Gestational diabetes mellitus is associated with distinct folate-related metabolites in early and mid-pregnancy: A prospective cohort study.

AIMS: This study aimed to evaluate the association between gestational diabetes mellitus (GDM) and circulating folate metabolites, folic acid (FA) intake, and the methylenetetrahydrofolate reductase (MTHFR) and methionine synthase reductase (MTRR) genotype. MATERIALS AND METHODS: A prospective pregnancy cohort study was conducted in Beijing, China, from 2022 to 2023. Circulating folate metabolites, including red blood cell (RBC) 5-methyltetrahydrofolate (5-MTHF), 5, 10-methylene-tetrahydrofolate (5,10-CH2-THF), 5- formyltetrahydrofolate (5-CHO-THF), and unmetabolised folic acid (UMFA), and plasma homocysteine (HCY), 5-MTHF, and methylmalonic acid (MMA), were determined at 6-17 weeks and 20-26 weeks of gestation. FA intake and the MTHFR and MTRR genotype were also examined. GDM was diagnosed between 24 and 28 weeks of pregnancy by a 75-g oral glucose tolerance test (OGTT). The association between the folate status and GDM was ascertained using multivariate generalised linear models, logistic regression models, and restricted cubic spline regression, adjusting for potential confounders. RESULTS: The study included 2032 pregnant women, of whom 392 (19.29%) developed GDM. UMFA above the 75th percentile (≥P75) [adjusted OR (aOR) (95% confidence interval [CI]) = 1.36 (1.01-1.84)], UMFA ≥ P90 [aOR (95% CI) = 1.82 (1.23-2.69)], and HCY ≥ P75 [aOR (95% CI) = 1.40 (1.04-1.88)] in early pregnancy, and RBC 5-MTHF [aOR (95% CI) = 1.48 (1.10-2.00)], RBC 5,10-CH2-THF [aOR (95% CI) = 1.55 (1.15-2.10)], and plasma 5-MTHF [aOR (95% CI) = 1.36 (1.00-1.86)] in mid-pregnancy ≥ P75 are associated with GDM. Higher UMFA levels in early pregnancy show positive associations with the 1-h and 2-h glucose levels during the OGTT, and higher HCY levels are associated with increased fasting glucose levels during the OGTT. In comparison, RBC 5- MTHF and 5,10-CH2-THF, and plasma 5- MTHF in mid-pregnancy are positively associated with the 1-h glucose level (p < 0.05). The MTHFR and MTRR genotype and FA intake are not associated with GDM. CONCLUSIONS: Elevated levels of UMFA and HCY during early pregnancy, along with elevated RBC 5-MTHF and 5,10-CH2-THF and plasma 5-MTHF during mid-pregnancy, are associated with GDM. These findings indicate distinct connections between different folate metabolites and the occurrence of GDM.

Low-dose aspirin for the prevention of preterm birth in nulliparous women: systematic review and meta-analysis.

OBJECTIVE: The objective was to assess the efficacy and safety of low-dose aspirin for the prevention of preterm birth in nulliparous women. DATA SOURCES: We searched PubMed, Embase and the Cochrane Central Register of Controlled Trials (CENTRAL) from inception to June 2022. STUDY ELIGIBILITY CRITERIA: Randomized controlled trials that compared aspirin to placebo in nulliparous women were eligible. METHODS: This study was reported in accordance with the PRISMA 2020 checklist. The primary outcomes of this study were the rates of preterm birth at less than 37 weeks and less than 34 weeks of gestation. The secondary outcomes included postpartum hemorrhage, placental abruption, cesarean section, any hypertensive disorder of pregnancy and small for gestational age. Relative risks with their 95% confidence intervals were calculated for analysis. Heterogeneity was assessed by Cochran's Q test and Higgins's I2. A random-effects model was used when I2 was > 50% to generate the RR and 95% CI; otherwise, a fixed-effects model was used. The risk of publication bias was assessed by funnel plots. We performed sensitivity analysis by sequentially omitting each included study to confirm the robustness of the analysis. RESULTS: Seven studies with a total of 29,029 participants were included in this review. Six studies were assessed as having a low risk of bias or an unclear risk of bias, and one study was judged as having a high risk of bias. In nulliparous women, low-dose aspirin was associated with a significant reduction in the rate of preterm birth at less than 34 weeks of gestational age (RR 0.84,95% CI: 0.71-0.99; I2 = 0%; P = 0.04), but we did not observe a significant difference in the rate of preterm birth at less than 37 weeks of gestation (RR 0.96,95% CI: 0.90-1.02; I2 = 31%; P = 0.18). Low-dose aspirin was associated with a significant increase in the rates of postpartum hemorrhage (RR 1.32,95% CI: 1.14-1.54; I2 = 0%; P = 0.0003), placental abruption (RR 2.18,95% CI: 1.10-4.32; I2 = 16%; P = 0.02) and cesarean section (RR 1.053, 95% CI: 1.001-1.108; I2 = 0%; P = 0.05) in nulliparous women. We also did not observe a significant effect of low-dose aspirin on the rates of any hypertensive disorder of pregnancy (RR 1.05, 95% CI: 0.96-1.14; I2 = 9%; P = 0.28) or small for gestational age (RR 0.96, 95% CI: 0.91-1.02; I2 = 0%; P = 0.16) in nulliparous women. Funnel plots indicated that no significant publication bias existed in this meta-analysis. Except for preterm birth at less than 34 weeks of gestation, placental abruption and cesarean section, the sensitivity analysis showed similar results, which confirmed the robustness of this meta-analysis. CONCLUSIONS: Low-dose aspirin might reduce the risk of preterm birth at less than 34 weeks of gestation in nulliparous women. The use of low-dose aspirin in nulliparous women increased the risk of postpartum hemorrhage and might increase the risk of placental abruption and cesarean section.

The influence of maternal prepregnancy weight and gestational weight gain on the umbilical cord blood metabolome: a case-control study.

BACKGROUND: Maternal overweight/obesity and excessive gestational weight gain (GWG) are frequently reported to be risk factors for obesity and other metabolic disorders in offspring. Cord blood metabolites provide information on fetal nutritional and metabolic health and could provide an early window of detection of potential health issues among newborns. The aim of the study was to explore the impact of maternal prepregnancy overweight/obesity and excessive GWG on cord blood metabolic profiles. METHODS: A case control study including 33 pairs of mothers with prepregnancy overweight/obesity and their neonates, 30 pairs of mothers with excessive GWG and their neonates, and 32 control mother-neonate pairs. Untargeted metabolomic profiling of umbilical cord blood samples were performed using UHPLC‒MS/MS. RESULTS: Forty-six metabolites exhibited a significant increase and 60 metabolites exhibited a significant reduction in umbilical cord blood from overweight and obese mothers compared with mothers with normal body weight. Steroid hormone biosynthesis and neuroactive ligand‒receptor interactions were the two top-ranking pathways enriched with these metabolites (P = 0.01 and 0.03, respectively). Compared with mothers with normal GWG, in mothers with excessive GWG, the levels of 63 metabolites were increased and those of 46 metabolites were decreased in umbilical cord blood. Biosynthesis of unsaturated fatty acids was the most altered pathway enriched with these metabolites (P < 0.01). CONCLUSIONS: Prepregnancy overweight and obesity affected the fetal steroid hormone biosynthesis pathway, while excessive GWG affected fetal fatty acid metabolism. This emphasizes the importance of preconception weight loss and maintaining an appropriate GWG, which are beneficial for the long-term metabolic health of offspring.

The clinical and metabolic characteristics of children and adolescents with hypothalamic dysfunction: A single-centre study from China.

OBJECTIVE: Hypothalamic dysfunction is characterized by complex aetiologies, multiple forms of onset and various clinical symptoms. This study aims to explore the clinical and metabolic characteristics of hypothalamic dysfunction in Chinese children and adolescents. DESIGN: This study is a single-centre, retrospective study that covers patients from 1989 to 2019. PATIENTS: We included 40 children and adolescents with hypothalamic dysfunction from our medical centre in Beijing, China. RESULTS: Intracranial tumour (37.5%) was the most common aetiology of children and adolescents with hypothalamic dysfunction, especially germ cell tumours, hypopituitarism (82.5%), weight gain (72.5%) and central diabetes insipidus (70.0%) were the most common symptoms in these patients. Furthermore, serum alanine aminotransferase, aspartate aminotransferase, γ-glutamyl transpeptidase, uric acid, total cholesterol, triglycerides and low-density lipoprotein cholesterol was significantly higher in hypothalamic dysfunction patients than sex- and age-matched controls and sex, age and body mass index (BMI)-matched controls (all p < 0.05). However, albumin and high-density lipoprotein cholesterol were lower (p< 0.05). Moreover, 95% (38/40) of the patients had metabolic diseases. In addition, the incidence of dyslipidaemia and hyperuricemia in children and adolescents with hypothalamic dysfunction was significantly higher than both sex- and age-matched controls and sex-, age- and BMI-matched controls (both p < 0.05) as well. CONCLUSIONS: Intracranial tumour was the most common aetiology in children and adolescents with hypothalamic dysfunction. In addition, these patients presented a worse metabolic profile on average than healthy patients.

Pregnancy outcomes and neonatal thyroid function in women with thyroid cancer: a retrospective study.

BACKGROUND: Evidence regarding adverse pregnancy outcomes in patients with thyroid cancer has been conflicting, and the effect of thyroid dysfunction caused by thyroid hormone suppression therapy in terms of neonatal thyroid stimulating hormone (TSH) is unclear. This study aimed to investigate whether thyroid cancer was associated with adverse pregnancy outcomes and had an adverse effect on neonatal thyroid function. METHODS: This was a retrospective study of 212 singleton pregnancies with thyroid cancer and 35,641 controls without thyroid cancer. Data on maternal pregnancy outcomes and neonatal outcomes were analyzed. RESULTS: The median TSH level in the thyroid cancer group was significantly lower than that in the control group (0.87 µIU/mL vs. 1.17 µIU/mL; P < 0.001), while the FT4 level was higher than that in the control group (17.16 pmol/L vs. 16.33 pmol/L; P < 0.001). The percentage of thyroid peroxidase antibodies (TPOAb) positive in the thyroid cancer group was significantly higher than that in the control group (25.0% vs. 11.8%; P < 0.001). Pregnancies with thyroid cancer had a higher risk of late miscarriage (OR 7.166, 95% CI: 1.521, 33.775, P = 0.013), after adjusting maternal TPOAb positive, there was no statistical significance (OR 3.480, 95% CI: 0.423, 28.614, P = 0.246). Pregnancies with thyroid cancer had higher gestational weight gain (GWG) (14.0 kg vs. 13.0 kg, P < 0.001). Although there was no significant difference in the prevalence of gestational diabetes mellitus (GDM) (20.8% vs. 17.4%, P = 0.194), the oral glucose tolerance test (OGTT) showed that fasting plasma glucose and 2-hour value in the thyroid cancer group were higher than those in the control group (P = 0.020 and 0.004, respectively). There was no statistically significant difference in TSH between the thyroid cancer group and the control group, regardless of full-term newborns or preterm newborns. CONCLUSIONS: Thyroid cancer might not have substantial adverse effects on pregnancy outcomes except for excessive GWG. No adverse effect on neonatal TSH was found, but the effect on long-term thyroid function and neuropsychological function in offspring need further study. TRIAL REGISTRATION: Beijing Birth Cohort Study (ChiCTR220058395).

Weight gain after diagnosis of gestational diabetes mellitus and its association with adverse pregnancy outcomes: a cohort study.

BACKGROUND: Gestational diabetes mellitus (GDM) and excessive body weight are two key risk factors for adverse perinatal outcomes. However, it is not clear whether restricted gestational weight gain (GWG) is favorable to reduce the risk for adverse pregnancy and neonatal outcomes in women with GDM. Therefore, this study aimed to assess the association of GWG after an oral glucose tolerance test with maternal and neonatal outcomes. METHODS: This prospective cohort study assessed the association of GWG after an oral glucose tolerance test (OGTT) with pregnancy and neonatal outcomes in 3126 women with GDM, adjusted for age, pre-pregnancy body mass index, height, gravidity, parity, adverse history of pregnancy, GWG before OGTT, blood glucose level at OGTT and late pregnancy. The outcomes included the prevalence of pregnancy-induced hypertension (PIH) and preeclampsia, large for gestational age (LGA), small for gestational age, macrosomia, low birth weight, preterm birth, and birth by cesarean section. GDM was diagnosed according to the criteria established by the International Association of Diabetes and Pregnancy Study Groups. RESULTS: GWG after OGTT was positively associated with risk for overall adverse pregnancy outcomes (adjusted odds ratio [aOR] = 1.72, 95% confidence interval [CI] = 1.50-1.97), LGA (aOR = 1.29, 95%CI = 1.13-1.47), macrosomia (aOR = 1.24, 95%CI = 1.06-1.46) and birth by cesarean section (aOR = 1.91, 95%CI = 1.67-2.19) in women with GDM. Further analyses revealed that a combination of excessive GWG before OGTT and after OGTT increased the risk of PIH and preeclampsia, LGA, macrosomia, and birth by cesarean section compared with adequate GWG throughout pregnancy. In contrast, GWG below the Institute of Medicine guideline after OGTT did not increase the risk of adverse perinatal outcomes despite GWG before OGTT. CONCLUSION: Excessive GWG after OGTT was associated with an elevated risk of adverse pregnancy outcomes, while insufficient GWG after OGTT did not increase the risk of LBW. Restricting GWG after diagnosis of GDM in women with excessive GWG in the first half of pregnancy may be beneficial to prevent PIH and preeclampsia, LGA, macrosomia, and birth by cesarean section.

Relationship between the duration of smoking and blood pressure in Han and ethnic minority populations: a cross-sectional study in China.

BACKGROUND: Evidence for correlation between the cigarette use and blood pressure change remains ambiguous. This study modelled relationship between the duration of smoking and systolic blood pressure in a large national multi-ethnic cross-sectional survey in China. METHODS: Participants were selected through a multi-stage probability sampling procedure from 2012 to 2017. Former or current smokers were included in this study, whose smoking behaviour, blood pressure, and other demographic information were collected and measured through a face-to-face interview. Linear and non-linear relationships between the duration of smoking and systolic blood pressure were analysed and differences of the association between Han and minority populations were specially checked. RESULTS: A total of 8801 participants were enrolled in this study. Prevalence of hypertension was 41.3 and 77.8% were current smokers. For every additional year of smoking duration, systolic blood pressure raised by 0.325 mmHg (95% CI 0.296 to 0.354 mmHg, P <  0.001). The Chinese minority populations may suffer more from the elevated blood pressure in long-term smoking than Han populations (0.283 mmHg (95% CI 0.252 to 0.314 mmHg, P <  0.001) versus 0.450 mmHg (95% CI 0.380 to 0.520 mmHg, P <  0.001) raise in systolic blood pressure with each additional year of smoking in minority and Han populations). CONCLUSIONS: Smoking is associated with raised systolic blood pressure in Chinese population. This association is notedly stronger in Chinese minority populations.

A Chinese patient with 11ß-hydroxylase deficiency due to novel compound heterozygous mutation in CYP11B1 gene: a case report.

BACKGROUND: Congenital adrenal hyperplasia (CAH) resulting from steroid 11ß-hydroxylase deficiency (11ß-OHD) is caused by mutations in the CYP11B1 gene. It is the second major form of CAH associated with hypertension and hypopotassemia. The aim of this study was to provide a genetic analysis of 11ß-OHD in a Chinese family. CASE PRESENTATION: A 19-year-old Chinese man was clinically diagnosed with 11ß-OHD. His initial clinical manifestations included precocious puberty, hyperpigmentation, hypertension, and hypopotassemia. The patient had taken an overdose of dexamethasone (0.75 mg/d) for more than 10 years before finally developing iatrogenic Cushing's syndrome. Our aim was to perform a molecular diagnosis of his family. Mutations in the CYP11B1 gene of the patient and his parents were examined using polymerase chain reaction (PCR) resequencing. Additionally, to predict the possible effects of novel mutations on the structure and function of 11ß-hydroxylase, these mutations were analyzed by MutationTaster software. Two novel pathogenic mutations were found in the CYP11B1 gene: a heterozygous in-frame insertion deletion mutation c.1440_1447delinsTAAAAG in exon 9 inherited from the father and a heterozygous mutation c.1094_1120delTGCGTGCGGCCCTCAAGGAGACCTTGC (p.364_372del) in exon 6 inherited from the mother. CONCLUSIONS: A clear genetic diagnosis can be made by analyzing the functional and structural consequences of CYP11B1 gene mutations that lead to 11ß-OHD. Because the dosage of glucocorticoid should be adjusted to minimize the risk of iatrogenic Cushing's syndrome, clinical follow-up should be conducted with these patients.

Gestational weight gain and pregnancy outcomes in Chinese women with type 2 diabetes mellitus: evidence from a tertiary hospital in Beijing.

Objective: To examine the effects of gestational weight gain on pregnancy outcomes and determine the optimal range of weight gain during pregnancy for Chinese women with type 2 diabetes mellitus. Methods: This retrospective cohort study included 691 Chinese women with type 2 diabetes mellitus from 2012 to 2020. The study utilized a statistical-based approach to determine the optimal range of gestational weight gain. Additionally, multivariate logistic regression analysis was conducted to assess the impact of gestational weight gain on pregnancy outcomes. Results: (1) In the obese subgroup, gestational weight gain below the recommendations was associated with decreased risks of large for gestational age (adjusted odds ratio [aOR] 0.19; 95% confidence interval [CI] 0.06-0.60) and macrosomia (aOR 0.18; 95% CI 0.05-0.69). In the normal weight subgroup, gestational weight gain below the recommendations of the Institute of Medicine was associated with decreased risks of preeclampsia (aOR 0.18; 95% CI 0.04-0.82) and neonatal hypoglycemia (aOR 0.38; 95% CI 0.15-0.97). (2) In the normal weight subgroup, gestational weight gain above the recommendations of the Institute of Medicine was associated with an increased risk of large for gestational age (aOR 4.56; 95% CI 1.54-13.46). In the obese subgroup, gestational weight gain above the recommendations was associated with an increased risk of preeclampsia (aOR 2.74; 95% CI 1.02, 7.38). (3) The optimal ranges of gestational weight gain, based on our study, were 9-16 kg for underweight women, 9.5-14 kg for normal weight women, 6.5-12 kg for overweight women, and 3-10 kg for obese women. (4) Using the optimal range of gestational weight gain identified in our study seemed to provide better prediction of adverse pregnancy outcomes. Conclusion: For Chinese women with type 2 diabetes, inappropriate gestational weight gain is associated with adverse pregnancy outcomes, and the optimal range of gestational weight gain may differ from the Institute of Medicine recommendations.

Label-free electrochemical biosensor based on dual amplification of gold nanoparticles and polycaprolactones for CEA detection.

Carcinoembryonic Antigen (CEA), an acidic glycoprotein with human embryonic antigen properties, is found on the surface of cancer cells that have differentiated from endodermal cells. This paper presents a label-free electrochemical immunoassay for the dual amplification detection of CEA using gold nanoparticles loaded with polypyrrole polydopamine (Au/PPy-PDA) and polymerized polycaprolactone (Ng-PCL) prepared by ring-opening polymerization (ROP). First, the composite Au/PPy-PDA was adhered to the electrode surface. Then, gold nanoparticles form a Au-S bond with the sulfhydryl group in Apt1 to secure it on the electrode surface. Subsequently, the non-specific binding sites on the electrodes surface are closed by bovine serum albumin (BSA). Next, CEA is dropped onto the electrode surface, which is immobilized by antigen-antibody specific recognition, and the carboxyl-functionalized Apt2 forms a "sandwich structure" of antibody-antigen-antibody by specific recognition. Polymeric Ng-PCL is adhered to the electrode surface, leading to an increase in the electrochemical impedance signal, resulting in a complete chain of signal analysis. Finally, the response signal is detected by electrochemical impedance spectroscopy (EIS). Under optimal experimental conditions, the method has the advantages of high sensitivity and wide linear range (1 pg mL-1∼100 ng mL-1), and the lower limit of detection (LOD) is 0.234 pg mL-1. And it has the same high sensitivity, selectivity and interference resistance for the real samples detection. Thus, it provides a new way of thinking about biomedical and clinical diagnosis.

Neonatal Amino Acids and Acylcarnitines Associated With Maternal Blood Glucose Levels Throughout Pregnancy: Insights From the Beijing Birth Cohort Study.

OBJECTIVE: To determine the association between maternal blood glucose patterns throughout pregnancy and neonatal amino acids and acylcarnitines. RESEARCH DESIGN AND METHODS: We conducted a prospective cohort study involving 11,457 singleton pregnant women without preexisting diabetes from the Beijing Birth Cohort Study, along with their neonates born between July 2021 and October 2022 in Beijing, China. Distinct maternal glucose trajectories were identified using a latent class model based on blood glucose levels across the three trimesters, and their association with neonatal circulating metabolites, including 11 amino acids and 33 acylcarnitines, was examined, adjusting for potential confounding factors. RESULTS: Three distinct groups of maternal glucose trajectories were identified: consistent normoglycemia (n = 8,648), mid-to-late gestational hyperglycemia (n = 2,540), and early-onset hyperglycemia (n = 269). Mid-to-late gestational hyperglycemia was associated with decreased levels of amino acids (alanine, arginine, ornithine, and proline) involved in the arginine and proline metabolism and urea cycle pathway, as well as increased levels of C4DC+C5-OH and decreased level of C6DC and C10:1. Early-onset hyperglycemia was associated with elevated levels of free acylcarnitine and C4DC+C5-OH and a decreased level of C10:1, involved in the fatty acid oxidation pathway. However, these associations were primarily observed in male neonates rather than in female neonates. CONCLUSIONS: Our findings revealed a significant link between maternal glucose trajectories throughout pregnancy and neonatal arginine and proline metabolism, urea cycle pathway, and fatty acid oxidation pathway. These results highlight the importance of maintaining optimal blood glucose levels throughout pregnancy to promote healthy neonatal metabolic outcomes.

The association between gestational weight trajectories in women with gestational diabetes and their offspring's weight from birth to 40 months.

AIMS: To identify the gestational weight gain (GWG) patterns in women with gestational diabetes mellitus (GDM) and evaluate their association with offspring weight status from birth to 40 months. MATERIALS AND METHODS: This study included 2,723 GDM-mother-child pairs from the Beijing Birth Cohort Study. The association between GWG trajectories identified by the latent class model and offspring weight outcomes from birth to 40 months were evaluated, after adjustment for maternal age, parity, pre-pregnancy body mass index, maternal height, and blood glucose levels. RESULTS: Three GWG rate groups, including the non-excessive GWG group (1,994/2,732), excessive GWG group (598 /2,732), and excessive early GWG group (140/2,732), were identified in women with GDM, respectively. Compared to the non-excessive GWG group, the adjusted OR (aOR) and 95% CI were 1.83 (1.35-2.47) and 1.79 (1.06-3.01) for macrosomia, 1.33 (1.07-1.66) and 1.48 (1.01-2.17) for large for gestational age (LGA) in the excessive GWG group and excessive early GWG group. Excessive GWG was also associated with an increased risk of BMI-for-age at 40 months (aOR = 1.66, 95% CI 1.14-2.42). CONCLUSIONS: Both excessive GWG and excessive early GWG increased the risk of macrosomia and LGA in women with GDM, but only the excessive GWG was associated with childhood overweight/obesity. The results suggest the long-term impact of GWG on offspring weight status in women with GDM and the potential benefits of GWG restriction after GDM diagnosis.

Dynamic changes in blood lipid levels and their associations with hypertensive disorders of pregnancy in twin pregnancy: A retrospective study.

BACKGROUND: Little knowledge on the association of blood lipid levels with hypertensive disorders of pregnancy (HDP) in twin pregnancy. OBJECTIVE: To investigate the association of blood lipid levels with HDP in twin pregnancy. METHODS: This is a retrospective study in the Beijing Birth Cohort on patients followed between January 2014 and November 2021. A total of 2628 women pregnant with twins were included and divided into HDP (n = 565) and normal blood pressure (NBP, n = 2063) groups. HDP subtypes included gestational hypertension (GH, n = 190) and preeclampsia (PE, n = 375). Dynamic changes in blood lipid profiles and their associations with HDP were assessed. RESULTS: Compared to NBP group, higher triglyceride (TG) and low-density lipoprotein  cholesterol (LDL-c) in the first (T1) and second trimesters (T2) existed in women with PE. In addition, TG increased significantly from T1 to T2, and high-density lipoprotein cholesterol (HDL-c) decreased significantly since T2 in women with PE, especially in women with early-onset PE and severe PE. Elevated TG and LDL-c were associated with HDP, mainly PE. In a subgroup analysis, higher TG or LDL-c increased the risk of HDP for underweight, overweight and primipara women. CONCLUSIONS: In twin pregnancy, women with PE had higher TG and LDL-c, and elevated TG and LDL-c were associated with PE. A significant increase in TG or decrease in HDL-c were more prone to PE, especially early-onset PE and severe PE. It is helpful to monitor blood lipid levels in women pregnant with twins, especially in underweight, overweight, and primipara women.

Dynamic changes of serum taurine and the association with gestational diabetes mellitus: A nested case-control study.

Objective: There is a lack of risk factors that can effectively identify gestational diabetes mellitus (GDM) in early pregnancy. It is unclear whether serum taurine in the first trimester and dynamic changes have different characteristics in GDM women. Whether these features are associated with the occurrence of GDM has not yet been elucidated. The main objective of this study was to observe the dynamic changes of serum taurine during pregnancy and investigate the relationship between serum taurine levels and GDM in the first and second trimesters. Methods: This was a nested case-control study in 47 women with GDM and 47 age-matched normoglycemic women. We examined serum taurine at 8-12 weeks' gestation and 24-28 weeks' gestation. The serum taurine of the two groups was compared. Multivariable logistic regression analysis was performed to investigate how serum taurine was associated with GDM. Results: The serum taurine concentration of GDM women was significantly lower than that of normoglycemic women in the first trimester(2.29 vs 3.94 µmol/L, P<0.001). As the pregnancy progressed, serum taurine concentration in normoglycaemic women decreased significantly(3.94 vs 2.47 µmol/L, P<0.001), but not in the GDM group(2.29 vs 2.37 µmol/L, P=0.249), resulting in the disappearance of differences between the two groups(2.47 vs 2.37 µmol/L, P=0.160). After adjustment for pre-pregnancy body mass index(BMI), fasting plasma glucose(FPG), and lipid profiles in the first trimester, the serum taurine concentration in the first trimester was negatively correlated with the risk of GDM(OR=0.017, 95% CI=0.003-0.107, P<0.001). Furthermore, dynamic change of serum taurine showed a significantly positive correlation with the risk of GDM(OR=9.909, 95% CI=3.556-27.610, P<0.001). Conclusion: Low serum taurine concentration in the first trimester was significantly associated with the development of GDM. As the pregnancy progressed, the association between serum taurine and GDM disappeared in the second trimester, which might be related to the inhibition of taurine transporter(TauT) activity by high glucose.

Maternal weight, blood lipids, and the offspring weight trajectories during infancy and early childhood in twin pregnancies.

BACKGROUND: The intrauterine environment has a profound and long-lasting influence on the health of the offspring. However, its impact on the postnatal catch-up growth of twin children remains unclarified. Therefore, this study aimed to explore the maternal factors in pregnancy associated with twin offspring growth. METHODS: This study included 3142 live twin children born to 1571 mothers from the Beijing Birth Cohort Study conducted from 2016 to 2021 in Beijing, China. Original and corrected weight-for-age standard deviation scores of the twin offspring from birth to 36 months of age were calculated according to the World Health Organization Child Growth Standards. The corresponding weight trajectories were identified by the latent trajectory model. Maternal factors in pregnancy associated with the weight trajectories of the twin offspring were examined after adjustment for potential confounders. RESULTS: Five weight trajectories of the twin children were identified, with 4.9% (154/3142) exhibiting insufficient catch-up growth, 30.6% (961/3142), and 46.8% (1469/3142) showing adequate catch-up growth from different birth weights, and 15.0% (472/3142) and 2.7% (86/3142) showing various degrees of excessive catch-up growth. Maternal short stature [adjusted odds ratio (OR) = 0.691, 95% confidence interval (CI) = 0.563-0.848, P = 0.0004] and lower total gestational weight gain (GWG) (adjusted OR = 0.774, 95% CI = 0.616-0.972, P = 0.03) were associated with insufficient catch-up growth of the offspring. Maternal stature (adjusted OR = 1.331, 95% CI = 1.168-1.518, P < 0.001), higher pre-pregnancy body mass index (BMI) (adjusted OR = 1.230, 95% CI = 1.090-1.387, P < 0.001), total GWG (adjusted OR = 1.207, 95% CI = 1.068-1.364, P = 0.002), GWG rate (adjusted OR = 1.165, 95% CI = 1.027-1.321, P = 0.02), total cholesterol (TC) (adjusted OR = 1.150, 95% CI = 1.018-1.300, P = 0.03) and low-density lipoprotein-cholesterol (LDL-C) (adjusted OR = 1.177, 95% CI = 1.041-1.330) in early pregnancy were associated with excessive growth of the offspring. The pattern of weight trajectories was similar between monochorionic and dichorionic twins. Maternal height, pre-pregnancy BMI, GWG, TC and LDL-C in early pregnancy were positively associated with excess growth in dichorionic twins, yet a similar association was observed only between maternal height and postnatal growth in monochorionic twins. CONCLUSION: This study identified the effect of maternal stature, weight status, and blood lipid profiles during pregnancy on postnatal weight trajectories of the twin offspring, thereby providing a basis for twin pregnancy management to improve the long-term health of the offspring.

Associations of gestational weight gain with birth weight outcomes in early pregnancy weight loss women: Findings from the Beijing Birth Cohort Study.

OBJECTIVE: To explore the relationship between gestational weight gain (GWG) and birth weight outcomes and establish suggested GWG patterns in early pregnancy weight loss women. METHODS: This retrospective study was conducted based on the Beijing Birth Cohort Study from 2014 to 2021 and included 20 688 women. Weight change in early pregnancy was calculated using weight measurements within 16 weeks of gestation. Multivariable logistic regression was used to analyze the relationships of different GWG categories, based on the Chinese standard, and birth weight outcomes. The statistical-based approach was used to determine the optimal GWG ranges and weekly weight gain. RESULTS: Compared to 3313 women who gained appropriate weight in early pregnancy, 2614 women who lost weight in the same period increased the risk of small for gestational age (SGA) (OR = 1.43, 95% CI: 1.14-1.80, P = 0.002). However, the relationship disappeared after adjusting for total GWG. Among the early pregnancy weight loss women, both excessive GWG and inadequate GWG were associated with adverse birth weight outcomes after adjusting for confounders. The suggested GWG range and rate were 11.0 ~ 16.0 kg and 0.46 to 0.67 kg/week from 16 weeks to delivery for women with normal body mass index (BMI) and weight loss in early pregnancy. CONCLUSION: Weight loss in early pregnancy was not the independent risk factor of birth weight outcomes. GWG may offset the expected effects. To achieve optimal outcomes, women with normal BMI and weight loss in early pregnancy need to have a higher weight gain rate in mid-late pregnancy but similar total GWG ranges with the Chinese standard for general women.

Association between serum lipid profile during the first and second trimester of pregnancy as well as their dynamic changes and gestational diabetes mellitus in twin pregnancies: a retrospective cohort study.

BACKGROUND: Abnormal lipid metabolism is associated with gestational diabetes mellitus (GDM) in singleton pregnancies. Data were lacking on twin pregnancies with GDM. We explored the association between serum lipid profiles in the first and second trimesters as well as their dynamic changes and GDM in twin pregnancies. METHODS: This was a retrospective cohort study of 2739 twin pregnancies that underwent a 75-g oral glucose tolerance test (OGTT) and were selected from the Beijing Birth Cohort Study from June 2013 to May 2021. Cholesterol (CHO), triglyceride (TG), high-density lipoprotein (HDL) and low-density lipoprotein (LDL) levels were measured at mean 9 and 25 weeks of gestation. We described maternal lipid levels in different tertiles that were associated with the risk of GDM stratified for age, pre-BMI, and fertilization type. GDM patients were divided into two groups according to OGTT: elevated fasting plasma glucose only (FPG group) and the rest of the GDM (non-FPG group). We estimated the relative risk of GDM with multivariable logistic regression models. RESULTS: In this study, we found that 599 (21.9%, 599/2739) twin pregnancies developed GDM. They had increased CHO, TG, LDL, and LDL/HDL, decreased HDL levels in the first trimester, and increased TG as well as decreased HDL in the second trimester in univariate analyses, each P < 0.05. In multivariate analysis, when TG > 1.67 mmol/l (upper tertile) in elderly individuals, nonoverweight and ART groups increased the risk of GDM by 2.7-fold, 2.3-fold and 2.2-fold, respectively, compared with TG < 0.96 mmol/l (lower tertile). This effect remained in the abovementioned groups in the second trimester. Moreover, high TGs increased the risk of GDM in the FPG group (OR = 2.076, 95% CI 1.130-3.815) and non-FPG group (OR = 2.526, 95% CI 1.739-3.67) in the first trimester when TG > 1.67 mmol/l, and the rising risk in the non-FPG group as the TG tertile increased remained in the second trimester. HDL predominantly showed a negative association with elevated FPG in the second trimester (p < 0.05). CONCLUSIONS: Twin pregnancies with GDM have higher lipid levels. Increased TGs in the first and second trimesters are strongly associated with GDM, especially in elderly individuals, nonoverweight and ART groups. Lipid profiles varied among different GDM subtypes.

Maternal and infant outcomes in women with and without gestational diabetes mellitus in the COVID-19 era in China: Lessons learned.

Aims: The global COVID-19 pandemic has required a drastic transformation of prenatal care services. Whether the reformulation of the antenatal care systems affects maternal and infant outcomes remains unknown. Particularly, women with gestational diabetes mellitus (GDM) are among those who bear the greatest brunt. Thus, this study aimed to evaluate the impact of COVID-19 lockdown during late pregnancy on maternal and infant outcomes in women stratified by the GDM status in China. Study design: The participants were women who experienced the COVID-19 lockdown during late pregnancy (3185 in the 2020 cohort) or not (2540 in the 2019 cohort) that were derived from the Beijing Birth Cohort Study. Maternal metabolic indicators, neonatal outcomes, and infant anthropometrics at 12 months of age were compared between the two cohorts, stratified by the GDM status. Results: Participants who experienced COVID-19 lockdown in late pregnancy showed lower gestational weight gain than those in the control cohort. Nevertheless, they displayed a worse metabolic profile. COVID-19 lockdown during pregnancy was associated with higher glycosylated hemoglobin (HbA1c) (ß= 0.11, 95% CI = 0.05-0.16, q-value = 0.002) and lower high density lipoprotein cholesterol level (HDL-C) level (ß=-0.09, 95% CI = -0.14 to -0.04, q-value = 0.004) in women with GDM, adjusted for potential confounders. In normoglycemic women, COVID-19 lockdown in late pregnancy was associated with higher fasting glucose level (ß= 0.10, 95% CI = 0.08-0.12, q-value <0.0001), lower HDL-C level (ß=-0.07, 95% CI = -0.08 to -0.04, q-value <0.0001), and increased risk of pregnancy-induced hypertension (adjusted OR=1.80, 95%CI=1.30-2.50, q-value=0.001). The fasting glucose level decreased less from early to late pregnancy in women who experienced COVID-19 lockdown than in the controls, regardless of the GDM status. The HDL-C has risen less with COVID-19 lockdown in the normoglycemic subgroup. In contrast, no significant differences regarding neonatal outcomes or infant weight were found between the two cohorts. Conclusion: Experiencing the COVID-19 lockdown in pregnancy was associated with worse maternal metabolic status but similar neonatal outcomes and infant weight.

Metabolic syndrome as a common comorbidity in adults with hypothalamic dysfunction.

Objective: Hypothalamic dysfunction (HD) results in various endocrine disorders and is associated with an increased risk of metabolic comorbidities. This study aimed to analyze the clinical characteristics and metabolic abnormalities of adults with HD of various causes. Methods: This study retrospectively reviewed adults with HD treated at our center between August 1989 and October 2020. Metabolic characteristics of patients were compared to those of age-, sex-matched lean, and body mass index (BMI)-matched controls. Results: Temperature dysregulation (61.0%) was the most common hypothalamic physiological dysfunction. At least one anterior pituitary hormone deficiency was observed in 50 patients (84.7%), with hypogonadotropic hypogonadism being the most frequently observed. Metabolic syndrome was confirmed in 31 patients (52.5%) and was significantly more prevalent in those with panhypopituitarism or overweight/obesity. Metabolic syndrome (MetS) was significantly more common in patients with HD than in both lean and BMI-matched controls (P < 0.001 and P = 0.030, respectively). Considering the components of MetS, elevated fasting glucose levels were significantly more common in patients with HD than in BMI-matched controls (P = 0.029). Overweight/obesity and panhypopituitarism were significant risk factors for MetS in the multivariate analysis on patients with HD. Moreover, in the multivariate analysis on patients and BMI-matched control, HD was a significant risk factor of MetS (P=0.035, OR 2.919) after adjusted for age, sex and BMI. Conclusions: Temperature dysregulation and hypogonadotropic hypogonadism are the most common physiological and endocrine dysfunctions, respectively. MetS and unfavorable metabolic profiles were prevalent in adults with HD. HD was a significant risk factor of MetS after adjusted for BMI.

Effect of PM2.5 on macrosomia in China: A nationwide prospective cohort study.

BACKGROUND: Macrosomia is associated with both neonatal complications and adult diseases (obesity, diabetes mellitus, etc.). Previous studies have reported maternal exposure to PM2.5 might influence metabolism and fetal development and cause adverse pregnancy outcomes. Studies conducted in areas with low PM2.5 concentration have found relationship between gestational PM2.5 exposure and birth weight. However, the impact of air pollution on macrosomia has not been studied, especially in highly polluted areas. OBJECTIVE: To evaluate the association between fine particulate matter (PM2.5) exposure during pregnancy and the risk of macrosomia. METHODS: Data from preconception health examination and prenatal and postnatal records were collected from 1 January 2010 to 31 December 2012 in the National Free Preconception Health Examination Project. Monthly mean of PM2.5 concentration during pregnancy was estimated from satellite data using an ensemble machine learning model. A newborn with birth weight above 4000 g was defined as macrosomia. Logistic regression models were used to examine the association between maternal exposure to PM2.5 and the risk of macrosomia, after adjusting for maternal age, pre-pregnancy body mass index, parity, neonatal sex, duration of gestation, seasonality, educational level, smoking and drinking habits, past history of diabetes mellitus and hypertension, and family history of diabetes mellitus. Restricted cubic spline models were used to evaluate the dose-response relationship between the risk of macrosomia and PM2.5 concentration. RESULTS: Of 177 841 singleton nonlow birth weight newborns included, 14 598 (8.2%) had macrosomia. The mean PM2.5 concentrations were 70.7, 71.5, and 80.9 µg/m3 in the first, second, and third trimesters. In full-adjusted logistic regression models, significant associations were found between increased risk of macrosomia and every 10 µg/m3 increase of PM2.5 concentration over the first (odds ratio [OR]: 1.045; 95% CI, 1.037-1.052), second (OR: 1.035; 95% CI, 1.028-1.043), and third (OR: 1.033; 95% CI, 1.026-1.039) trimesters. There was a nonlinear does-response association between PM2.5 concentration and the risk of macrosomia. CONCLUSIONS: Maternal exposure to PM2.5 during pregnancy was associated with an increased risk of macrosomia in China.