Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 43
Filtrar
1.
Nucleic Acids Res ; 52(5): 2188-2197, 2024 Mar 21.
Artigo em Inglês | MEDLINE | ID: mdl-38364855

RESUMO

i-Motifs (iMs), are secondary structures formed in cytosine-rich DNA sequences and are involved in multiple functions in the genome. Although putative iM forming sequences are widely distributed in the human genome, the folding status and strength of putative iMs vary dramatically. Much previous research on iM has focused on assessing the iM folding properties using biophysical experiments. However, there are no dedicated computational tools for predicting the folding status and strength of iM structures. Here, we introduce a machine learning pipeline, iM-Seeker, to predict both folding status and structural stability of DNA iMs. The programme iM-Seeker incorporates a Balanced Random Forest classifier trained on genome-wide iMab antibody-based CUT&Tag sequencing data to predict the folding status and an Extreme Gradient Boosting regressor to estimate the folding strength according to both literature biophysical data and our in-house biophysical experiments. iM-Seeker predicts DNA iM folding status with a classification accuracy of 81% and estimates the folding strength with coefficient of determination (R2) of 0.642 on the test set. Model interpretation confirms that the nucleotide composition of the C-rich sequence significantly affects iM stability, with a positive correlation with sequences containing cytosine and thymine and a negative correlation with guanine and adenine.


Assuntos
DNA , Aprendizado de Máquina , Motivos de Nucleotídeos , Humanos , Sequência de Bases , Citosina/química , DNA/química , DNA/genética
2.
Nucleic Acids Res ; 52(W1): W19-W28, 2024 Jul 05.
Artigo em Inglês | MEDLINE | ID: mdl-38676949

RESUMO

DNA, beyond its canonical B-form double helix, adopts various alternative conformations, among which the i-motif, emerging in cytosine-rich sequences under acidic conditions, holds significant biological implications in transcription modulation and telomere biology. Despite recognizing the crucial role of i-motifs, predictive software for i-motif forming sequences has been limited. Addressing this gap, we introduce 'iM-Seeker', an innovative computational platform designed for the prediction and evaluation of i-motifs. iM-Seeker exhibits the capability to identify potential i-motifs within DNA segments or entire genomes, calculating stability scores for each predicted i-motif based on parameters such as the cytosine tracts number, loop lengths, and sequence composition. Furthermore, the webserver leverages automated machine learning (AutoML) to effortlessly fine-tune the optimal i-motif scoring model, incorporating user-supplied experimental data and customised features. As an advanced, versatile approach, 'iM-Seeker' promises to advance genomic research, highlighting the potential of i-motifs in cell biology and therapeutic applications. The webserver is freely available at https://im-seeker.org.


Assuntos
DNA , Internet , Aprendizado de Máquina , Motivos de Nucleotídeos , Software , DNA/química , DNA/genética , Humanos , Análise de Sequência de DNA/métodos , Algoritmos
3.
Nucleic Acids Res ; 50(6): 3445-3455, 2022 04 08.
Artigo em Inglês | MEDLINE | ID: mdl-35253884

RESUMO

Concatemers of d(TCCC) that were first detected through their association with deletions at the RACK7 locus, are widespread throughout the human genome. Circular dichroism spectra show that d(GGGA)n sequences form G-quadruplexes when n > 3, while i-motif structures form at d(TCCC)n sequences at neutral pH when n ≥ 7 in vitro. In the PC3 cell line, deletions are observed only when the d(TCCC)n variant is long enough to form significant levels of unresolved i-motif structure at neutral pH. The presence of an unresolved i-motif at a representative d(TCCC)n element at RACK7 was suggested by experiments showing that that the region containing the d(TCCC)9 element was susceptible to bisulfite attack in native DNA and that d(TCCC)9 oligo formed an i-motif structure at neutral pH. This in turn suggested that that the i-motif present at this site in native DNA must be susceptible to bisulfite mediated deamination even though it is a closed structure. Bisulfite deamination of the i-motif structure in the model oligodeoxynucleotide was confirmed using mass spectrometry analysis. We conclude that while G-quadruplex formation may contribute to spontaneous mutation at these sites, deletions actually require the potential for i-motif to form and remain unresolved at neutral pH.


Assuntos
Quadruplex G , Dicroísmo Circular , DNA/química , DNA/genética , Genoma Humano , Humanos , Concentração de Íons de Hidrogênio
4.
Org Biomol Chem ; 22(1): 55-58, 2023 12 20.
Artigo em Inglês | MEDLINE | ID: mdl-37970888

RESUMO

GC-rich sequences can fold into G-quadruplexes and i-motifs and are known to control gene expression in many organisms. The potent G-quadruplex experimental anticancer drug QN-302 down-regulates a number of cancer-related genes, in particular S100P. Here we show this ligand has strong opposing effects with i-motif DNA structures and is one of the most potent i-motif destabilising agents reported to date. QN-302 down-regulates the expression of numerous cancer-related genes by pan-quadruplex targeting. QN-302 exhibits exceptional combined synergistic effects compared to many other G-quadruplex and i-motif interacting compounds. This work further emphasises the importance of considering G-quadruplex and i-motif DNA structures as one dynamic system.


Assuntos
Quadruplex G , Neoplasias , Humanos , DNA/genética , DNA/química , Regiões Promotoras Genéticas/genética , Neoplasias/genética , Proteínas de Ligação ao Cálcio/genética , Proteínas de Neoplasias
5.
Molecules ; 28(6)2023 Mar 07.
Artigo em Inglês | MEDLINE | ID: mdl-36985425

RESUMO

The naphthalene diimide compound QN-302, designed to bind to G-quadruplex DNA sequences within the promoter regions of cancer-related genes, has high anti-proliferative activity in pancreatic cancer cell lines and anti-tumor activity in several experimental models for the disease. We show here that QN-302 also causes downregulation of the expression of the S100P gene and the S100P protein in cells and in vivo. This protein is well established as being involved in key proliferation and motility pathways in several human cancers and has been identified as a potential biomarker in pancreatic cancer. The S100P gene contains 60 putative quadruplex-forming sequences, one of which is in the promoter region, 48 nucleotides upstream from the transcription start site. We report biophysical and molecular modeling studies showing that this sequence forms a highly stable G-quadruplex in vitro, which is further stabilized by QN-302. We also report transcriptome analyses showing that S100P expression is highly upregulated in tissues from human pancreatic cancer tumors, compared to normal pancreas material. The extent of upregulation is dependent on the degree of differentiation of tumor cells, with the most poorly differentiated, from more advanced disease, having the highest level of S100P expression. The experimental drug QN-302 is currently in pre-IND development (as of Q1 2023), and its ability to downregulate S100P protein expression supports a role for this protein as a marker of therapeutic response in pancreatic cancer. These results are also consistent with the hypothesis that the S100P promoter G-quadruplex is a potential therapeutic target in pancreatic cancer at the transcriptional level for QN-302.


Assuntos
Quadruplex G , Neoplasias Pancreáticas , Humanos , Linhagem Celular Tumoral , Neoplasias Pancreáticas/tratamento farmacológico , Neoplasias Pancreáticas/genética , Neoplasias Pancreáticas/metabolismo , Proteínas de Ligação ao Cálcio/metabolismo , Expressão Gênica , Proteínas de Neoplasias/metabolismo , Neoplasias Pancreáticas
6.
J Am Chem Soc ; 144(2): 935-950, 2022 01 19.
Artigo em Inglês | MEDLINE | ID: mdl-34989224

RESUMO

The cationic porphyrin TMPyP4 is a well-established DNA G-quadruplex (G4) binding ligand that can stabilize different topologies via multiple binding modes. However, TMPyP4 can have both a stabilizing and destabilizing effect on RNA G4 structures. The structural mechanisms that mediate RNA G4 unfolding remain unknown. Here, we report on the TMPyP4-induced RNA G4 unfolding mechanism studied by well-tempered metadynamics (WT-MetaD) with supporting biophysical experiments. The simulations predict a two-state mechanism of TMPyP4 interaction via a groove-bound and a top-face-bound conformation. The dynamics of TMPyP4 stacking on the top tetrad disrupts Hoogsteen H-bonds between guanine bases, resulting in the consecutive TMPyP4 intercalation from top-to-bottom G-tetrads. The results reveal a striking correlation between computational and experimental approaches and validate WT-MetaD simulations as a powerful tool for studying RNA G4-ligand interactions.


Assuntos
Quadruplex G , Ligantes , Porfirinas/química , Cátions/química , Ligação de Hidrogênio , Substâncias Intercalantes/química , Simulação de Dinâmica Molecular , Conformação de Ácido Nucleico , Termodinâmica
7.
Bioorg Med Chem Lett ; 73: 128886, 2022 10 01.
Artigo em Inglês | MEDLINE | ID: mdl-35835380

RESUMO

There are thousands of compounds shown to interact with G-quadruplex DNA, yet very few which target i-motif (iM) DNA. Previous work showed that tobramycin can interact with iM- DNA, indicating the potential for sugar-molecules to target these structures. Computational approaches indicated that the sugar-containing natural products baicalin and geniposidic acid had potential to target iM-DNA. We assessed the DNA interacting properties of these compounds using FRET-based DNA melting and a fluorescence-based displacement assay using iM-DNA structures from the human telomere and the insulin linked polymorphic region (ILPR), as well as complementary G-quadruplex and double stranded DNA. Both baicalin and geniposidic acid show promise as iM-interacting compounds with potential for use in experiments into the structure and function of i-motif forming DNA sequences and present starting points for further synthetic development of these as probes for iM-DNA.


Assuntos
Produtos Biológicos , Quadruplex G , DNA/química , Humanos , Desnaturação de Ácido Nucleico , Açúcares
8.
Nucleic Acids Res ; 48(1): 55-62, 2020 01 10.
Artigo em Inglês | MEDLINE | ID: mdl-31777919

RESUMO

i-Motifs are widely used in nanotechnology, play a part in gene regulation and have been detected in human nuclei. As these structures are composed of cytosine, they are potential sites for epigenetic modification. In addition to 5-methyl- and 5-hydroxymethylcytosine modifications, recent evidence has suggested biological roles for 5-formylcytosine and 5-carboxylcytosine. Herein the human telomeric i-motif sequence was used to examine how these four epigenetic modifications alter the thermal and pH stability of i-motifs. Changes in melting temperature and transitional pH depended on both the type of modification and its position within the i-motif forming sequence. The cytosines most sensitive to modification were next to the first and third loops within the structure. Using previously described i-motif forming sequences, we screened the MCF-7 and MCF-10A methylomes to map 5-methylcytosine and found the majority of sequences were differentially methylated in MCF7 (cancerous) and MCF10A (non-cancerous) cell lines. Furthermore, i-motif forming sequences stable at neutral pH were significantly more likely to be epigenetically modified than traditional acidic i-motif forming sequences. This work has implications not only in the epigenetic regulation of DNA, but also allows discreet tunability of i-motif stability for nanotechnological applications.


Assuntos
5-Metilcitosina/análogos & derivados , Citosina/análogos & derivados , Citosina/metabolismo , DNA/metabolismo , Epigênese Genética , 5-Metilcitosina/química , 5-Metilcitosina/metabolismo , Linhagem Celular , Citosina/química , DNA/química , DNA/genética , Metilação de DNA , Humanos , Concentração de Íons de Hidrogênio , Células MCF-7 , Motivos de Nucleotídeos
9.
Chemistry ; 27(63): 15773-15785, 2021 Nov 11.
Artigo em Inglês | MEDLINE | ID: mdl-34436799

RESUMO

A library of eleven cationic gold(III) complexes of the general formula [(C C)Au(N N)]+ when C C is either biphenyl or 4,4'-ditertbutyldiphenyl and N N is a bipyridine, phenanthroline or dipyridylamine derivative have been synthesized and characterized. Contrasting effects on the viability of the triple negative breast cancer cells MDA-MB-231 was observed from a preliminary screening. The antiproliferative activity of the seven most active complexes were further assayed on a larger panel of human cancer cells as well as on non-cancerous cells for comparison. Two complexes stood out for being either highly active or highly selective. Eventually, reactivity studies with biologically meaningful amino acids, glutathione, higher order DNA structures and thioredoxin reductase (TrxR) revealed a markedly different behavior from that of the well-known coordinatively isomeric [(C N C)Au(NHC)]+ structure. This makes the [(C C)Au(N N)]+ complexes a new class of organogold compounds with an original mode of action.


Assuntos
Antineoplásicos , Antineoplásicos/farmacologia , Linhagem Celular Tumoral , Proliferação de Células , Ouro/farmacologia , Humanos , Compostos Organoáuricos/farmacologia , Tiorredoxina Dissulfeto Redutase
10.
J Nat Prod ; 84(5): 1617-1625, 2021 05 28.
Artigo em Inglês | MEDLINE | ID: mdl-33974416

RESUMO

Heliomycin (also known as resistomycin) is an antibiotic with a broad spectrum of biological activities. However, low aqueous solubility and poor knowledge of its chemical properties have limited the development of this natural product. Here, we present an original scheme for the introduction of aminoalkylamine residues at positions 3, 5, and 7 of heliomycin and, using this, have prepared a series of novel water-soluble derivatives. The addition of side chains to the heliomycin scaffold significantly improves their interaction with different DNA secondary structures. One derivative, 7-deoxy-7-(2-aminoethyl)amino-10-O-methylheliomycin (8e), demonstrated affinity, stabilization potential, and good selectivity toward i-motif-forming DNA sequences over the duplex and G-quadruplex. Heliomycin derivatives therefore represent promising molecular scaffolds for further development as DNA-i-motif interacting ligands and potential chemotherapeutic agents.


Assuntos
DNA/química , Compostos Policíclicos/química , Animais , Linhagem Celular , Quadruplex G , Humanos , Camundongos , Conformação de Ácido Nucleico , Solubilidade , Água
11.
Nucleic Acids Res ; 47(22): 11746-11754, 2019 12 16.
Artigo em Inglês | MEDLINE | ID: mdl-31722410

RESUMO

Liquid-liquid phase separation plays an important role in a variety of cellular processes, including the formation of membrane-less organelles, the cytoskeleton, signalling complexes, and many other biological supramolecular assemblies. Studies on the molecular basis of phase separation in cells have focused on protein-driven phase separation. In contrast, there is limited understanding on how RNA specifically contributes to phase separation. Here, we described a phase-separation-like phenomenon that SHORT ROOT (SHR) RNA undergoes in cells. We found that an RNA G-quadruplex (GQ) forms in SHR mRNA and is capable of triggering RNA phase separation under physiological conditions, suggesting that GQs might be responsible for the formation of the SHR phase-separation-like phenomenon in vivo. We also found the extent of GQ-triggered-phase-separation increases on exposure to conditions which promote GQ. Furthermore, GQs with more G-quartets and longer loops are more likely to form phase separation. Our studies provide the first evidence that RNA can adopt structural motifs to trigger and/or maintain the specificity of RNA-driven phase separation.


Assuntos
Quadruplex G , Transição de Fase , RNA/química , Arabidopsis/genética , Proteínas de Arabidopsis/química , Proteínas de Arabidopsis/genética , Extração Líquido-Líquido , Conformação de Ácido Nucleico , Raízes de Plantas/química , RNA/isolamento & purificação , RNA/fisiologia , RNA Mensageiro/química , RNA Mensageiro/isolamento & purificação , Fatores de Transcrição/química , Fatores de Transcrição/genética
12.
J Am Chem Soc ; 142(32): 13856-13866, 2020 08 12.
Artigo em Inglês | MEDLINE | ID: mdl-32786817

RESUMO

Cytosine-rich DNA can fold into secondary structures known as i-motifs. Mounting experimental evidence suggests that these non-canonical nucleic acid structures form in vivo and play biological roles. However, to date, there are no optical probes able to identify i-motif in the presence of other types of DNA. Herein, we report for the first time the interactions between the three isomers of [Ru(bqp)2]2+ with i-motif, G-quadruplex, and double-stranded DNA. Each isomer has vastly different light-switching properties: mer is "on", trans is "off", and cis switches from "off" to "on" in the presence of all types of DNA. Using emission lifetime measurements, we show the potential of cis to light up and identify i-motif, even when other DNA structures are present using a sequence from the promoter region of the death-associated protein (DAP). Moreover, separated cis enantiomers revealed Λ-cis to have a preference for the i-motif, whereas Δ-cis has a preference for double-helical DNA. Finally, we propose a previously unreported light-switching mechanism that originates from steric compression and electronic effects in a tight binding site, as opposed to solvent exclusion. Our work suggests that many published non-emissive Ru complexes could potentially switch on in the presence biological targets with suitable binding sites, opening up a plethora of opportunity in the detection of biological molecules.


Assuntos
Complexos de Coordenação/química , DNA/química , Rutênio/química , Cristalografia por Raios X , Teoria da Densidade Funcional , Simulação de Acoplamento Molecular , Estrutura Molecular , Motivos de Nucleotídeos , Solventes/química
13.
J Am Chem Soc ; 142(49): 20600-20604, 2020 12 09.
Artigo em Inglês | MEDLINE | ID: mdl-33253551

RESUMO

Guanine- and cytosine-rich nucleic acid sequences have the potential to form secondary structures such as G-quadruplexes and i-motifs, respectively. We show that stabilization of G-quadruplexes using small molecules destabilizes the i-motifs, and vice versa, indicating these gene regulatory controllers are interdependent in human cells. This has important implications as these structures are predominately considered as isolated structural targets for therapy, but their interdependency highlights the interplay of both structures as an important gene regulatory switch.


Assuntos
Quadruplex G , Sequência de Bases , Pontos de Checagem do Ciclo Celular/efeitos dos fármacos , Núcleo Celular/química , Núcleo Celular/metabolismo , Cromatina/metabolismo , Elipticinas/farmacologia , Quadruplex G/efeitos dos fármacos , Loci Gênicos , Humanos , Ligantes , Células MCF-7
14.
Biochemistry ; 58(4): 245-249, 2019 01 29.
Artigo em Inglês | MEDLINE | ID: mdl-30350580

RESUMO

Numerous studies have been published stressing the importance of finding ligands that can bind specifically to DNA secondary structures. Several have identified ligands that are presented as having specific binding to the G-quadruplex; however, these were not originally tested on the complementary i-motif structure. The i-motif was overlooked and presumed to be irrelevant due to the belief that the hemiprotonated (cytosine+-cytosine) base pair at the core of the structure required acidic pH. The pathophysiological relevance of i-motifs has since been documented, as well as the discovery of several genomic sequences, which can form i-motif at neutral pH. Using different biophysical methodologies, we provide experimental evidence to show that widely used G-quadruplex ligands interact with i-motif structures at neutral pH, generally leading to their destabilization. Crucially, this has implications both for the search for quadruplex binding compounds as well as for the effects of compounds reported to have G-quadruplex specificity without examining their effects on i-motif.


Assuntos
Quadruplex G , Motivos de Nucleotídeos , Acridinas/química , Acridinas/metabolismo , Aminoquinolinas/química , Aminoquinolinas/metabolismo , Proteínas Reguladoras de Apoptose/genética , Berberina/química , Berberina/metabolismo , Dicroísmo Circular , Concentração de Íons de Hidrogênio , Ligantes , Mitoxantrona/química , Mitoxantrona/metabolismo , Proteínas do Tecido Nervoso/genética , Ácidos Picolínicos/química , Ácidos Picolínicos/metabolismo , Porfirinas/química , Porfirinas/metabolismo , Temperatura de Transição
15.
Nucleic Acids Res ; 45(6): 2951-2959, 2017 04 07.
Artigo em Inglês | MEDLINE | ID: mdl-28180276

RESUMO

i-Motifs are alternative DNA secondary structures formed in cytosine-rich sequences. Particular examples of these structures, traditionally assumed to be stable only at acidic pH, have been found to form under near-physiological conditions. To determine the potential impact of these structures on physiological processes, investigation of sequences with the capacity to fold under physiological conditions is required. Here we describe a systematic study of cytosine-rich DNA sequences, with varying numbers of consecutive cytosines, to gain insights into i-motif DNA sequence and structure stability. i-Motif formation was assessed using ultraviolet spectroscopy, circular dichroism and native gel electrophoresis. We found that increasing cytosine tract lengths resulted in increased thermal stability; sequences with at least five cytosines per tract folded into i-motif at room temperature and neutral pH. Using these results, we postulated a folding rule for i-motif formation, analogous to (but different from) that for G-quadruplexes. This indicated that thousands of cytosine-rich sequences in the human genome may fold into i-motif structures under physiological conditions. Many of these were found in locations where structure formation is likely to influence gene expression. Characterization of a selection of these identified i-motif forming sequences uncovered 17 genomic i-motif forming sequence examples which were stable at neutral pH.


Assuntos
DNA/química , Sequência de Bases , Citosina/química , Genoma Humano , Humanos , Concentração de Íons de Hidrogênio , Conformação de Ácido Nucleico , Telômero/química , Temperatura
16.
Chemistry ; 24(14): 3613-3622, 2018 Mar 07.
Artigo em Inglês | MEDLINE | ID: mdl-29334159

RESUMO

Cyclometalated (C^N^C)AuIII complexes bearing functionalized N-heterocyclic carbene (NHC) ligands provide a high-yielding, modular route to bioconjugated and binuclear complexes. This methodology has been applied to the synthesis of bioconjugated complexes presenting biotin and 17α-ethynylestradiol vectors, as well as to the synthesis of bimetallic AuIII /AuI complexes. The in vitro antiproliferative activities of these compounds against various cancer cells lines depend on the linker length, with the longer linker being the most potent. The estradiol conjugate AuC6 Estra proved to be more toxic against the estrogen receptor positive (ER+) cancer cells than against the ER- cancer cells and non-cancer cells. The bimetallic complex AuC6 Au was more selective for breast cancer cells with respect to a healthy cell standard than the monometallic complex AuNHC. The metal uptake study on cells expressing or not biotin and estrogen receptors revealed an improved and targeted delivery of gold for both the bioconjugated complexes AuC6 Biot and AuC6 Estra compared to the non-vectorised analogue AuNHC. The investigations of the interaction of the bioconjugates and bimetallic complexes with human telomeric G-quadruplex DNA using FRET-melting techniques revealed a reduced ability to stabilize this DNA structure with respect to the non-vectorised analogue AuNHC.


Assuntos
Antineoplásicos/síntese química , Antineoplásicos/farmacologia , Compostos Organoáuricos/síntese química , Compostos Organoáuricos/farmacologia , Antineoplásicos/química , Linhagem Celular Tumoral , Proliferação de Células/efeitos dos fármacos , Ensaios de Seleção de Medicamentos Antitumorais , Humanos , Ligantes , Metano/análogos & derivados , Metano/química , Estrutura Molecular , Compostos Organoáuricos/química
17.
Biochemistry ; 56(36): 4879-4883, 2017 09 12.
Artigo em Inglês | MEDLINE | ID: mdl-28853563

RESUMO

Both 5-aza-2'-deoxycytidine (decitabine) and its primary breakdown product, 2'-deoxyriboguanylurea (GuaUre-dR), have been shown to act as mutagens and epimutagens that cause replication stress and alter both DNA methylation and gene expression patterns. As cytosine analogues, both are expected to be preferentially incorporated into regions of GC skew where runs of cytosine residues are sequestered on one strand and guanine residues on the other. Given that such regions have been identified as sites with the potential for effects on gene expression and replication stress linked to formation of alternative DNA secondary structures, it is of interest to determine the influence that these base analogues might have on the stability of structures of this kind. Here we report that incorporation of GuaUre-dR into an i-motif-forming sequence decreases both the thermal and pH stability of an i-motif despite the apparent ability of GuaUre-dR to base pair with cytosine.


Assuntos
Citosina/química , DNA/química , Desoxirribose/análogos & derivados , Guanidinas/química , Sequência de Bases , Dicroísmo Circular , Desoxirribose/química , Humanos , Conformação de Ácido Nucleico , Mutação Puntual
18.
Inorg Chem ; 56(10): 5728-5740, 2017 May 15.
Artigo em Inglês | MEDLINE | ID: mdl-28441013

RESUMO

The synthesis of a series of cyclometalated gold(III) complexes supported by pyrazine-based (C^N^C)-type pincer ligands is reported, including the crystal structure of a cationic example. The compounds provide a new platform for the study of antiproliferative properties of gold(III) complexes. Seven complexes were tested: the neutral series (C^Npz^C)AuX [X = Cl (1), 6-thioguanine (4), C≡CPh (5), SPh (6)] and an ionic series that included the N-methyl complex [(C^NpzMe^C)AuCl]BF4 (7) and the N-heterocyclic carbene complexes [(C^Npz^C)AuL]+ with L = 1,3-dimethylbenzimidazol-2-ylidene (2) or 1,3,7,9-tetramethylxanthin-8-ylidene (3). Tests against human leukemia cells identified 1, 2, 3, and 4 as particularly promising, whereas protecting the noncoordinated N atom on the pyrazine ring by methylation (as in 7) reduced the cytotoxicity. Complex 2 proved to be the most effective of the entire series against the HL60 leukemia, MCF-7 breast cancer, and A549 lung cancer cell lines, with IC50 values down to submicromolar levels, associated with a lower toxicity toward healthy human lung fibroblast cells. The benzimidazolylidene complex 2 accumulated more effectively in human lung cancer cells than its caffeine-based analogue 3 and the gold(III) chloride 1. Compound 2 proved to be unaffected by glutathione under physiological conditions for periods of up to 6 days and stabilizes the DNA G-quadruplex and i-motif structures; the latter is the first such report for gold compounds. We also show the first evidence of inhibition of MDM2-p53 protein-protein interactions by a gold-based compound and identified the binding mode of the compound with MDM2 using saturation transfer difference NMR spectroscopy combined with docking calculations.


Assuntos
Antineoplásicos/farmacologia , Metano/análogos & derivados , Compostos Organoáuricos/farmacologia , Pirazinas/farmacologia , Antineoplásicos/síntese química , Antineoplásicos/química , Linhagem Celular Tumoral , Proliferação de Células/efeitos dos fármacos , Cristalografia por Raios X , Relação Dose-Resposta a Droga , Ensaios de Seleção de Medicamentos Antitumorais , Polarização de Fluorescência , Humanos , Ligantes , Metano/química , Metano/farmacologia , Modelos Moleculares , Estrutura Molecular , Compostos Organoáuricos/síntese química , Compostos Organoáuricos/química , Pirazinas/química , Relação Estrutura-Atividade
19.
Org Biomol Chem ; 15(27): 5669-5673, 2017 Jul 21.
Artigo em Inglês | MEDLINE | ID: mdl-28567459

RESUMO

i-Motifs are quadruplex DNA structures formed from sequences rich in cytosine and held together by intercalated, hemi-protonated cytosine-cytosine base pairs. These sequences are prevalent in gene promoter regions and may play a role in gene transcription. Targeting these structures with ligands could provide a novel way to target genetic disease but there are very few ligands which have been shown to interact with i-motif DNA. Fluorescent intercalator displacement (FID) assays are a simple way to screen ligands against DNA secondary structures. Here we characterise how thiazole orange interacts with i-motif DNA and assess its ability for use in a FID assay. Additionally, we report FID-based ligand screening using thiazole orange against the i-motif forming sequence from the human telomere to reveal new i-motif binding compounds which have the potential for further development.


Assuntos
DNA/química , Corantes Fluorescentes/química , Substâncias Intercalantes/química , Sítios de Ligação , Ligantes , Estrutura Molecular , Motivos de Nucleotídeos
20.
Biochem Biophys Res Commun ; 447(1): 128-32, 2014 Apr 25.
Artigo em Inglês | MEDLINE | ID: mdl-24699415

RESUMO

The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5'-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3' using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K(+) ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.


Assuntos
Quadruplex G , Fator 2 Relacionado a NF-E2/química , Fator 2 Relacionado a NF-E2/genética , Regiões Promotoras Genéticas , Aminacrina/química , Sequência de Bases , Sítios de Ligação , Dicroísmo Circular , Ligantes , Ressonância Magnética Nuclear Biomolecular
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA