Evolutionary divergence of duplicated genomes in newly described allotetraploid cottons.

Allotetraploid cotton (Gossypium) species represents a model system for the study of plant polyploidy, molecular evolution, and domestication. Here, chromosome-scale genome sequences were obtained and assembled for two recently described wild species of tetraploid cotton, Gossypium ekmanianum [(AD)6, Ge] and Gossypium stephensii [(AD)7, Gs], and one early form of domesticated Gossypium hirsutum, race punctatum [(AD)1, Ghp]. Based on phylogenomic analysis, we provide a dated whole-genome level perspective for the evolution of the tetraploid Gossypium clade and resolved the evolutionary relationships of Gs, Ge, and domesticated G. hirsutum. We describe genomic structural variation that arose during Gossypium evolution and describe its correlates-including phenotypic differentiation, genetic isolation, and genetic convergence-that contributed to cotton biodiversity and cotton domestication. Presence/absence variation is prominent in causing cotton genomic structural variations. A presence/absence variation-derived gene encoding a phosphopeptide-binding protein is implicated in increasing fiber length during cotton domestication. The relatively unimproved Ghp offers the potential for gene discovery related to adaptation to environmental challenges. Expanded gene families enoyl-CoA δ isomerase 3 and RAP2-7 may have contributed to abiotic stress tolerance, possibly by targeting plant hormone-associated biochemical pathways. Our results generate a genomic context for a better understanding of cotton evolution and for agriculture.

Genome-wide association study for boll weight in Gossypium hirsutum races.

High yield has always been an essential target in almost all of the cotton breeding programs. Boll weight (BW) is a key component of cotton yield. Numerous linkage mapping and genome-wide association studies (GWAS) have been performed to understand the genetic mechanism of BW, but information on the markers/genes controlling BW remains limited. In this study, we conducted a GWAS for BW using 51,268 high-quality single-nucleotide polymorphisms (SNPs) and 189 Gossypium hirsutum accessions across five different environments. A total of 55 SNPs significantly associated with BW were detected, of which 29 and 26 were distributed in the A and D subgenomes, respectively. Five SNPs were simultaneously detected in two environments. For TM5655, TM8662, TM36371, and TM50258, the BW grouped by alleles of each SNP was significantly different. The ± 550 kb regions around these four key SNPs contained 262 genes. Of them, Gh_A02G1473, Gh_A10G1765, and Gh_A02G1442 were expressed highly at 0 to 1 days post-anthesis (dpa), - 3 to 0 dpa, and - 3 to 0 dpa in ovule of TM-1, respectively. They were presumed as the candidate genes for fiber cell differentiation, initiation, or elongation based on gene annotation of their homologs. Overall, these results supplemented valuable information for dissecting the genetic architecture of BW and might help to improve cotton yield through molecular marker-assisted selection breeding and molecular design breeding.

Genetic dissection of lint percentage in short-season cotton using combined QTL mapping and RNA-seq.

KEY MESSAGE: In total, 17 QTLs for lint percentage in short-season cotton, including three stable QTLs, were detected. Twenty-eight differentially expressed genes located within the stable QTLs were identified, and two genes were validated by qRT-PCR. The breeding and use of short-season cotton have significant values in addressing the question of occupying farmlands with either cotton or cereals. However, the fiber yields of short-season cotton varieties are significantly lower than those of middle- and late-maturing varieties. How to effectively improve the fiber yield of short-season cotton has become a focus of cotton research. Here, a high-density genetic map was constructed using genome resequencing and an RIL population generated from the hybridization of two short-season cotton accessions, Dong3 and Dong4. The map contained 4960 bin markers across the 26 cotton chromosomes and spanned 3971.08 cM, with an average distance of 0.80 cM between adjacent markers. Based on the genetic map, quantitative trait locus (QTL) mapping for lint percentage (LP, %), an important yield component trait, was performed. In total, 17 QTLs for LP, including three stable QTLs, qLP-A02, qLP-D04, and qLP-D12, were detected. Three out of 11 non-redundant QTLs overlapped with previously reported QTLs, whereas the other eight were novel QTLs. A total of 28 differentially expressed genes associated with the three stable QTLs were identified using RNA-seq of ovules and fibers at different seed developmental stages from the parental materials. The two genes, Ghir_A02G017640 and Ghir_A02G018500, may be related to LP as determined by further qRT-PCR validation. This study provides useful information for the genetic dissection of LP and promotes the molecular breeding of short-season cotton.

Phylogeny, gene structures, and expression patterns of the auxin response factor (GhARF2) in upland cotton (Gossypium hirsutum L.).

BACKGROUND: Auxin response factors (ARFs) are a class of transcription factors that regulate the expression of auxin-responsive genes and play important functions in plant growth and development. To understand the biological functions of the auxin response factor GhARF2 gene in upland cotton, the coding sequence (CDS) of GhARF2 gene was cloned, and its protein sequence, evolutionary relationship, subcellular localization and expression pattern were analysed. METHODS: The CDS sequence of GhARF2 gene was cloned from upland cotton variety Baimian No.1, and its protein sequence was analyzed by bioinformatics method. The subcellular localization of GhARF2 protein was detected by tobacco epidermal transient transformation system, and the tissue expression and stress expression pattern of GhARF2 were analyzed by quantitative Real­Time PCR (qRT-PCR). RESULTS: The full-length CDS of GhARF2 gene was 2583 bp, encoded 860 amino acids, and had a molecular weight and an isoelectric point of 95.46 KDa and 6.02, respectively. The GhARF2 protein had multiple phosphorylation sites, no transmembrane domain, and secondary structures dominated by random coils and alpha helix. The GhARF2 protein had 3 conserved typical domains of ARF gene family members, including the B3 DNA binding domain, the Auxin_resp domain, and the Aux/IAA domain. Phylogenetic analysis revealed that ARF2 proteins in different species were clustered in the Group A subgroup, in which GhARF2 was closely related to TcARF2 of Theobroma cacao L. (Malvaceae). The subcellular localization results showed that the GhARF2 protein was localized in the nucleus. Analysis of tissue expression pattern showed that the GhARF2 gene was expressed in all tested tissues, with the highest expression levels in sepal, followed by leaf, and the lowest expression levels in fiber. Further stress expression analysis showed that the GhARF2 gene was induced by drought, high-temperature, low-temperature and salt stress, and had different expression patterns under different stress conditions. CONCLUSION: These results established a foundation for understanding the functions of GhARF2 and breeding varieties with high-stress tolerance in cotton.

LINC00664/miR-411-5p/KLF9 feedback loop contributes to the human oral squamous cell carcinoma progression.

OBJECTIVES: Oral squamous cell carcinoma (OSCC) is one of the most aggressive head and neck cancers with high incidence. Multiple studies have revealed that long non-coding RNAs (lncRNAs) play pivotal roles in tumorigenesis. However, the role of long intergenic non-protein coding RNA 664 (LINC00664) on the progression of OSCC was still unclear. SUBJECTS AND METHODS: In this study, the expression of LINC00664 in OSCC tissues and cell lines was detected by quantitative real-time polymerase chain reaction (qRT-PCR). The functional role of LINC0664 was estimated by cell counting kit-8 (CCK-8), transwell assays, Western blot in vitro, and xenograft tumor model in vivo. The regulatory mechanism was investigated by RNA-binding protein immunoprecipitation (RIP), chromatin immunoprecipitation (ChIP), and luciferase reporter assays. RESULTS: LINC00664 was found to be upregulated in OSCC tissues and cell lines and was associated with poor prognosis of OSCC patients. LINC00664 knockdown suppressed OSCC cell proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT). Moreover, Kruppel like factor 9 (KLF9) enhanced LINC00664 expression at transcription level. Interestingly, LINC00664 upregulated KLF9 expression by sponging miR-411-5p. In addition, knockdown of LINC00664 restrained tumor growth of OSCC in vivo. CONCLUSION: Our study identified the oncogenic roles of LINC00664 in OSCC tumorigenesis and EMT via KLF9/LINC00664/miR-411-5p/KLF9 feedback loop, which provides new perspectives of the potential therapeutic target for OSCC.

Inhibition of EZH2 mitigates peritoneal fibrosis and lipid precipitation in peritoneal mesothelial cells mediated by klotho.

BACKGROUND: Peritoneal fibrosis caused by long-term peritoneal dialysis (PD) is the main reason why patients withdraw from PD treatment. Lipid accumulation in the peritoneum was shown to participate in fibrosis, and klotho is a molecule involved in lipid metabolism. GSK343 (enhancer of zeste 2 polycomb repressive complex 2 subunit (EZH2) inhibitor) has been verified to inhibit epithelial mesenchymal transdifferentiation (EMT) and peritoneal fibrosis, but its related mechanism remains unclear. This study aimed to investigate whether lipid accumulation was involved in the effect of GSK343 and its related mechanism. MATERIALS AND METHODS: First, the expression of EZH2, klotho and EMT indices in human peritoneal mesothelial cells (HMrSV5) incubated with high glucose (HG) levels was detected. After EZH2 was inhibited by GSK343, Western blot (WB), wound healing and Transwell assays were used to explore the effect of GSK343. EZH2 and klotho expression was also detected. Oil red O and Nile red staining and triglyceride (TG) detection kits were used to detect lipid accumulation. A rescue experiment with small interfering RNA specific for klotho (si-klotho) on the basis of GSK343 was also conducted to verify that GSK343 exerted its effect via klotho. In in vivo experiments, rats were administered GSK343, and the related index was assessed. RESULTS: In our study, we revealed that the expression of EZH2 was significantly upregulated and klotho was significantly downregulated in HMrSV5 cells induced by high glucose. With the aid of GSK343, we found that lipid deposition caused by HG was significantly decreased. In addition, EMT and fibrosis were also significantly alleviated. Moreover, GSK343 could also restore the downregulation of klotho. To further verify whether klotho mediated the effect of EZH2, a rescue experiment with si-klotho was also conducted. The results showed that si-klotho could counteract the protective effect of GSK343 on high glucose-induced lipid accumulation and fibrosis. In vivo experiments also revealed that GSK343 could relieve peritoneal fibrosis, lipid deposition and EMT by mitigating EZH2 and restoring klotho expression. CONCLUSIONS: Combining these findings, we found that EZH2 regulated lipid deposition, peritoneal fibrosis, and EMT mediated by klotho. To our knowledge, this is the first study to demonstrate the effect of the EZH2-klotho interaction on peritoneal fibrosis. Hence, EZH2 and klotho could act as potential targets for the treatment of peritoneal fibrosis.

Protective effect of thymol on glycerol-induced acute kidney injury.

Acute kidney injury (AKI) is a syndrome characterized by an accelerating decrease in renal function in a short time. Thymol is one of the main components of thyme species and has a variety of pharmacological effects. Here, we investigated whether thymol could ameliorate rhabdomyolysis (RM)-induced AKI and its related mechanism. Glycerol was used to induce RM-associated AKI in rats. Rats received thymol (20 mg/kg/day or 40 mg/kg/day) gavage 24 h before glycerol injection until 72 h after injection daily. Kidney injury was identified by measuring serum creatinine (Scr) and urea levels and by H&E and PAS staining and immunohistochemistry (the expression of proliferating cell nuclear antigen (PCNA)). Renal superoxide dismutase (SOD), malondialdehyde (MDA), and oxidative stress-related Nrf2/HO-1 signaling pathways were measured. The expression of the inflammatory markers TNF-α, IL-6, MCP-1, and NF-κB was assessed by ELISA and western blotting. Finally, the expression of the PI3K/Akt signaling pathway was detected by western blotting. Glycerol administration induced obvious renal histologic damage and increased Scr, urea, and PCNA expression. Notably, thymol treatment attenuated these structural and functional changes and prevented renal oxidative stress, inflammatory damage and PI3K/Akt pathway downregulation associated with glycerol-induced AKI. In conclusion, thymol might have potential applications in the amelioration of AKI via its antioxidant and anti-inflammatory effects and upregulation of the PI3K/Akt signaling pathway.

Sequence Characteristics and Expression Analysis of the Gene Encoding Sedoheptulose-1,7-Bisphosphatase, an Important Calvin Cycle Enzyme in Upland Cotton (Gossypium hirsutum L.).

Sedoheptulose-1,7-bisphosphatase (SBPase, EC 3.1.3.37) is a key enzyme in the plant Calvin cycle and one of the main rate-limiting enzymes in the plant photosynthesis pathway. Many studies have demonstrated that the SBPase gene plays an important role in plant photosynthetic efficiency, yield, and stress responses; however, few studies have been conducted on the function and expression of the GhSBPase gene in upland cotton. In this study, our results showed that the coding sequence (CDS) of GhSBPase gene was 1182 bp, encoding a protein with 393 amino acids. The GhSBPase protein had adenosine monophosphate (AMP) binding site and a FIG (FBPase/IMPase/glpX) domain, and had six Cys residues and a CGGT(A/Q)C motif that were involved in redox regulation in plants. Evolutionarily, the GhSBPase protein clustered into the dicotyledon subgroup and was most closely related to the tomato SlSBPase protein. Western-blot analysis further indicated that the GhSBPase gene was indeed the gene encoding the SBPase protein in upland cotton. The GhSBPase protein was localized in chloroplast, which was consistent with its function as a key enzyme in photosynthesis. The GhSBPase gene was specifically highly expressed in leaves, and its expression level was significantly lower in a yellow-green leaf mutant than in the wild type. Moreover, the GhSBPase expression was in response to drought, salt, high- and low-temperature stress, and exhibits different expression patterns. The GhSBPase promoter had the cis-acting elements in response to abiotic stress, phytohormone, and light. In addition, the GhSBPase expression was positively correlated with the chlorophyll fluorescence parameters, suggesting that changes in the expression of the GhSBPase had potential applicability in breeding for enhanced cotton photosynthetic efficiency. These results will help to understand the function of the GhSBPase gene in photosynthesis and the adaptability of plants to external stress and provide important gene information for the high-yield breeding of crops in the future.

Genome-Wide Association Study of Lint Percentage in Gossypium hirsutum L. Races.

Lint percentage is one of the most essential yield components and an important economic index for cotton planting. Improving lint percentage is an effective way to achieve high-yield in cotton breeding worldwide, especially upland cotton (Gossypium hirsutum L.). However, the genetic basis controlling lint percentage has not yet been systematically understood. Here, we performed a genome-wide association mapping for lint percentage using a natural population consisting of 189 G. hirsutum accessions (188 accessions of G. hirsutum races and one cultivar TM-1). The results showed that 274 single-nucleotide polymorphisms (SNPs) significantly associated with lint percentage were detected, and they were distributed on 24 chromosomes. Forty-five SNPs were detected at least by two models or at least in two environments, and their 5 Mb up- and downstream regions included 584 makers related to lint percentage identified in previous studies. In total, 11 out of 45 SNPs were detected at least in two environments, and their 550 Kb up- and downstream region contained 335 genes. Through RNA sequencing, gene annotation, qRT-PCR, protein-protein interaction analysis, the cis-elements of the promotor region, and related miRNA prediction, Gh_D12G0934 and Gh_A08G0526 were selected as key candidate genes for fiber initiation and elongation, respectively. These excavated SNPs and candidate genes could supplement marker and gene information for deciphering the genetic basis of lint percentage and facilitate high-yield breeding programs of G. hirsutum ultimately.

One-step hydrothermal synthesis of WS2 quantum dots as fluorescent sensor for sensitive and selective recognition of hemoglobin and cardiac biomarker myoglobin.

Transition metal dichalcogenide (TMD) dots exhibit excellent photoluminescence performance due to the quantum confinement effect and edge effect, and are extensively applied in electronic and optical devices, sensors, catalysis, and bioimaging. In this work, WS2 quantum dots (WS2 QDs) were prepared under a simple one-step hydrothermal method by optimizing the reaction conditions, and a quantum yield of 11.23% was achieved. The as-prepared WS2 QDs possess good photo-bleaching resistance, salt tolerance, and pH stability. The fluorescence investigations showed that the WS2 QDs acted as a highly efficient fluorescent sensor to detect hemoglobin (Hb) and cardiac biomarker myoglobin (Myo). The linear range was 1-600 µg/mL for Hb and 0.01-120 µg/mL for Myo, with detection limits as low as 260 and 7.6 ng/mL, respectively. Importantly, the WS2 QDs were used to determine the Hb/Myo content in human blood/serum samples, with satisfactory results, indicating that this technique holds promise for application in clinical diagnosis associated with Hb/Myo levels. To the best of our knowledge, this is the first example of TMD QDs without any modification as a fluorescent sensor for detecting Hb and Myo simultaneously.

Preoperative Cardiac Index as a Predictor of Maturation and Primary Patency of Radiocephalic Arteriovenous Fistula in Hemodialysis.

BACKGROUND: Radiocephalic arteriovenous fistula (RCAVF) is the best access modality to be considered initially when planning arteriovenous fistula (AVF) for maintenance hemodialysis. Considering the higher incidence of RCAVF failed maturation (M), it is important to perform proper preoperative evaluation and identification of high-risk patients. There has been no study on the influence of preoperative cardiac function on the M and patency of AVFs. The purpose of this investigation is to determine whether preoperative cardiac index (CI) is a predictor of M and primary patency of RCAVF. METHOD: A total of 365 end-stage renal disease patients undergoing RCAVF surgery were consecutively enrolled with a median follow-up time of 20 months in this prospective cohort study. Demographics, vascular diameters measured by duplex ultrasound examination, and CI measured by echocardiography, were analyzed for effect on RCAVF primary functional M and primary patency. RESULT: Patients in the group achieving primary RCAVF functional M had a significantly larger mean CI than the group with early RCAVF failure (2.93 ± 0.77 vs. 3.57 ± 0.76 L/min/m2, p < 0.001). The receiver operating characteristic curve was plotted and demonstrated that preoperative vein diameter and CI can predict failure of RCAVF M. The AUC of CI was higher (0.745 vs. 0.666). Multivariate regression analysis, adjusted for age, sex, diabetes, preoperative dialysis status and vessel diameters, showed that decreased CI remained associated with increased risk of failure of M (FM) and worse primary unassisted patency. The Kaplan-Meier survival analysis suggested that patients with CI <3 L/min/m2 had a worse primary unassisted patency rate at all time points compared with patients with CI ≥3 L/min/m2. CONCLUSION: This study demonstrated that preoperative CI was associated with RCAVF M and long-term patency. A decreased CI may be a possible predictor of an increased risk of FM and a shorter primary patency time.

Sequence Characteristics and Expression Analysis of GhCIPK23 Gene in Upland Cotton (Gossypium hirsutum L.).

CIPK (calcineurin B-like-interacting protein kinase) is a kind of serine/threonine protein kinase widely existing in plants, and it plays an important role in plant growth and development and stress response. To better understand the biological functions of the GhCIPK23 gene in upland cotton, the coding sequence (CDS) of the GhCIPK23 gene was cloned in upland cotton, and its protein sequence, evolutionary relationship, subcellular localization, expression pattern and cis-acting elements in the promoter region were analyzed. Our results showed that the full-length CDS of GhCIPK23 was 1368 bp, encoding a protein with 455 amino acids. The molecular weight and isoelectric point of this protein were 50.83 KDa and 8.94, respectively. The GhCIPK23 protein contained a conserved N-terminal protein kinase domain and C-terminal regulatory domain of the CIPK gene family member. Phylogenetic tree analysis demonstrated that GhCIPK23 had a close relationship with AtCIPK23, followed by OsCIPK23, and belonged to Group A with AtCIPK23 and OsCIPK23. The subcellular localization experiment indicated that GhCIPK23 was located in the plasma membrane. Tissue expression analysis showed that GhCIPK23 had the highest expression in petals, followed by sepals, and the lowest in fibers. Stress expression analysis showed that the expression of the GhCIPK23 gene was in response to drought, salt, low-temperature and exogenous abscisic acid (ABA) treatment, and had different expression patterns under different stress conditions. Further cis-acting elements analysis showed that the GhCIPK23 promoter region had cis-acting elements in response to abiotic stress, phytohormones and light. These results established a foundation for understanding the function of GhCIPK23 and breeding varieties with high-stress tolerance in cotton.

Genome-wide dissection of hybridization for fiber quality- and yield-related traits in upland cotton.

An evaluation of combining ability can facilitate the selection of suitable parents and superior F1 hybrids for hybrid cotton breeding, although the molecular genetic basis of combining ability has not been fully characterized. In the present study, 282 female parents were crossed with four male parents in accordance with the North Carolina II mating scheme to generate 1128 hybrids. The parental lines were genotyped based on restriction site-associated DNA sequencing and 306 814 filtered single nucleotide polymorphisms were used for genome-wide association analysis involving the phenotypes, general combining ability (GCA) values, and specific combining ability values of eight fiber quality- and yield-related traits. The main results were: (i) all parents could be clustered into five subgroups based on population structure analyses and the GCA performance of the female parents had significant differences between subgroups; (ii) 20 accessions with a top 5% GCA value for more than one trait were identified as elite parents for hybrid cotton breeding; (iii) 120 significant single nucleotide polymorphisms, clustered into 66 quantitative trait loci, such as the previously reported Gh_A07G1769 and GhHOX3 genes, were found to be significantly associated with GCA; and (iv) identified quantitative trait loci for GCA had a cumulative effect on GCA of the accessions. Overall, our results suggest that pyramiding the favorable loci for GCA may improve the efficiency of hybrid cotton breeding.

Faster lipid ß-oxidation rate by acetyl-CoA carboxylase 2 inhibition alleviates high-glucose-induced insulin resistance via SIRT1/PGC-1α in human podocytes.

Diabetic nephropathy (DN) is becoming a research hotspot in recent years because the prevalence is high and the prognosis is poor. Lipid accumulation in podocytes induced by hyperglycemia has been shown to be a driving mechanism underlying the development of DN. However, the mechanism of lipotoxicity remains unclear. Increasing evidence shows that acetyl-CoA carboxylase 2 (ACC2) plays a crucial role in the metabolism of fatty acid, but its effect in podocyte injury of DN is still unclear. In this study, we investigated whether ACC2 could be a therapeutic target of lipid deposition induced by hyperglycemia in the human podocytes. Our results showed that high glucose (HG) triggered significant lipid deposition with a reduced ß-oxidation rate. It also contributed to the downregulation of phosphorylated ACC2 (p-ACC2), which is an inactive form of ACC2. Knockdown of ACC2 by sh-RNA reduced lipid deposition induced by HG. Additionally, ACC2-shRNA restored the expression of glucose transporter 4 (GLUT4) on the cell surface, which was downregulated in HG and normalized in the insulin signaling pathway. We verified that ACC2-shRNA alleviated cell injury, apoptosis, and restored the cytoskeleton disturbed by HG. Mechanistically, SIRT1/PGC-1α is close related to the insulin metabolism pathway. ACC2-shRNA could restore the expression of SIRT1/PGC-1α, which was downregulated in HG. Rescue experiment revealed that inhibition of SIRT1 by EX-527 counteracted the effect of ACC2-shRNA. Taken together, our data suggest that podocyte injury mediated by HG-induced insulin resistance and lipotoxicity could be alleviated by ACC2 inhibition via SIRT1/PGC-1α.

Prevalence of the prelacrimal recess in maxillary sinus and its medial bony wall dimensions.

OBJECTIVE: To investigate the occurrence rate of the prelacrimal recess (PLR) and its medial bony wall dimensions based on the radiological analysis to help surgeons enhance the understanding of anatomic structures for the endoscopic prelacrimal recess approach. METHODS: Cone-beam computed tomography images of 255 patients were evaluated retrospectively. The prevalence of the PLR in maxillary sinus was investigated and the thickness of its medial bony wall was measured and statistically assessed. Meanwhile, the width of the PLR was measured. The correlation between the width of the PLR and its medial bony wall thickness was assessed. The data were compared between the left side and right side, male and female. RESULTS: The PLR was present in 82.5% of the maxillary sinus, with no significant differences between the left and right sides, as well as different gender groups. The mean thickness of the medial bony wall of the PLR was 2.84 ± 1.41 mm, without statistical difference between the left and right sides but significantly larger in males than in females. The mean width of the PLR was 4.62 ± 1.74 mm and it had a significant negative correlation with the thickness of the medial bony wall of the PLR. CONCLUSION: A large individual variation exists in the anatomy of PLR, including its prevalence and dimensions of its medial bony wall. When considering the intranasal endoscopic prelacrimal recess approach, the surgeons should carefully evaluate the anatomical structure of the PLR preoperatively so as to minimize the risks of surgical complications.

Host-induced gene silencing of the acetolactate synthases VdILV2 and VdILV6 confers resistance to Verticillium wilt in cotton (Gossypium hirsutum L.).

Cotton Verticillium wilt caused by Verticillium dahliae (V. dahliae) is one of the most destructive fungal diseases and is difficult to control. However, resistant germplasm resources are scarce in cotton. Many studies have shown that host-induced gene silencing (HIGS) is a practical and effective technology in crop disease prevention by silencing virulence genes of pathogens. Acetolactate synthase (ALS) contains a catalytic subunit ILV2 and a regulatory subunit ILV6, which catalyzes the first common step reaction in branched-chain amino acid (BCAA) biosynthesis. We identified two acetolactate synthases, VdILV2 and VdILV6, which are homologs of ILV2 and ILV6, respectively, in Magnaporthe oryzae. To characterize the function of VdILV2 and VdILV6 in V. dahliae, we suppressed their expression in the strong pathogenic isolate Vd991 by using HIGS technology. VdILV2- or VdILV6-silenced V. dahliae had a dramatic reduction in pathogenicity. The results indicated that VdILV2 and VdILV6 are involved in the pathogenicity of V. dahliae. HIGS of VdILV2 or VdILV6 provides a novel fungicide target and an effective control to resist Verticillium wilt caused by V. dahliae.

Genome sequencing of the Australian wild diploid species Gossypium australe highlights disease resistance and delayed gland morphogenesis.

The diploid wild cotton species Gossypium australe possesses excellent traits including resistance to disease and delayed gland morphogenesis, and has been successfully used for distant breeding programmes to incorporate disease resistance traits into domesticated cotton. Here, we sequenced the G. australe genome by integrating PacBio, Illumina short read, BioNano (DLS) and Hi-C technologies, and acquired a high-quality reference genome with a contig N50 of 1.83 Mb and a scaffold N50 of 143.60 Mb. We found that 73.5% of the G. australe genome is composed of various repeat sequences, differing from those of G. arboreum (85.39%), G. hirsutum (69.86%) and G. barbadense (69.83%). The G. australe genome showed closer collinear relationships with the genome of G. arboreum than G. raimondii and has undergone less extensive genome reorganization than the G. arboreum genome. Selection signature and transcriptomics analyses implicated multiple genes in disease resistance responses, including GauCCD7 and GauCBP1, and experiments revealed induction of both genes by Verticillium dahliae and by the plant hormones strigolactone (GR24), salicylic acid (SA) and methyl jasmonate (MeJA). Experiments using a Verticillium-resistant domesticated G. barbadense cultivar confirmed that knockdown of the homologues of these genes caused a significant reduction in resistance against Verticillium dahliae. Moreover, knockdown of a newly identified gland-associated gene GauGRAS1 caused a glandless phenotype in partial tissues using G. australe. The G. australe genome represents a valuable resource for cotton research and distant relative breeding as well as for understanding the evolutionary history of crop genomes.

Assessment of the prelacrimal recess in maxillary sinus in different sex and age groups using cone beam computed tomography (CBCT).

BACKGROUND: The intranasal endoscopic prelacrimal recess approach (PLRA) to the maxillary sinus (MS) has been reported to treat many MS and skull base diseases. However, previous studies revealed that the width of the prelacrimal recess (PLR) shows a large individual variation. The purpose of this study was to ascertain the prevalence of the PLR in MS according to gender and age. METHODS: A series of 701 maxillofacial cone beam computed tomography (CBCT) scans from adult patients were analyzed retrospectively. Patients were divided into five age groups (18-24 years, 25-34 years, 35-44 years, 45-54 years, and ≥ 55 years) and by sex. The frequencies of occurrence of the PLR in the MS were calculated and compared. RESULTS: According to the findings obtained from our study, PLR was present in 81.5% of maxillary sinuses. No differences were found when the data distributions of right and left sides were compared. For individuals, the right and left sides were not always symmetrical. The probability of PLR was lesser among women than among men, but this differences was not significant. Another finding of our study was that the percentage of PLR decreased with increasing age among patients aged < 55 years, however, increased again among patients aged ≥ 55 years. CONCLUSION: The anatomy of PLR varies among individuals. Careful analysis of individual anatomical structure characteristic is recommended when considering intranasal endoscopic PLRA to the MS. Besides, the age variation of PLR should be considered in order to avoid complications.

Verticillium dahliae VdTHI20, Involved in Pyrimidine Biosynthesis, Is Required for DNA Repair Functions and Pathogenicity.

Verticillium dahliae (V. dahliae) infects roots and colonizes the vascular vessels of host plants, significantly reducing the economic yield of cotton and other crops. In this study, the protein VdTHI20, which is involved in the thiamine biosynthesis pathway, was characterized by knocking out the corresponding VdTHI20 gene in V. dahliae via Agrobacterium tumefaciens-mediated transformation (ATMT). The deletion of VdTHI20 resulted in several phenotypic defects in vegetative growth and conidiation and in impaired virulence in tobacco seedlings. We show that VdTHI20 increases the tolerance of V. dahliae to UV damage. The impaired vegetative growth of ΔVdTHI20 mutant strains was restored by complementation with a functional copy of the VdTHI20 gene or by supplementation with additional thiamine. Furthermore, the root infection and colonization of the ΔVdTHI20 mutant strains were suppressed, as indicated by green fluorescent protein (GFP)-labelling under microscope observation. When the RNAi constructs of VdTHI20 were used to transform Nicotiana benthamiana, the transgenic lines expressing dsVdTHI20 showed elevated resistance to V. dahliae. Together, these results suggest that VdTHI20 plays a significant role in the pathogenicity of V. dahliae. In addition, the pathogenesis-related gene VdTHI20 exhibits potential for controlling V. dahliae in important crops.

Characterization on the conservation and diversification of miRNA156 gene family from lower to higher plant species based on phylogenetic analysis at the whole genomic level.

miRNA156 family members (miR156s) participate in regulating the transition of plant vegetative and reproductive growth, flower development, and formation of berry skin color by negatively modulating their target gene SPLs. However, the evolution and functional diversification of miR156s in plants remain elusive. Phylogenetic analysis on 310 miR156s from 51 plant species on miRBase 21.0 showed that only miR156a could be conserved in the 51 plant species, but their sequences exhibited variation; another set of miR156s, such as miR156m/n/o/p/q/r/s/t/u/v/w/x/y/z, was identified only in certain special plant species (Glycine max and Malus); also, all base variations in the sequences of 310 miR156s occurred within one miR156 seed sequence, "TGACAGAAGAGAGTGAGCAC," and the changed base sites were mainly located at the 11th and 14th bases from the 5' end of the miR156 seed sequence, in which some base variations of miR156s resulted in a difference in miR156 targeting modes; by contrast, miR156 precursor sequences are highly divergent across diverse species. Similarly, cis-regulatory motifs on the promoter sequence of MIR156s in various plants also exhibited significant discrepancy. The intragenic MIR156 genes overlapped their target SBP genes, thereby suggesting that some microRNAs (miRNAs) originate from duplication of target genes. These traits might be the reasons of the conservation and diversification of miR156 gene family. This study identified the conserved seed sequence "TGACAGAAGAGAGTGAGCAC," and the sequence variation characterization, of miR156 family evolution, also investigated the varied traits of their promoters, precursors, and mature sequences in sequence evolutions and found some miRNAs might originate from duplication of target genes. Our findings will contribute to our understanding of the functional diversification of miRNAs and the interactions of miRNA/target pairs based on the evolutionary history of miRNA genes.