RESUMO
The pursuit of environmentally friendly solvents has become an essential research topic in sustainable chemistry and nanomaterial science. With the need to substitute toxic solvents in nanofabrication processes becoming more pressing, the search for alternative solvents has taken on a crucial role in this field. Additionally, the use of toxic, non-economical organic solvents, such as N-methyl-2 pyrrolidone and dimethylformamide, is not suitable for all biomedical applications, even though these solvents are often considered as the best exfoliating agents for nanomaterial fabrication. In this context, the success of producing two-dimensional transition metal dichalcogenides (2D TMDs), such as MoS2 and WS2, with excellent captivating properties is due to the ease of synthesis based on environment-friendly, benign methods with fewer toxic chemicals involved. Herein, we report for the first time on the use of cyrene as an exfoliating agent to fabricate monolayer and few-layered 2D TMDs with a versatile, less time-consuming liquid-phase exfoliation technique. This bio-derived, aprotic, green and eco-friendly solvent produced a stable, surfactant-free, concentrated 2D TMD dispersion with very interesting features, as characterized by UV-visible and Raman spectroscopies. The surface charge and morphology of the fabricated nanoflakes were analyzed using ς-potential and scanning electron microscopy. The study demonstrates that cyrene is a promising green solvent for the exfoliation of 2D TMD nanosheets with potential advantages over traditional organic solvents. The ability to produce smaller-sized-especially in the case of WS2 as compared to MoS2-and mono/few-layered nanostructures with higher negative surface charge values makes cyrene a promising candidate for various biomedical and electronic applications. Overall, the study contributes to the development of sustainable and environmentally friendly methods for the production of 2D nanomaterials for various applications.
Assuntos
Nanoestruturas , Elementos de Transição , Solventes , Molibdênio/química , Elementos de Transição/química , Nanoestruturas/químicaRESUMO
A new series of tetrasubstituted pyrrole derivatives (TSPs) was synthesized based on a previously developed hypothesis on their ability to mimic hydrophobic protein motifs. The resulting new TSPs were endowed with a significant toxicity against human epithelial melanoma A375 cells, showing IC50 values ranging from 10 to 27 µM, consistent with the IC50 value of the reference compound nutlin-3a (IC50 = 15 µM). In particular, compound 10a (IC50 = 10 µM) resulted as both the most soluble and active among the previous and present TSPs. The biological investigation evidenced that the anticancer activity is related to the activation of apoptotic cell-death pathways, supporting our rational design based on the ability of TSPs to interfere with PPI involved in the cell cycle regulation of cancer cells and, in particular, the p53 pathway. A reinvestigation of the TSP pharmacophore by using DFT calculations showed that the three aromatic substituents on the pyrrole core are able to mimic the hydrophobic side chains of the hot-spot residues of parallel and antiparallel coiled coil structures suggesting a possible molecular mechanism of action. A structure-activity relationship (SAR) analysis which includes solubility studies allows us to rationalize the role of the different substituents on the pyrrole core.
Assuntos
Antineoplásicos , Melanoma , Humanos , Pirróis/farmacologia , Pirróis/química , Ensaios de Seleção de Medicamentos Antitumorais , Antineoplásicos/farmacologia , Antineoplásicos/química , Relação Estrutura-Atividade , Melanoma/tratamento farmacológico , Proliferação de Células , Estrutura Molecular , Apoptose , Linhagem Celular TumoralRESUMO
The synthesis of two 5'-end (4-dimethylamino)azobenzene conjugated G-quadruplex forming aptamers, the thrombin binding aptamer (TBA) and the HIV-1 integrase aptamer (T30695), was performed. Their structural behavior was investigated by means of UV, CD, fluorescence spectroscopy, and gel electrophoresis techniques in K+-containing buffers and water-ethanol blends. Particularly, we observed that the presence of the 5'-(4-dimethylamino)azobenzene moiety leads TBA to form multimers instead of the typical monomolecular chair-like G-quadruplex and almost hampers T30695 G-quadruplex monomers to dimerize. Fluorescence studies evidenced that both the conjugated G-quadruplexes possess unique fluorescence features when excited at wavelengths corresponding to the UV absorption of the conjugated moiety. Furthermore, a preliminary investigation of the trans-cis conversion of the dye incorporated at the 5'-end of TBA and T30695 showed that, unlike the free dye, in K+-containing water-ethanol-triethylamine blend the trans-to-cis conversion was almost undetectable by means of a standard UV spectrophotometer.
Assuntos
Aptâmeros de Nucleotídeos/química , Compostos Azo/química , Quadruplex G , Oligonucleotídeos/química , Análise EspectralRESUMO
The identification of molecules whose biological activity can be properly modulated by light is a promising therapeutic approach aimed to improve drug selectivity and efficacy on the molecular target and to limit the side effects compared to traditional drugs. Recently, two photo-switchable diastereomeric benzodiazopyrrole derivatives 1RR and 1RS have been reported as microtubules targeting agents (MTAs) on human colorectal carcinoma p53 null cell line (HCT 116 p53-/-). Their IC50 was enhanced upon Light Emitting Diode (LED) irradiation at 435 nm and was related to their cis form. Here we have investigated the photo-responsive behavior of the acid derivatives of 1RR and 1RS, namely, d1RR and d1RS, in phosphate buffer solutions at different pH. The comparison of the UV spectra, acquired before and after LED irradiation, indicated that the transâcis conversion of d1RR and d1RS is affected by the degree of ionization. The apparent rate constants were calculated from the kinetic data by means of fast UV spectroscopy and the conformers of the putative ionic species present in solution (pH range: 5.7-8.0) were modelled. Taken together, our experimental and theoretical results suggest that the photo-conversions of trans d1RR/d1RS into the corresponding cis forms and the thermal decay of cis d1RR/d1RS are dependent on the presence of diazonium form of d1RR/d1RS. Finally, a photo-reaction was detected only for d1RR after prolonged LED irradiation in acidic medium, and the resulting product was characterized by means of Liquid Chromatography coupled to High resolution Mass Spectrometry (LC-HRMS) and Nuclear Magnetic Resonance (NMR) spectroscopy.
Assuntos
Proliferação de Células/efeitos dos fármacos , Neoplasias Colorretais/terapia , Fotoquimioterapia , Pirróis/farmacologia , Cromatografia Líquida , Neoplasias Colorretais/patologia , Compostos de Diazônio/química , Compostos de Diazônio/farmacologia , Células HCT116 , Humanos , Espectroscopia de Ressonância Magnética , Espectrometria de Massas , Pirróis/químicaRESUMO
BACKGROUND: The thrombin binding aptamer (TBA) is endowed with antiproliferative properties but its potential development is counteracted by the concomitant anticoagulant activity. METHODS: Five oligonucleotides (ODNs) based on TBA sequence (GGTTGGTGTGGTTGG) and containing l-residues or both l-residues and inversion of polarity sites have been investigated by NMR and CD techniques for their ability to form G-quadruplex structures. Furthermore, their anticoagulant (PT assay) and antiproliferative properties (MTT assay), and their resistance in fetal bovine serum have been tested. RESULTS: CD and NMR data suggest that the investigated ODNs are able to form right- and left-handed G-quadruplex structures. All ODNs do not retain the anticoagulant activity characteristic of TBA but are endowed with a significant antiproliferative activity against two cancerous cell lines. Their resistance in biological environment after six days is variable, depending on the ODN. CONCLUSIONS: A comparison between results and literature data suggests that the antiproliferative activity of the TBA analogues investigated could depends on two factors: a) biological pathways and targets different from those already identified or proposed for other antiproliferative G-quadruplex aptamers, and b) the contribution of the guanine-based degradation products. GENERAL SIGNIFICANCE: Modified TBA analogues containing l-residues and inversion of polarity sites lose the anticoagulant activity but gain antiproliferative properties against two cancer cell lines. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio.
Assuntos
Antineoplásicos/farmacologia , Aptâmeros de Nucleotídeos/farmacologia , Proliferação de Células/efeitos dos fármacos , Neoplasias/tratamento farmacológico , Trombina/farmacologia , Anticoagulantes/química , Anticoagulantes/metabolismo , Anticoagulantes/farmacologia , Antineoplásicos/química , Antineoplásicos/metabolismo , Aptâmeros de Nucleotídeos/química , Aptâmeros de Nucleotídeos/metabolismo , Sequência de Bases , Coagulação Sanguínea/efeitos dos fármacos , Dicroísmo Circular , Estabilidade de Medicamentos , Esterases/química , Quadruplex G , Células HCT116 , Humanos , Espectroscopia de Ressonância Magnética , Modelos Moleculares , Neoplasias/patologia , Ligação Proteica , Relação Estrutura-Atividade , Trombina/análogos & derivados , Trombina/química , Trombina/metabolismo , Fatores de TempoRESUMO
Here we report investigations, based on circular dichroism, nuclear magnetic resonance spectroscopy, molecular modelling, differential scanning calorimetry and prothrombin time assay, on analogues of the thrombin binding aptamer (TBA) in which individual thymidines were replaced by 5-fluoro-2'-deoxyuridine residues. The whole of the data clearly indicate that all derivatives are able to fold in a G-quadruplex structure very similar to the 'chair-like' conformation typical of the TBA. However, only ODNs TBA-F4: and TBA-F13: have shown a remarkable improvement both in the melting temperature (ΔTm ≈ +10) and in the anticoagulant activity in comparison with the original TBA. These findings are unusual, particularly considering previously reported studies in which modifications of T4 and T13 residues in TBA sequence have clearly proven to be always detrimental for the structural stability and biological activity of the aptamer. Our results strongly suggest the possibility to enhance TBA properties through tiny straightforward modifications.
Assuntos
Anticoagulantes/química , Aptâmeros de Nucleotídeos/química , Flúor/química , Dicroísmo Circular , Desoxirribonucleases , Espectroscopia de Ressonância Magnética , Modelos Moleculares , Desnaturação de Ácido Nucleico , Tempo de Protrombina , Termodinâmica , Timidina/químicaRESUMO
Many antiproliferative G-quadruplexes (G4s) arise from the folding of GT-rich strands. Among these, the Thrombin Binding Aptamer (TBA), as a rare example, adopts a monomolecular well-defined G4 structure. Nevertheless, the potential anticancer properties of TBA are severely hampered by its anticoagulant action and, consequently, no related studies have appeared so far in the literature. We wish to report here that suitable chemical modifications in the TBA sequence can preserve its antiproliferative over anticoagulant activity. Particularly, we replaced one residue of the TT or TGT loops with a dibenzyl linker to develop seven new quadruplex-forming TBA based sequences (TBA-bs), which were studied for their structural (CD, CD melting, 1D NMR) and biological (fibrinogen, PT and MTT assays) properties. The three-dimensional structures of the TBA-bs modified at T13 (TBA-bs13) or T12 (TBA-bs12), the former endowed with selective antiproliferative activity, and the latter acting as potently as TBA in both coagulation and MTT assays, were further studied by 2D NMR restrained molecular mechanics. The comparative structural analyses indicated that neither the stability, nor the topology of the G4s, but the different localization of the two benzene rings of the linker was responsible for the loss of the antithrombin activity for TBA-bs13.
Assuntos
Anticoagulantes/química , Antineoplásicos/química , Aptâmeros de Nucleotídeos/química , Anticoagulantes/farmacologia , Antineoplásicos/farmacologia , Aptâmeros de Nucleotídeos/farmacologia , Compostos de Benzil/química , Testes de Coagulação Sanguínea , Proliferação de Células/efeitos dos fármacos , Fibrinogênio , Quadruplex G , Células HeLa , Humanos , Modelos Moleculares , Desnaturação de Ácido Nucleico , Oligonucleotídeos/síntese química , Tempo de ProtrombinaRESUMO
In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions.
Assuntos
Aptâmeros de Nucleotídeos/química , Quadruplex G , Oligodesoxirribonucleotídeos/química , Sequência de Bases , Dicroísmo Circular , Modelos Moleculares , Ressonância Magnética Nuclear BiomolecularRESUMO
We report an investigation into analogues of the thrombin binding aptamer (TBA). Individual thymidines were replaced by the unusual residue 5-hydroxymethyl-2'-deoxyuridine (hmU). This differs from the canonical thymidine by a hydroxyl group on the 5-methyl group. NMR and CD data clearly indicate that all TBA derivatives retain the ability to fold into the "chair-like" quadruplex structure. The presence of the hmU residue does not significantly affect the thermal stability of the modified aptamers compared to the parent, except for analogue H9, which showed a marked increase in melting temperature. Although all TBA analogues showed decreased affinities to thrombin, H3, H7, and H9 proved to have improved anticoagulant activities. Our data open up the possibility to enhance TBA biological properties, simply by introducing small chemical modifications.
Assuntos
Anticoagulantes/química , Aptâmeros de Nucleotídeos/química , Trombina/química , Timidina/análogos & derivados , Anticoagulantes/metabolismo , Aptâmeros de Nucleotídeos/metabolismo , Sequência de Bases , Dicroísmo Circular , Fibrinogênio/química , Fibrinogênio/metabolismo , Espectroscopia de Ressonância Magnética , Modelos Moleculares , Ligação Proteica , Trombina/metabolismo , Timidina/químicaRESUMO
Degradation of nucleic acids in biological environments is the major drawback of the therapeutic use of aptamers. Among the approaches used to circumvent this negative aspect, the introduction of 3'-3' inversion of polarity sites at the sequence 3'-end has successfully been proposed. However, the introduction of inversion of polarity at the ends of the sequence has never been exploited for G-quadruplex forming aptamers. In this communication we describe CD, UV, electrophoretic and biochemical investigations concerning thrombin binding aptamer analogues containing one or two inversions of polarity sites at the oligonucleotide ends. Data indicate that, in some cases, this straightforward chemical modification is able to improve, at the same time, the thermal stability, affinity to thrombin and nuclease resistance in biological environments, thus suggesting its general application as a post-SELEX modification also for other therapeutically promising aptamers adopting G-quadruplex structures.
Assuntos
Oligonucleotídeos/química , Trombina/química , Sítios de Ligação , Quadruplex G , Trombina/análogos & derivadosRESUMO
Cyanobacteria in water supplies are considered an emerging threat, as some species produce toxic metabolites, cyanotoxins, of which the most widespread and well-studied are microcystins. Consumption of contaminated water is a common exposure route to cyanotoxins, making the study of cyanobacteria in drinking waters a priority to protect public health. In drinking water treatment plants, pre-oxidation with chlorinated compounds is widely employed to inhibit cyanobacterial growth, although concerns on its efficacy in reducing cyanotoxin content exists. Additionally, the effects of chlorination on abundant but less-studied cyanometabolites (e.g. cyanopeptolins whose toxicity is still unclear) remain poorly investigated. Here, two chlorinated oxidants, sodium hypochlorite (NaClO) and chlorine dioxide (ClO2), were tested on the toxic cyanobacterium Microcystis aeruginosa, evaluating their effect on cell viability, toxin profile and content. Intra- and extracellular microcystins and other cyanometabolites, including their degradation products, were identified using an untargeted LC-HRMS approach. Both oxidants were able to inactivate M. aeruginosa cells at a low dose (0.5 mg L-1), and greatly reduced intracellular toxins content (>90%), regardless of the treatment time (1-3 h). Conversely, a two-fold increase of extracellular toxins after NaClO treatment emerged, suggesting a cellular damage. A novel metabolite named cyanopeptolin-type peptide-1029, was identified based on LC-HRMSn (n = 2, 3) evidence, and it was differently affected by the two oxidants. NaClO led to increase its extracellular concentration from 2 to 80-100 µg L-1, and ClO2 induced the formation of its oxidized derivative, cyanopeptolin-type peptide-1045. In conclusion, pre-oxidation treatments of raw water contaminated by toxic cyanobacteria may lead to increased cyanotoxin concentrations in drinking water and, depending on the chemical agent, its dose and treatment duration, also of oxidized metabolites. Since the effects of such metabolites on human health remain unknown, this issue should be handled with extreme caution by water security agencies involved in drinking water management.
RESUMO
The antiviral activity of certain acyclic nucleosides drew our attention to the fact that the replacement of the furanose ring by an alkyl group bearing hydroxyl(s) could be a useful structural modification to modulate the biological properties of those nucleosides. Herein, we report on the synthesis of some novel acadesine analogues, where the ribose moiety is mimicked by a D-ribityl or by a hydroxybutyl chain.
Assuntos
Aminoimidazol Carboxamida/análogos & derivados , Antivirais/síntese química , Ribonucleosídeos/síntese química , Ribose/química , Relação Estrutura-Atividade , Aminoimidazol Carboxamida/síntese química , Aminoimidazol Carboxamida/farmacologia , Antivirais/farmacologia , Humanos , Nucleotídeos/química , Ribonucleosídeos/farmacologia , Vírus/efeitos dos fármacosRESUMO
Marine toxins have a significant impact on seafood resources and human health. Up to date, mainly based on bioassays results, two genera of toxic microalgae, Gambierdiscus and Fukuyoa have been hypothesized to produce a suite of biologically active compounds, including maitotoxins (MTXs) and ciguatoxins (CTXs) with the latter causing ciguatera poisoning (CP) in humans. The global ubiquity of these microalgae and their ability to produce (un-)known bioactive compounds, necessitates strategies for screening, identifying, and reducing the number of target algal species and compounds selected for structural elucidation. To accomplish this task, a dereplication process is necessary to screen and profile algal extracts, identify target compounds, and support the discovery of novel bioactive chemotypes. Herein, a dereplication strategy was applied to a crude extract of a G. balechii culture to investigate for bioactive compounds with relevance to CP using liquid chromatography-high resolution mass spectrometry, in vitro cell-based bioassay, and a combination thereof via a bioassay-guided micro-fractionation. Three biologically active fractions exhibiting CTX-like and MTX-like toxicity were identified. A naturally incurred fish extract (Sphyraena barracuda) was used for confirmation where standards were unavailable. Using this approach, a putative I/C-CTX congener in G. balechii was identified for the first time, 44-methylgambierone was confirmed at 8.6 pg cell-1, and MTX-like compounds were purported. This investigative approach can be applied towards other harmful algal species of interest. The identification of a microalgal species herein, G. balechii (VGO920) which was found capable of producing a putative I/C-CTX in culture is an impactful advancement for global CP research. The large-scale culturing of G. balechii could be used as a source of I/C-CTX reference material not yet commercially available, thus, fulfilling an analytical gap that currently hampers the routine determination of CTXs in various environmental and human health-relevant matrices.
Assuntos
Ciguatera , Ciguatoxinas , Dinoflagellida , Animais , Humanos , Ciguatoxinas/toxicidade , Ciguatoxinas/análise , Toxinas Marinhas/análise , Cromatografia Líquida/métodos , Espectrometria de Massas em Tandem/métodosRESUMO
The cKit87up sequence d((5')AGGGAGGGCGCTGGGAGGAGGG(3')) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K(+)- or NH(4)(+)-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results showed that (1) P1-P4 interact with the cKit87up quadruplex, and (2) the binding mode depends on the quadruplex stability. In K(+) buffer, P1-P4 bind the ckit87up quadruplex structure as "quadruplex-binding agents". The same holds for P1 in NH(4)(+) solution. On the contrary, in NH(4)(+) solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid complexes, thus acting as "quadruplex openers".
Assuntos
Quadruplex G , Sondas de Oligonucleotídeos/química , Ácidos Nucleicos Peptídicos/química , Proteínas Proto-Oncogênicas c-kit/química , Humanos , Modelos Moleculares , Sondas de Oligonucleotídeos/síntese química , Ácidos Nucleicos Peptídicos/síntese químicaRESUMO
Previous studies indicate that some perylene bisimide derivatives can drive the assembly of DNA G-quadruplexes, thus suggesting the possible advantage in the adoption of perylene-conjugated G-rich oligonucleotides in biological and biotechnological applications. Nevertheless, the typical poor solubility of perylene bisimides strongly limits the number of suitable chemical strategies to prepare perylene-conjugated oligonucleotides. In order to overcome these difficulties, we employed the earlier described core twisted perylene derivatives possessing unique optical and electronic properties, besides good solubility in common solvents. As a first result, the large-scale synthesis of a new dibromoperylene derivative (PEOEBr) phosphoramidite building block is herein reported. Furthermore, the structural behavior of the conjugated PEOEBr-GGGTTAGGG (HTRp2) human telomeric repeat was investigated by using CD, UV, fluorescence, and gel electrophoresis techniques in desalted water and in K(+)- and Na(+)-containing buffers. We observed that the peculiar property of PEOEBr moieties to form dimers instead of extended aggregates drives the HTRp2 strands toward dimerization and mainly promotes the formation of quadruplex species having both the 5'-ends located at the same side of the structures. However, the counterions present in solutions (K(+) or Na(+)) as well as the strand concentration, also contribute to influence the topology and the stoichiometry of formed structures. Furthermore, unlike the unmodified sequence GGGTTAGGG (HTR2), HTRp2 strands quickly associate into G-quadruplexes even in desalted water, as assessed by CD experiments.
Assuntos
Quadruplex G , Halogenação , Oligonucleotídeos/química , Compostos Organofosforados/química , Perileno/análogos & derivados , Sequência de Bases , Bromo/química , Dicroísmo Circular , Ensaio de Desvio de Mobilidade Eletroforética , Humanos , Oligonucleotídeos/síntese química , Compostos Organofosforados/síntese química , Perileno/síntese química , Espectrofotometria UltravioletaRESUMO
The solid-phase synthesis of the first example of a new diphosphate AICAR derivative is reported. The new substance is characterized by the presence of a 5'-phosphate group while a second phosphate moiety is installed on a 5-hydroxypentyl chain attached to the 4-N-position of AICAR. Cyclization of the diphosphate derivative by pyrophosphate bond formation allowed for the formation of a novel AICAR-based cyclic ADP-ribose (cADPR) mimic.
Assuntos
Aminoimidazol Carboxamida/análogos & derivados , ADP-Ribose Cíclica/análogos & derivados , ADP-Ribose Cíclica/síntese química , Compostos Organofosforados/síntese química , Ribonucleotídeos/síntese química , Aminoimidazol Carboxamida/síntese química , Ciclização , Estabilidade de Medicamentos , Espectroscopia de Ressonância Magnética , Estrutura Molecular , Técnicas de Síntese em Fase SólidaRESUMO
Palytoxin (PLTX) and its congeners are emerging toxins held responsible for a number of human poisonings following the inhalation of toxic aerosols, skin contact, or the ingestion of contaminated seafood. Despite the strong structural analogies, the relative toxic potencies of PLTX congeners are quite different, making it necessary to isolate them individually in sufficient amounts for toxicological and analytical purposes. Previous studies showed poor PLTX recoveries with a dramatic decrease in PLTX yield throughout each purification step. In view of a large-scale preparative work aimed at the preparation of PLTX reference material, we have investigated evaporation as a critical-although unavoidable-step that heavily affects overall recoveries. The experiments were carried out in two laboratories using different liquid chromatography-mass spectrometry (LC-MS) instruments, with either unit or high resolution. Palytoxin behaved differently when concentrated to a minimum volume rather than when evaporated to complete dryness. The recoveries strongly depended on the solubility as well as on the material of the used container. The LC-MS analyses of PLTX dissolved in aqueous organic blends proved to give a peak intensity higher then when dissolved in pure water. After drying, the PLTX adsorption appeared stronger on glass surfaces than on plastic materials. However, both the solvents used to dilute PLTX and that used for re-dissolution had an important role. A quantitative recovery (97%) was achieved when completely drying 80% aqueous EtOH solutions of PLTX under N2-stream in Teflon. The stability of PLTX in acids was also investigated. Although PLTX was quite stable in 0.2% acetic acid solutions, upon exposure to stronger acids (pH < 2.66), degradation products were observed, among which a PLTX methyl-ester was identified.
Assuntos
Acrilamidas/isolamento & purificação , Cromatografia Líquida , Venenos de Cnidários/isolamento & purificação , Espectrometria de Massas , Solventes , Manejo de Espécimes , Solventes/química , Manejo de Espécimes/métodosRESUMO
Interactions of novel bi-dimensional nanomaterials and live matter such as bacteria and viruses represent an extremely hot topic due to the unique properties of the innovative nanomaterials, capable in some cases to exhibit bactericide and antiviral actions. The interactions between bacteria and viruses and two dimensional nanosheets are here investigated. We extensively studied the interaction between a gram-negative bacterium, Escherichia coli, and a gram-positive bacterium, Staphylococcus aureus, with two different types of 2D nanoflakes such as MoS2, belonging to the Transition Metal Dichalcogenides family, and Graphene Oxide. The same two types of nanomaterials were employed to study their antiviral action toward the Herpes simplex virus type-1, (HSV-1). The experimental results showed different bactericide impacts as well as different antiviral power between the two nanomaterials. The experimental findings were interpreted in bacteria on the base of the Derjaguin-Landau-Verwey-Overbeek theory. A simple kinetic model of bacterial growth in the presence of the interacting nanosheets is also elaborated, to explain the observed results. The experimental results in viruses are really novel and somewhat surprising, evidencing a stronger antiviral action of Graphene Oxide as compared to MoS2. Results in viruses are complicated to quantitatively interpret due to the complexity of the system under study, constituted by virus/host cell and nanoflake, and due to the lack of a well assessed theoretical context to refer to. Thus, these results are interpreted in terms of qualitative arguments based on the chemical properties of the interactors in the given solvent medium.
RESUMO
Some G-quadruplex (GQ) forming aptamers, such as T30695, exhibit particularly promising properties among the potential anti-HIV drugs. T30695â¯G-quadruplex binds to HIV-1 integrase (IN) and inhibits its activity during 3'-end processing at nanomolar concentrations. Herein we report a study concerning six T30695-GQ variants, in which the R or S chiral glycerol T, singly replaced the thymine residues at the T30695â¯G-quadruplex loops. CD melting, EMSA and HMRS experiments provided information about the thermal stability and the stoichiometry of T30695-GQ variants, whereas CD and 1H NMR studies were performed to evaluate the effects of the modifications on T30695-GQ topology. Furthermore, LEDGF/p75 dependent and independent integration assays were carried out to evaluate how T loop modifications impact T30695-GQ biological activities. The obtained results showed that LEDGF/p75 adversely affects the potencies of T30695 and its variants. The IN inhibitory activities of the modified aptamers also depended on the position and on the chirality (R or S) of glycerol T loop in the GQ, mostly regardless of the G-quadruplex stabilities. In view of our and literature data, we suggest that the allosteric modulation of IN tetramer conformations by LEDGF/p75 alters the interactions between the aptamers and the enzyme. Therefore, the new T30695 variants could be suitable tools in studies aimed to clarify the HIV-1 IN tetramers allostery and its role in the integration activity.
Assuntos
Aptâmeros de Nucleotídeos/farmacologia , Glicerol/farmacologia , Inibidores de Integrase de HIV/farmacologia , Integrase de HIV/metabolismo , Peptídeos e Proteínas de Sinalização Intercelular/metabolismo , Oligonucleotídeos/farmacologia , Aptâmeros de Nucleotídeos/química , Aptâmeros de Nucleotídeos/genética , Quadruplex G , Variação Genética/genética , Glicerol/química , Inibidores de Integrase de HIV/química , Oligonucleotídeos/química , Oligonucleotídeos/genética , Conformação ProteicaRESUMO
A new modified acyclic nucleoside, namely N(1)-(3-hydroxy-2-hydroxymethyl-2-methylpropyl)-thymidine, was synthesized and transformed into a building block useful for oligonucleotide (ON) automated synthesis. A series of modified thrombin binding aptamers (TBAs) in which the new acyclic nucleoside replaces, one at the time, the thymidine residues were then synthesized and characterized by UV, CD, MS, and (1)H NMR. The biological activity of the resulting TBAs was tested by Prothrombin Time assay (PT assay) and by purified fibrinogen clotting assay. From a structural point of view, nearly all the new TBA analogues show a similar behavior as the unmodified counterpart, being able to fold into a bimolecular or monomolecular quadruplex structure depending on the nature of monovalent cations (sodium or potassium) coordinated in the quadruplex core. From the comparison of structural and biological data, some important structure-activity relationships emerged, particularly when the modification involved the TT loops. In agreement with previous studies we found that the folding ability of TBA analogues is more affected by modifications involving positions 4 and 13, rather than positions 3 and 12. On the other hand, the highest anti-thrombin activities were detected for aptamers containing the modification at T13 or T12 positions, thus indicating that the effects produced by the introduction of the acyclic nucleoside on the biological activity are not tightly connected with structure stabilities. It is noteworthy that the modification at T7 produces an ON being more stable and active than the natural TBA.