Expression of different genotypes of bovine TRDMT1 gene and its polymorphisms association with body measures in Qinchuan cattle (Bos Taurus).

DNA methyltransferase 2 (DNMT2) was renamed as tRNA aspartic acid methyltransferase 1 (TRDMT1) by catalyzing the methylation of tRNAAsp anti-codon loop C38. The development of sequencing of nucleic acids and protein detection techniques have prompted the demonstration that TRDMT1 mediated tRNA modification affects protein synthesis efficiency. This process affects the growth and development of animals. The DNA of 224 Qinchuan cattles aged 2-4 years old was collected in this experiment. The genetic variations of TRDMT1 exon and some intron regions were detected by mixed pool sequencing technology. qRT-PCR and Western Blot were used to detect the expression levels of mRNA and protein produced with the combination of different genetic variant loci. Three haplotypes were detected and the distribution ratios were different. Muscle tissue mRNA and protein testing showed that there were differences in mRNA expression levels among different genotypes (P < 0.05) and the protein expression levels between different genotypes show the same trend as mRNA. This study provides potential molecular materials for the improvement of Qinchuan cattle reproductivity and provides theoretical support for studying the effects of livestock TRDMT1 on animal growth and development.

Insertion/deletions within the bovine FoxO1 gene and their association analysis with growth traits in three Chinese cattle breeds.

FOXO1 (FKHR) gene, as a transcription factor, plays a vital role in animal growth and development, participating in many biological processes. The aim of this study was to ascertain Insertion/deletions (Indels) polymorphism within bovine FoxO1 gene in 679 Chinese adult cows and associate them with stature traits. Two Indels (named as Indel-3 and Indel-4, recorded as rs383545622 and rs525318770 in NCBI, respectively) were successfully genotyped by the Once PCR method, which was reliable, rapid and cost effective for simultaneous detection of two or more Indels. Indel-3 and Indel-4 were located at the second intron. All four different haplotypes (H1: D3D4, H2: I3D4, H3: D3I4, H4: I3I4) could be identified, and the D (del-) allele, DD (del-/del-) genotype and D3D4 haplotype retained the highest frequency. However, individuals with DI (D3I3, D4I4 or H1H4/H2H3 genotype) showed significantly better phenotypic traits than those with the other genotypes in Nanyang cattle, showing a hybrid vigor. The results implied that this DI genotype can be applied to early selective breeding to improve the productivity of Nanyang cattle. Our results suggested that these two Indels within the bovine FoxO1 gene might be used as genetic markers for marker-assisted selection (MAS) in cattle breeding and genetics.

A novel 17 bp InDel polymorphism within the PPARGC1A gene is significantly associated with growth traits in sheep.

Peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PPARGC1A) is a member of transcriptional coactivator of the peroxisome proliferator-activated receptor. It is involved in lipid metabolism, energy metabolism, adipocyte differentiation and regulation of mitochondrial biogenesis. Therefore, the genetic variation of PPARGC1A gene will be of great value. The purposes of this study were to detect novel InDels within the PPARGC1A gene and analyze the effects of genetic polymorphisms on growth traits. We detected a novel 17 bp insertion polymorphism within the eleventh intron of the sheep PPARGC1A gene. Experimental results revealed that the InDel (insertion/deletion) genotypes distribution of the seven breeds of sheep was significant differences, of which three genotypes were detected. After correlation analysis, there were many significant phenotypic differences between the body size traits of the three genotypes. Interestingly, the dominant genotype was different in body weight both in STHS sheep and HS sheep. In summary, the 17 bp insertion polymorphism within the PPARGC1A gene had a great influence on the growth traits of sheep, which may provide a potential theoretical basis for marker-assisted selection in sheep genetic breeding.

Exploring of InDel in bovine PSAP gene and their association with growth traits in different development stages.

PSAP (prosaposin) is widely expressed in different organs, and plays an important role in fat deposit. Insertion/Deletion (InDel) is a relatively simple and effective DNA marker. However, the association of molecular marker at different stages of animal development has not received enough attention, especially fat deposition related traits. Therefore, eight cattle breeds were used to explore novel InDels variants within bovine PSAP gene, and to evaluate their effects on growth traits in different development stages. Herein, two novel InDels (P5:NC037355.1g.27974439-27974440 ins AGTGTGGTTAATGTCAAC and P8:NC037355.1g.27980734-27980752 del GTCAAAAAATCAGGGGAAAC) within the bovine PSAP gene were found, and their association with growth traits in different development stages were analyzed. Interestingly, the dominant genotype was different in different development stages both in NY cattle and JX cattle for daily gain and body weight. PSAP Gene expression patterns were analyzed in this study, high expression in the middle stage of adipocytes differentiation suggests that it plays a certain role in fat development. It reveals that InDels could affect phenotype in different development stages, which depend on the expression pattern of the host gene and their function in different tissues. These findings could provide a new way for molecular marker studies in bovine breeding and genetics.

miR-18b regulates the function of rabbit ovary granulosa cells.

MicroRNAs (miRNAs) have been determined to participate in the process of oestradiol production. Generally, there are two pathways by which oestradiol levels change, one being the state of cells (i.e. the status of enzymes involved in the synthesis of hormones such as oestradiol) and the other being the number of cells that secrete oestradiol. It is known that oestrogens are the main steroids produced by granulosa cells (GCs) of mature ovarian follicles. In this study we explored the function of miR-18b in rabbit GCs by overexpressing or inhibiting its activity. We found that miR-18b silencing promoted the secretion of oestradiol by significantly affecting the expression of steroidogenesis-related genes. Thus, miR-18b may act as a negative regulator of the production of enzymes related to oestradiol synthesis and affect oestradiol production. Furthermore, the effects of miR-18b on the proliferation, cell cycle and apoptosis of GCs were investigated using a cell counting kit (CCK-8) proliferation assay, detection of annexin V-fluorescein isothiocyanate apoptosis, flow cytometry and quantitative polymerase chain reaction. The results showed that miR-18b upregulated GC apoptosis (miR-18b overexpression decreases cell growth and stimulates apoptosis). These findings suggest that miR-18b and the oestrogen receptor 1 (ESR1) gene may be attractive targets to further explore the molecular regulation of GCs. The miR-18b may also explain, in part, the abnormal folliculogenesis in mammals caused by conditions such as polycystic ovary syndrome, primary ovarian insufficiency, and others.

Genetic effects of FTO gene insertion/deletion (InDel) on fat-tail measurements and growth traits in Tong sheep.

Tong sheep is a kind of famous fat-tailed sheep in China, which no longer meets market demands because of the large amount of fat deposition in tail. Fat mass and obesity associated (FTO) gene regulates fatty acid transport and fat metabolism to affect obesity and is also reported to regulate phenotypic traits in healthy animals. To identify the insertion/deletion (InDel) variations of the FTO gene and evaluate their effects on fat-tail measurements and growth traits, 166 healthy individuals from Tong sheep were identified and analyzed. Herein, 10 novel InDel polymorphisms were founded in the Tong sheep FTO gene, which displayed intermediate polymorphism (0.25 < PIC < 0.5) and were in Hardy-Weinberg equilibrium (p > .05). Correlation analysis of 78 Tong sheep phenotypic traits data and InDel polymorphisms showed that eight InDel loci were significantly associated with partial growth traits (p < .05), four InDel loci were significantly correlated with fat-tail measurements (p < .05). In particular, individuals with genotype DD showed better phenotypic traits than individuals with other genotypes at male sheep InDel 5 and InDel 8 loci, which had small tail-fat dimensions while having good growth traits. These results confirmed potential usefulness of FTO gene in marker-assisted selection programs of Tong sheep breeding.

Detection of key gene InDels in TGF-ß pathway and its relationship with growth traits in four sheep breeds.

TGF-ß signaling pathway plays an important role in regulating cell proliferation and differentiation, embryonic development, bone formation, etc. LTBP1, THBS1, SMAD4 and other genes are important members of TGF-ß signaling pathway. LTBP1 binds to TGF-ß, while THBS1 binds to LTBP1, which is an important signal transduction molecule in the TGF-ß pathway. In order to explore the effects of the insertion/deletion variation of three genes (LTBP1, THBS1, SMAD4) in the TGF-ß signaling pathway on the growth traits such as body length and body weight of sheep, a total of 625 healthy individuals from 4 breeds of the Tong sheep, Hu sheep, small-tail Han sheep and Lanzhou fat-tail sheep were identified and analyzed. In this study, we identified 4 InDel loci: one loci of LTBP1, two loci of THBS1, and one loci of SMAD4, respectively named as: InDel-1 (deletion 13 bp), InDel-2 (deletion 16 bp), InDel-3 (deletion 22 bp), InDel-4 (deletion 7 bp). Among the 4 analyzed breeds, association analysis showed that all new InDel polymorphisms were significantly associated with 10 different growth traits (p < 0.05), which may provide a theoretical basis for sheep breeding to accelerate the progression of marker-assisted selection in sheep breeding.

The PLAG1 mRNA expression analysis among genetic variants and relevance to growth traits in Chinese cattle.

Pleomorphic adenoma gene 1 (PLAG1) encodes a developmentally regulated zinc finger protein, locating in growth-related QTNs. The mRNA expression of this gene was investigated in different tissues and from two different developmental periods, whilst to explore the functions of PLAG1 in growth traits of cattle. The results showed that PLAG1 was expressed in all examined tissues. However, PLAG1 expression levels in all examined tissues were significantly different between the 5-month fetus and 36-month adult cattle. Our juvenile results indicated PLAG1 is primarily expressed in embryonic tissues of Chinese cattle. Furthermore, two variations were identified. Association analysis revealed that the two variations were associated with growth traits (p < 0.05 or p < 0.01). These new findings provide a comprehensive overview of the critical roles of PLAG1 in growth traits modulation and can be highlighted as candidate molecular markers in cattle breeding.

Genetic Architecture and Selection of Chinese Cattle Revealed by Whole Genome Resequencing.

The bovine genetic resources in China are diverse, but their value and potential are yet to be discovered. To determine the genetic diversity and population structure of Chinese cattle, we analyzed the whole genomes of 46 cattle from six phenotypically and geographically representative Chinese cattle breeds, together with 18 Red Angus cattle genomes, 11 Japanese black cattle genomes and taurine and indicine genomes available from previous studies. Our results showed that Chinese cattle originated from hybridization between Bos taurus and Bos indicus. Moreover, we found that the level of genetic variation in Chinese cattle depends upon the degree of indicine content. We also discovered many potential selective sweep regions associated with domestication related to breed-specific characteristics, with selective sweep regions including genes associated with coat color (ERCC2, MC1R, ZBTB17, and MAP2K1), dairy traits (NCAPG, MAPK7, FST, ITFG1, SETMAR, PAG1, CSN3, and RPL37A), and meat production/quality traits (such as BBS2, R3HDM1, IGFBP2, IGFBP5, MYH9, MYH4, and MC5R). These findings substantially expand the catalogue of genetic variants in cattle and reveal new insights into the evolutionary history and domestication traits of Chinese cattle.

Neonatal respiratory distress syndrome and underlying mechanisms in cloned cattle.

Neonatal respiratory distress is a major mortality factor in cloned animals, but the pathogenesis of this disease is rarely investigated. In this study, four neonatal cloned cattle, born after full-term gestation, exhibited symptoms of neonatal respiratory distress syndrome (NRDS), which included symptoms of hyaline membrane disease as well as disordered surfactant homeostasis in their collapsed lungs. No differences in DNA methylation or histone modifications correlated with the suppressed SPB and SPC transcription observed in the cloned cattle group (p > 0.05), whereas TTF-1 occupancy at SPB and SPC promoter regions in cloned cattle was significantly reduced to 24% and 20% that of normal lungs, respectively (SPB, p < 0.05; SPC, p < 0.01). Decreased TTF1 expression, dysregulation of SPB and SPC transcription by TTF-1, and disordered proteolytic processing of Surfactant protein B precursor together potentially contribute to the disruption of surfactant homeostasis and NRDS in bovine clones. Elucidation of the associated mechanisms should facilitate the development of novel preventive or therapeutic strategies to reduce the mortality rate of cloned animals and to improve the efficiency of SCNT technology.

Two New Insertion/Deletion Variants of the PITX2 Gene and their Effects on Growth Traits in Sheep.

In China, Tong sheep (TS) and Lanzhou fat-tailed sheep (LFTS) are two closely relative endanger breeds for low meat production and low fecundity, finding some marker-assisted selected (MAS) is our first priority for improving their growth traits. For this purpose, Hu sheep (HS) and small-tailed Han sheep (STHS) were compared with two endangered breeds (TS and LFTS). Paired-liked homeodomain transcription factor 2 (PITX2) gene was the important member of PITX family, which could adjust animal growth through hypothalamic-pituitary-adrenal axis. During the past years, insertion/deletion (indel) has become increasingly popular in application as MAS. In this study, two novel indel loci were identified, and five significant differences, including chest width, hip width, chest depth, chest circumference, and body height, were found between different breeds. Interestingly, there was no DD genotype and smaller number of ID genotye. All the ID genotypes were significantly greater than II genotype, which was to say the allele of "D" was dominant variation and its frequency was lower, which demonstrated that it has huge space for selection. Briefly, the two indel were potential and useful DNA markers for selecting excellent individuals in relation to growth traits in sheep.

Transcriptomic profiling reveals disordered regulation of surfactant homeostasis in neonatal cloned bovines with collapsed lungs and respiratory distress.

Respiratory distress is a major cause of mortality in cloned neonatal animals, but its pathogenesis remains poorly understood. Here, we used necropsy and histology procedures to evaluate the lungs of cloned neonatal bovines dying of respiratory distress, finding incomplete lung dilation, alveolar collapse, and thickened alveolar walls. Comparison of the transcriptomes between collapsed lungs of cloned bovines and their normal counterparts revealed 1373 differentially expressed genes in collapsed lungs (p < 0.05, fold change >1.5 or <1.5-1 ), many of which were associated with surfactant biosynthesis, secretion, transport, recycling, and degradation. ERK/MAPK and Notch signaling pathways were among the canonical pathways relevant to surfactant homeostasis. Expression of the genes encoding Surfactant protein B (SPB) and Surfactant protein C (SPC)-which control surfactant lipid packing, spreading, and stability-were significantly lower in collapsed lungs of cloned neonates at the transcript (p < 0.01) and protein levels (p < 0.05) relative to that in normal lungs. Thus, our results provide an initial view into the changes in gene expression in cloned newborns with lung collapse and respiratory distress, and present a valuable resource for developing novel preventive or therapeutic strategies to reduce the mortality rate of cloned animals and to improve the efficiency of somatic cell nuclear transfer technology.

[Pulmonary surfactant homeostasis associated genetic abnormalities and lung diseases].

Pulmonary surfactant (PS) is synthesized and secreted by alveolar epithelial type II (AEII) cells, which is a complex compound formed by proteins and lipids. Surfactant participates in a range of physiological processes such as reducing the surface tension, keeping the balance of alveolar fluid, maintaining normal alveolar morphology and conducting host defense. Genetic disorders of the surfactant homeostasis genes may result in lack of surfactant or cytotoxicity, and lead to multiple lung diseases in neonates, children and adults, including neonatal respiratory distress syndrome, interstitial pneumonia, pulmonary alveolar proteinosis, and pulmonary fibrosis. This paper has provided a review for the functions and processes of pulmonary surfactant metabolism, as well as the connection between disorders of surfactant homeostasis genes and lung diseases.

Analysis of immunoglobulin organization and complexity in mink (Neovison vison).

Mink are susceptible to viruses such as SARS-CoV-2, H1N1 and H9N2, so they are considered a potential animal model for studying human viral infections. Therefore, it is important to study the immune system of mink. Immunoglobulin (Ig) is an important component of humoral immunity and plays an important role in the body's immune defense. In this study, we described the gene loci structure of mink Ig germline by genome comparison, and analysed the mechanism of expression diversity of mink antibody library by 5'RACE and next-generation sequencing (NGS). The results were as follows: the IgH, Igκ and Igλ loci of mink were located on chromosome 13, chromosome 8 and chromosome 3, respectively, and they had 25, 36 and 7 V genes, 3, 5 and 7 J genes and 10 DH genes, respectively. Mink Ig heavy chain preferred the IGHV1, IGHD2 and IGHJ4 subgroups, κ chain mainly use the IGKV1, IGKJ1 and IGHL4 subgroups, and λ chain mainly use the IGLV3 and IGLJ3 subgroups. Linkage diversity analysis revealed that N nucleotide insertion was the main factor affecting the linkage diversity of mink Igs. On the mutation types of mink Ig Somatic Hypermutation (SHM), the high mutation types of heavy chain were mainly G > A, C > T, T > C, A > G, C > A, G > T, A > C, and T > G; the high mutation types of κ chain were G > A and T > C; and the high mutation types of λ chain were G > A and A > G. The objective of this study was to analyse the loci structure and expression diversity of Ig in mink. The results contribute to our comprehension of Ig expression patterns in mink and were valuable for advancing knowledge in mink immunogenetics, exploring the evolution of adaptive immune systems across different species, and conducting comparative genomics research.

Differential analysis of immunoglobulin gene expression pattern in chickens of distinct breeds and developmental periods.

Immunoglobulin is an essential component of the body's defense against pathogens, aiding in the recognition and clearance of foreign antigens. Research concerning immunoglobulin gene and its diversity of expression across different breeds within the same species is relatively scarce. In this study, we employed RACE (Rapid Amplification of cDNA Ends) technology, prepared DNA libraries, performed high-throughput sequencing, and conducted related bioinformatics analysis to analyze the differences in immunoglobulin gene diversity and expression at different periods in Hy-line brown hens, Lueyang black-bone chickens, and Beijing-You chickens. The study found that the composition of chicken immunoglobulin genes is relatively simple, with both the light chain and heavy chain having a functional V gene. Additionally, the mechanisms of immunoglobulin diversity generation tended to be consistent among different breeds and periods of chickens, primarily relying on abundant junctional diversity, somatic hypermutation (SHM), and gene conversion (GCV) to compensate for the limitations of low-level V(D)J recombination. As the age increased, the junctional diversity of IgH and IgL tended to diversify and showed similar expression patterns among different breeds. In the three chicken breeds, the predominant types of mutations observed in IGHV and IGLV SHM were A to G and G to A transitions. Specifically, IGLV exhibited a preference for A to G mutations, whereas IGHV displayed a bias toward G to A mutations. The regions at the junctions between framework regions (FR) and complementarity-determining regions (CDR) and within the CDR regions themselves are typically prone to mutations. The locations of GCV events in IGLV and IGHV do not show significant differences, and replacement segments are concentrated in the central regions of FR1, CDR, and FR2. Importantly, gene conversion events are not random occurrences. Additionally, our investigation revealed that CDRH3 in chickens of diverse breeds and periods the potential for diversification through the incorporation of cysteine. This study demonstrates that the diversity of immunoglobulin expression tends to converge among Hy-line brown hens, Lueyang black-bone chickens, and Beijing-You chickens, indicating that the immunoglobulin gene expression mechanisms in different breeds of chickens do not exhibit significant differences due to selective breeding.

Immunoglobulins play a key role in the organism's defense against pathogens, and their diverse expression allows the body to generate a wide array of antibodies. This diversity serves as a critical safeguard for the immune system against various pathogens. Natural geographical variances and artificial breeding and selection can potentially lead to different immune responses in distinct populations of the same species when confronted with the same pathogen. In this study, we investigated the diversity of immunoglobulin gene expression in the natural state of different chicken breeds (Hy-line brown hens, Lueyang black-bone chickens, and Beijing-You chickens) and at different periods from the perspective of immunoglobulin gene expression mechanism. We analyzed the diversity of immunoglobulin based on the results of high-throughput sequencing by extracting Fabricius bursa RNA, RACE (Rapid Amplification of cDNA Ends) technique, and constructing DNA libraries. Our study reveals that the junctional diversity, somatic hypermutation, CDR3 diversity, and gene conversion expression of immunoglobulins in Hy-line brown hens, Lueyang black-bone chickens, and Beijing-You chickens converge during the same time period. This indicates that the immunoglobulin gene expression mechanisms in different chicken breeds do not exhibit significant variations as a result of selective breeding.

Effect of Five Different Antioxidants on the Effectiveness of Goat Semen Cryopreservation.

The effective combination of semen cryopreservation and artificial insemination has a positive effect on the conservation of germplasm resources, production and breeding, etc. However, during the process of semen cryopreservation, the sperm cells are very susceptible to different degrees of physical, chemical, and oxidative stress damage. Oxidative damage is the most important factor that reduces semen quality, which is affected by factors such as dilution equilibrium, change of osmotic pressure, cold shock, and enzyme action during the freezing-thawing process, which results in the aggregation of a large amount of reactive oxygen species (ROS) in sperm cells and affects the quality of semen after thawing. Therefore, the method of adding antioxidants to semen cryoprotective diluent is usually used to improve the effect of semen cryopreservation. The aim of this experiment was to investigate the effects of adding five antioxidants (GLP, Mito Q, NAC, SLS, and SDS) to semen cryoprotection diluent on the cryopreservation effect of semen from Saanen dairy goats. The optimal preservation concentrations were screened by detecting sperm viability, plasma membrane integrity, antioxidant capacity, and acrosomal enzyme activities after thawing, and the experimental results were as follows: the optimal concentrations of GLP, Mito Q, NAC, SLS, and SDS added to semen cryopreservation diluent at different concentrations were 0.8 mg/mL, 150 nmol/L, 0.6 mg/mL, 0.15 mg/ mL, 0.6 mg/mL, and 0.15 mg/mL. The optimal concentrations of the five antioxidants were added to the diluent and analyzed after 1 week of cryopreservation, and it was found that sperm viability, plasma membrane integrity, and mitochondrial activity were significantly enhanced after thawing compared with the control group (P < 0.05), and their antioxidant capacity was significantly enhanced (P < 0.05). Therefore, the addition of the above five antioxidants to goat sperm cryodilution solution had a better enhancement of sperm cryopreservation. This study provides a useful reference for exploring the improvement of goat semen cryoprotection effect.

Antibody repertoire development in fetal and neonatal piglets. XVI. Influenza stimulates adaptive immunity, class switch and diversification of the IgG repertoire encoded by downstream Cγ genes.

Infection of germ-free isolator piglets with swine influenza (S-FLU) that generates dsRNA during replication causes elevation of immunoglobulins in serum and bronchoalveolar lavage, a very weak response to trinitrophenyl conjugates but an immune response to S-FLU. The increased immunoglobulin levels result mainly from the polyclonal activation of B cells during the infection, but model antigen exposure may contribute. The 10-fold increase in local and serum IgG accompanies a 10-fold decrease in the transcription of IgG3 in the tracheal-bronchial lymph nodes and in the ileal Peyer's patches. Infection results in class switch recombination to downstream Cγ genes, which diversify their repertoire; both features are diagnostic of adaptive immunity. Meanwhile the repertoires of IgM and IgG3 remain undiversified suggesting that they encode innate, natural antibodies. Whereas IgG3 may play an initial protective role, antibodies encoded by downstream Cγ genes with diversified repertoires are predicted to be most important in long-term protection against S-FLU.

Antibody repertoire development in fetal and neonatal piglets. XX. B cell lymphogenesis is absent in the ileal Peyer's patches, their repertoire development is antigen dependent, and they are not required for B cell maintenance.

The continuous ileal Peyer's patches (IPP) of sheep are regarded as a type of mammalian bursal equivalent where B cells diversify their repertoire in an Ag-independent fashion. Anatomically and developmentally similar IPP occur in swine. Resection of ∼90% of the IPP in piglets at birth did not alter Ig levels in serum and secretions or retard diversification of the Ab repertoire when animals were maintained in isolators and colonized with a defined gut flora. Resection or sham surgery elevated IgG and IgA in serum and in lavage fluid from the gut, lung, and in saliva. No changes in the frequency of IgG-, IgA-, and IgM-containing cells in the spleen and peripheral lymph node were observed. Using an index that quantifies diversification of the VDJ repertoire, no differences were seen in three secondary lymphoid tissues between piglets lacking IPP and colonized controls, whereas both groups displayed >10-fold greater diversification than did late-term fetal piglets or piglets maintained germ-free. Somatic hypermutation was very low in fetal IPP and the IPP of germ-free piglets but increased 3- to 5-fold after colonization. D-J signal joint circles were not recovered in IPP, and V-DJ signal joint circles were 5-fold lower than in bone marrow and similar to those in thymus and spleen. We conclude that the porcine IPP are not a site of B cell lymphogenesis, do not undergo Ag-independent repertoire diversification, and are not primary lymphoid tissue since they are not required for maintenance of Ig levels in serum and secretions.

Testing Rhodiola sachalinensis saccharide as cryoprotectant for bovine spermatozoa.

Rhodiola sachalinensis saccharide (RSS) was extracted from the rhizome of Herba Rhodiolae and was expected as a novel cryoprotectant. The aim of this study was to test the effects of RSS on motility of bull sperm and the activities of superoxide dismutase (SOD), lactate dehydrogenase (LDH), and glutamic oxaloacetic transaminase (GOT) in bull sperm during cryopreservation. Rhodiola sachalinensis saccharide was added at the concentrations of 0.02, 0.04, 0.06, 0.08, and 0.10 mg/mL to the extenders, which were used to store bovine semen. It was found that the RSS-added extends resulted in a higher percentage of cryopreserved sperm motility, mitochondrial activity, and membrane and acrosome integrity than those of RSS-free extenders. The SOD, LDH, and GOT activities were all decreased during the process of freezing and thawing. The extenders supplemented with RSS improved the SOD, LDH, and GOT activities after cryopreservation compared with the RSS-free groups. In conclusion, RSS conferred great cryoprotective capacity to the basic extender for bull spermatozoa during the process of freezing-thawing, and the optimal concentration of RSS for the extender was 0.06 mg/mL.

Detection of key gene InDels in JAK/STAT pathway and their associations with growth traits in four Chinese sheep breeds.

OBJECTIVE: The Janus kinase/signal transducer and transporter activator (JAK/STAT) signaling pathway plays crucial roles in lipid metabolism, glucose metabolism and cell senescence, suggesting that they are potential candidate genes affecting growth traits in animals. The present study aimed to evaluate the association between InDels in the JAK/STAT pathway and growth traits of four Chinese sheep breeds, including Tong sheep, Hu sheep, Small-tailed Han sheep and Lanzhou fat-tailed sheep. RESULTS: Seventy-six indel loci of 11 genes in JAK/STAT were detected, and three genotypes were selected at four loci by PCR amplification, electrophoresis and sequencing, including one locus in STAT3, one locus in STAT5A, and two loci in JAK1. The Correlation analysis indicated that there was no significant correlation between STAT3 and growth traits in four sheep breeds (P > 0.05); STAT5A was significantly associated with body height, rump width and tube circumference in Hu sheep and body length in Tong sheep (P < 0.05); JAK1 was significantly correlated with body height, body oblique length, cross height and tube circumference in Hu sheep (P < 0.05) and body oblique length, cross height and tube circumference in small-tailed Han sheep (P < 0.05). CONCLUSION: Overall, our results indicated a potential association between the growth traits of sheep and the InDels of JAK1 and STAT5A.