepáticas/patologia , Neoplasias Hepáticas/cirurgia , Estadiamento de Neoplasias , Prognóstico , Transdução de Sinais/fisiologia , Transativadores/sangue , Transativadores/classificação , Proteínas Virais Reguladoras e Acessórias/sangue , Proteínas Virais Reguladoras e Acessórias/classificaçãoRESUMO
Long noncoding RNAs (lncRNAs) play roles in the development and progression of many cancers; however, the contributions of lncRNAs to human gallbladder cancer (GBC) remain largely unknown. In this study, we identify a group of differentially expressed lncRNAs in human GBC tissues, including prognosis-associated gallbladder cancer lncRNA (lncRNA-PAGBC), which we find to be an independent prognostic marker in GBC Functional analysis indicates that lncRNA-PAGBC promotes tumour growth and metastasis of GBC cells. More importantly, as a competitive endogenous RNA (ceRNA), lncRNA-PAGBC competitively binds to the tumour suppressive microRNAs miR-133b and miR-511. This competitive role of lncRNA-PAGBC is required for its ability to promote tumour growth and metastasis and to activate the AKT/mTOR pathway. Moreover, lncRNA-PAGBC interacts with polyadenylate binding protein cytoplasmic 1 (PABPC1) and is stabilized by this interaction. This work provides novel insight on the molecular pathogenesis of GBC.
Assuntos
Carcinogênese/genética , Neoplasias da Vesícula Biliar/genética , Vesícula Biliar/fisiopatologia , Regulação Neoplásica da Expressão Gênica , RNA Longo não Codificante/genética , Linhagem Celular Tumoral , Proliferação de Células , Transformação Celular Neoplásica , Neoplasias da Vesícula Biliar/patologia , Humanos , MicroRNAs/genética , MicroRNAs/metabolismo , Metástase Neoplásica , Prognóstico , Proteínas Proto-Oncogênicas c-akt/metabolismo , Serina-Treonina Quinases TOR/metabolismoRESUMO
BACKGROUND & AIMS: In recent years, circular RNAs (circRNAs) have been shown to have critical regulatory roles in cancer biology. However, the contributions of circRNAs to hepatocellular carcinoma (HCC) remain largely unknown. METHODS: cSMARCA5 (a circRNA derived from exons 15 and 16 of the SMARCA5 gene, hsa_circ_0001445) was identified by RNA-sequencing and validated by quantitative reverse transcription PCR. The role of cSMARCA5 in HCC progression was assessed both in vitro and in vivo. circRNAs in vivo precipitation, luciferase reporter assay, biotin-coupled microRNA capture and fluorescence in situ hybridization were conducted to evaluate the interaction between cSMARCA5 and miR-17-3p/miR-181b-5p. RESULTS: The expression of cSMARCA5 was lower in HCC tissues, because of the regulation of DExH-Box Helicase 9, an abundant nuclear RNA helicase. The downregulation of cSMARCA5 in HCC was significantly correlated with aggressive characteristics and served as an independent risk factor for overall survival and recurrence-free survival in patients with HCC after hepatectomy. Our in vivo and in vitro data indicated that cSMARCA5 inhibits the proliferation and migration of HCC cells. Mechanistically, we found that cSMARCA5 could promote the expression of TIMP3, a well-known tumor suppressor, by sponging miR-17-3p and miR-181b-5p. CONCLUSION: These results reveal an important role of cSMARCA5 in the growth and metastasis of HCC and provide a fresh perspective on circRNAs in HCC progression. LAY SUMMARY: Herein, we studied the role of cSMARCA5, a circular RNA, in hepatocellular carcinoma. Our in vitro and in vivo data showed that cSMARCA5 inhibits the growth and migration of hepatocellular carcinoma cells, making it a potential therapeutic target.
Assuntos
Adenosina Trifosfatases/genética , Carcinoma Hepatocelular/genética , Carcinoma Hepatocelular/metabolismo , Proteínas Cromossômicas não Histona/genética , Neoplasias Hepáticas/genética , Neoplasias Hepáticas/metabolismo , RNA/metabolismo , Animais , Carcinoma Hepatocelular/patologia , Linhagem Celular Tumoral , Movimento Celular , Proliferação de Células , RNA Helicases DEAD-box/antagonistas & inibidores , RNA Helicases DEAD-box/genética , RNA Helicases DEAD-box/metabolismo , Éxons , Feminino , Regulação Neoplásica da Expressão Gênica , Técnicas de Silenciamento de Genes , Humanos , Neoplasias Hepáticas/patologia , Masculino , Camundongos , Camundongos Endogâmicos BALB C , Camundongos Nus , MicroRNAs/genética , MicroRNAs/metabolismo , Pessoa de Meia-Idade , Metástase Neoplásica/genética , Metástase Neoplásica/patologia , Proteínas de Neoplasias/antagonistas & inibidores , Proteínas de Neoplasias/genética , Proteínas de Neoplasias/metabolismo , Prognóstico , RNA Circular , Fatores de Risco , Análise de Sequência de RNA , Inibidor Tecidual de Metaloproteinase-3/genética , Inibidor Tecidual de Metaloproteinase-3/metabolismoRESUMO
BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in serine/threonine kinase 11 (STK11) gene. The increased cancer risk has been connected to P53 pathway. METHODS: PJS probands with STK11 mutation were included in the function analysis. P53 activity elevated by STK11 mutants was investigated using dual-luciferase reporter assay in vitro after constructing expression vectors of STK11 wild type and mutants generated by site-directed substitution. The association between the P53 activity and clinicopathological factors was analysis, especially the cancer history. RESULTS: Thirteen probands with STK11 mutations were involved, and within the mutations, c.G924A was novel. P53 activity elevation caused by 6 truncating mutations were significantly lower than that of STK11 wild type (P < 0.05). Family history of cancer was observed in 5 families. Within them, P53 activity was reduced and cancer occurred before 40 in 2 families, while it was not significantly changed and cancers happened after 45 in the other 3 families. CONCLUSIONS: The affected P53 activity caused by STK11 mutations in PJS patients is significantly associated with protein truncation, while cancer risk in PJS can be elevated through pathways rather than P53 pathway. P53 activity test is probably a useful supporting method to predict cancer risk in PJS, which could be helpful in clinical practice.
Assuntos
Mutação/genética , Neoplasias/genética , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinases/genética , Transdução de Sinais/genética , Proteína Supressora de Tumor p53/genética , Quinases Proteína-Quinases Ativadas por AMP , Adolescente , Adulto , Criança , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Fenótipo , Adulto JovemRESUMO
N6 -Methyladenosine (m6 A) modification has been implicated in many biological processes. However, its role in cancer has not been well studied. Here, we demonstrate that m6 A modifications are decreased in hepatocellular carcinoma, especially in metastatic hepatocellular carcinoma, and that methyltransferase-like 14 (METTL14) is the main factor involved in aberrant m6 A modification. Moreover, METTL14 down-regulation acts as an adverse prognosis factor for recurrence-free survival of hepatocellular carcinoma and is significantly associated with tumor metastasis in vitro and in vivo. We confirm that METTL14 interacts with the microprocessor protein DGCR8 and positively modulates the primary microRNA 126 process in an m6 A-dependent manner. Further experiments show that microRNA 126 inhibits the repressing effect of METTL14 in tumor metastasis. CONCLUSION: These studies reveal an important role of METTL14 in tumor metastasis and provide a fresh view on m6 A modification in tumor progression. (Hepatology 2017;65:529-543).
Assuntos
Adenosina/análogos & derivados , Carcinoma Hepatocelular/patologia , Neoplasias Hepáticas/patologia , Metiltransferases/genética , MicroRNAs/metabolismo , Adenosina/metabolismo , Animais , Carcinoma Hepatocelular/genética , Carcinoma Hepatocelular/mortalidade , Modelos Animais de Doenças , Regulação para Baixo , Regulação Neoplásica da Expressão Gênica , Humanos , Neoplasias Hepáticas/genética , Masculino , Camundongos , Camundongos Endogâmicos BALB C , Metástase Neoplásica/genética , Interferência de RNA , Sensibilidade e Especificidade , Transdução de Sinais , Taxa de Sobrevida , Células Tumorais CultivadasRESUMO
BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in the tumor suppressor gene, STK11, and is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. CASE PRESENTATION: We reported an isolated PJS patient who died of colon cancer, whose blood sample was collected together with all the available family members'. The entire coding region of the STK11 gene was amplified by PCR and analyzed by Sanger sequencing, through which, a novel mutation, c.962_963delCC in exon 8 was identified in this patient. This mutation causes a frameshift mutation and a premature termination at codon 358. Protein structure prediction by Swiss-Model indicated a dramatic change and partial loss of the C-terminal domain. We did not observe this mutation in both parents of the proband. Therefore, it is considered a novel de-novo mutation. Furthermore, the mutation was not found in 50 unrelated healthy people. CONCLUSIONS: The novel mutation we reported here had not been recorded in databases or literature, and the patient who possessed it suffered from PJS and colon cancer. So our results enlarge the spectrum of STK11 variants in PJS patients. This mutation is most likely responsible for development of the PJS phenotype, especially the cancer occurrence.
Assuntos
Povo Asiático/genética , Neoplasias/genética , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinases/genética , Quinases Proteína-Quinases Ativadas por AMP , Sequência de Aminoácidos , China , Éxons , Mutação da Fase de Leitura , Mutação em Linhagem Germinativa , Humanos , Masculino , Pessoa de Meia-Idade , Neoplasias/diagnóstico , Linhagem , Síndrome de Peutz-Jeghers/diagnóstico , Conformação Proteica , Fatores de Risco , Análise de Sequência de DNARESUMO
UNLABELLED: Systemic analyses using large-scale genomic profiles have successfully identified cancer-driving somatic copy number variations (SCNVs) loci. However, functions of vast focal SCNVs in "protein-coding gene desert" regions are largely unknown. The integrative analysis of long noncoding RNA (lncRNA) expression profiles with SCNVs in hepatocellular carcinoma (HCC) led us to identify the recurrent deletion of lncRNA-PRAL (p53 regulation-associated lncRNA) on chromosome 17p13.1, whose genomic alterations were significantly associated with reduced survival of HCC patients. We found that lncRNA-PRAL could inhibit HCC growth and induce apoptosis in vivo and in vitro through p53. Subsequent investigations indicated that the three stem-loop motifs at the 5' end of lncRNA-PRAL facilitated the combination of HSP90 and p53 and thus competitively inhibited MDM2-dependent p53 ubiquitination, resulting in enhanced p53 stability. Additionally, in vivo lncRNA-PRAL delivery efficiently reduced intrinsic tumors, indicating its potential therapeutic application. CONCLUSIONS: lncRNA-PRAL, one of the key cancer-driving SCNVs, is a crucial stimulus for HCC growth and may serve as a potential target for antitumor therapy.
Assuntos
Carcinoma Hepatocelular/genética , Variações do Número de Cópias de DNA , Neoplasias Hepáticas/genética , RNA Longo não Codificante/genética , Proteína Supressora de Tumor p53/metabolismo , Adulto , Idoso , Animais , Sequência de Bases , Carcinoma Hepatocelular/metabolismo , Carcinoma Hepatocelular/mortalidade , China/epidemiologia , Pontos de Quebra do Cromossomo , Feminino , Genes p53 , Proteínas de Choque Térmico HSP90/metabolismo , Humanos , Sequências Repetidas Invertidas , Neoplasias Hepáticas/metabolismo , Neoplasias Hepáticas/mortalidade , Masculino , Camundongos Nus , Pessoa de Meia-Idade , Dados de Sequência Molecular , PrognósticoRESUMO
UNLABELLED: Tumor cells with stemness (stem-cell) features contribute to initiation and progression of hepatocellular carcinoma (HCC), but involvement of long noncoding RNAs (lncRNAs) remains largely unclear. Genome-wide analyses were applied to identify tumor-associated lncRNA-DANCR. DANCR expression level and prognostic values of DANCR were assayed in two HCC cohorts (China and Korea, n = 135 and 223). Artificial modulation of DANCR (down- and overexpression) was done to explore the role of DANCR in tumorigenesis and colonization, and tumor-bearing mice were used to determine therapeutic effects. We found that lncRNA-DANCR is overexpressed in stem-like HCC cells, and this can serve as a prognostic biomarker for HCC patients. Experiments showed that DANCR markedly increased stemness features of HCC cells to promote tumorigenesis and intra-/extrahepatic tumor colonization. Conversely, DANCR knockdown attenuated the stem-cell properties and in vivo interference with DANCR action led to decreased tumor cell vitality, tumor shrinkage, and improved mouse survival. Additionally, we found that the role of DANCR relied largely on an association with, and regulation of, CTNNB1. Association of DANCR with CTNNB1 blocked the repressing effect of microRNA (miR)-214, miR-320a, and miR-199a on CTNNB1. This observation was confirmed in vivo, suggesting a novel mechanism of tumorigenesis involving lncRNAs, messenger RNAs, and microRNAs. CONCLUSIONS: These studies reveal a significance and mechanism of DANCR action in increasing stemness features and offer a potential prognostic marker and a therapeutic target for HCC.
Assuntos
Carcinoma Hepatocelular/patologia , Neoplasias Hepáticas/patologia , Células-Tronco Neoplásicas/patologia , RNA Longo não Codificante/fisiologia , beta Catenina/fisiologia , Animais , Carcinogênese , Masculino , Camundongos , Camundongos NusRESUMO
BACKGROUND AND AIMS: Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies. METHODS AND RESULTS: We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain. CONCLUSIONS: The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.
Assuntos
Biomarcadores Tumorais/genética , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinases/genética , Deleção de Sequência , Quinases Proteína-Quinases Ativadas por AMP , Adulto , Povo Asiático/genética , Sequência de Bases , Biomarcadores Tumorais/química , Biomarcadores Tumorais/metabolismo , China , Análise Mutacional de DNA , Éxons , Feminino , Predisposição Genética para Doença , Hereditariedade , Heterozigoto , Humanos , Modelos Moleculares , Linhagem , Síndrome de Peutz-Jeghers/diagnóstico , Síndrome de Peutz-Jeghers/enzimologia , Síndrome de Peutz-Jeghers/etnologia , Fenótipo , Conformação Proteica , Proteínas Serina-Treonina Quinases/química , Proteínas Serina-Treonina Quinases/metabolismo , Relação Estrutura-AtividadeRESUMO
BACKGROUND: Downregulation of Aldolase B (ALDOB) has been reported in hepatocellular carcinoma. However, its clinical significance and its role in pathogenesis of HCC remain largely unknown. METHODS: We analyzed the expression of ALDOB and its clinical features in a large cohort of 313 HCC patients using tissue microarray and immunohistochemistry. Moreover, the function of stably overexpressed ALDOB in HCC cells was explored in vitro and in vivo. Gene expression microarray analysis was performed on ALDOB-overexpressing SMMC7721 cells to elucidate its mechanism of action. RESULTS: ALDOB downregulation in HCC was significantly correlated with aggressive characteristics including absence of encapsulation, increased tumor size (>5 cm) and early recurrence. ALDOB downregulation was indicative of a shorter recurrence-free survival (RFS) and overall survival (OS) for all HCC patients and early-stage HCC patients (BCLC 0-A and TNM I stage patients). Multiple analyses revealed that ALDOB downregulation was an independent risk factor of RFS and OS. Stable expression of ALDOB in HCC cell lines reduced cell migration in vitro and inhibited lung metastasis, intrahepatic metastasis, and reduced circulating tumor cells in vivo. Mechanistically, we found that cells stably expressing ALDOB show elevated Ten-Eleven Translocation 1 (TET1) expression. Moreover, ALDOB expressing cells have higher levels of methylglyoxal than do control cells, which can upregulate TET1 expression. CONCLUSION: The downregulation of ALDOB could indicate a poor prognosis for HCC patients, and therefore, ALDOB might be considered a prognostic biomarker for HCC, especially at the early stage. In addition, ALDOB inhibits the invasive features of cell lines partly through TET1 expression.
Assuntos
Biomarcadores Tumorais/biossíntese , Carcinoma Hepatocelular/genética , Proteínas de Ligação a DNA/biossíntese , Frutose-Bifosfato Aldolase/biossíntese , Neoplasias Hepáticas/genética , Proteínas Proto-Oncogênicas/biossíntese , Idoso , Animais , Biomarcadores Tumorais/genética , Carcinoma Hepatocelular/patologia , Movimento Celular/genética , Proliferação de Células/genética , Proteínas de Ligação a DNA/genética , Intervalo Livre de Doença , Feminino , Frutose-Bifosfato Aldolase/genética , Regulação Neoplásica da Expressão Gênica , Humanos , Neoplasias Hepáticas/patologia , Masculino , Camundongos , Pessoa de Meia-Idade , Oxigenases de Função Mista , Metástase Neoplásica , Prognóstico , Proteínas Proto-Oncogênicas/genética , Ensaios Antitumorais Modelo de XenoenxertoRESUMO
UNLABELLED: Many protein-coding oncofetal genes are highly expressed in murine and human fetal liver and silenced in adult liver. The protein products of these hepatic oncofetal genes have been used as clinical markers for the recurrence of hepatocellular carcinoma (HCC) and as therapeutic targets for HCC. Herein we examined the expression profiles of long noncoding RNAs (lncRNAs) found in fetal and adult liver in mice. Many fetal hepatic lncRNAs were identified; one of these, lncRNA-mPvt1, is an oncofetal RNA that was found to promote cell proliferation, cell cycling, and the expression of stem cell-like properties of murine cells. Interestingly, we found that human lncRNA-hPVT1 was up-regulated in HCC tissues and that patients with higher lncRNA-hPVT1 expression had a poor clinical prognosis. The protumorigenic effects of lncRNA-hPVT1 on cell proliferation, cell cycling, and stem cell-like properties of HCC cells were confirmed both in vitro and in vivo by gain-of-function and loss-of-function experiments. Moreover, mRNA expression profile data showed that lncRNA-hPVT1 up-regulated a series of cell cycle genes in SMMC-7721 cells. By RNA pulldown and mass spectrum experiments, we identified NOP2 as an RNA-binding protein that binds to lncRNA-hPVT1. We confirmed that lncRNA-hPVT1 up-regulated NOP2 by enhancing the stability of NOP2 proteins and that lncRNA-hPVT1 function depends on the presence of NOP2. CONCLUSION: Our study demonstrates that the expression of many lncRNAs is up-regulated in early liver development and that the fetal liver can be used to search for new diagnostic markers for HCC. LncRNA-hPVT1 promotes cell proliferation, cell cycling, and the acquisition of stem cell-like properties in HCC cells by stabilizing NOP2 protein. Regulation of the lncRNA-hPVT1/NOP2 pathway may have beneficial effects on the treatment of HCC.
Assuntos
Carcinoma Hepatocelular/fisiopatologia , Proliferação de Células/fisiologia , Neoplasias Hepáticas/fisiopatologia , Células-Tronco Neoplásicas/fisiologia , Proteínas Nucleares/fisiologia , RNA Longo não Codificante/fisiologia , tRNA Metiltransferases/fisiologia , Animais , Carcinoma Hepatocelular/mortalidade , Carcinoma Hepatocelular/patologia , Ciclo Celular/fisiologia , Modelos Animais de Doenças , Feminino , Humanos , Técnicas In Vitro , Neoplasias Hepáticas/mortalidade , Neoplasias Hepáticas/patologia , Masculino , Camundongos , Pessoa de Meia-Idade , Fenótipo , Prognóstico , Transdução de Sinais/fisiologia , Fator de Crescimento Transformador beta1/fisiologiaRESUMO
BACKGROUND: H19 was one of the earliest identified, and is the most studied, long noncoding RNAs. It is presumed that H19 is essential for regulating development and disease conditions, and it is associated with carcinogenesis for many types. However the biological function and regulatory mechanism of this conserved RNA, particularly with respect to its effect on transcription, remain largely unknown. METHODS: We performed RNA pulldown, RNA immunoprecipitation and deletion mapping to identify the proteins that are associated with H19. In addition, we employed EU (5-ethynyl uridine) incorporation, immunoprecipitation and Western blotting to investigate the functional aspects of H19. RESULTS: Our research further verifies that H19 is bound to hnRNP U, and this interaction is located within the 5' 882 nt region of H19. Moreover, H19 disrupts the interaction between hnRNP U and actin, which inhibits phosphorylation at Ser5 of the RNA polymerase II (Pol II) C-terminal domain (CTD), consequently preventing RNA Pol II-mediated transcription. We also showed that hnRNP U is essential for H19-mediated transcription repression. CONCLUSIONS: In this study, we demonstrate that H19 inhibits RNA Pol II-mediated transcription by disrupting the hnRNP U-actin complex. GENERAL SIGNIFICANCE: These data suggest that H19 regulates general transcription and exerts wide-ranging effects in organisms.
Assuntos
Actinas/metabolismo , Ribonucleoproteínas Nucleares Heterogêneas Grupo U/metabolismo , RNA Polimerase II/metabolismo , RNA Longo não Codificante/fisiologia , Transcrição Gênica/fisiologia , Sequência de Bases , Linhagem Celular Tumoral , Primers do DNA , Humanos , Ligação Proteica , Reação em Cadeia da Polimerase em Tempo RealRESUMO
UNLABELLED: In recent years, long noncoding RNAs (lncRNAs) have been investigated as a new class of regulators of biological function. A recent study reported that lncRNAs control cell proliferation in hepatocellular carcinoma (HCC). However, the role of lncRNAs in liver regeneration and the overall mechanisms remain largely unknown. To address this issue, we carried out a genome-wide lncRNA microarray analysis during liver regeneration in mice after 2/3 partial hepatectomy (PH) at various timepoints. The results revealed differential expression of a subset of lncRNAs, notably a specific differentially expressed lncRNA associated with Wnt/ß-catenin signaling during liver regeneration (an lncRNA associated with liver regeneration, termed lncRNA-LALR1). The functions of lncRNA-LALR1 were assessed by silencing and overexpressing this lncRNA in vitro and in vivo. We found that lncRNA-LALR1 enhanced hepatocyte proliferation by promoting progression of the cell cycle in vitro. Furthermore, we showed that lncRNA-LALR1 accelerated mouse hepatocyte proliferation and cell cycle progression during liver regeneration in vivo. Mechanistically, we discovered that lncRNA-LALR1 facilitated cyclin D1 expression through activation of Wnt/ß-catenin signaling by way of suppression of Axin1. In addition, lncRNA-LALR1 inhibited the expression of Axin1 mainly by recruiting CTCF to the AXIN1 promoter region. We also identified a human ortholog RNA of lncRNA-LALR1 (lncRNA-hLALR1) and found that it was expressed in human liver tissues. CONCLUSION: lncRNA-LALR1 promotes cell cycle progression and accelerates hepatocyte proliferation during liver regeneration by activating Wnt/ß-catenin signaling. Pharmacological intervention targeting lncRNA-LALR1 may be therapeutically beneficial in liver failure and liver transplantation by inducing liver regeneration.