First Report of metaplexis yellow mottle-associated virus Infecting Metaplexis japonica (Thunb.) Makino in Shandong, China.

Metaplexis japonica (Thunb.) Makino, commonly known as rough potato, has a wide distribution in China, Japan, Korea, and adjacent Russia. In China, M. japonica is a traditional herbal medicinal plant, which is also cultivated as a vegetable (Shi et al. 2020; Wei et al. 2019). In July 2023, leaves of M. japonica plants growing near a soybean field in Qingdao, Shandong province, exhibited leaf crinkling, mosaic and distorting symptoms of probable virus infection (Supplementary Figure 1). The disease incidence in a 50 m2 area was approximately 40%. To identify the suspected viral etiological agents, symptomatic leaves from 10 M. japonica plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq). TransZol Up Total RNA Extraction Kit (TransGen Biotech, Beijing, China) was used to extract total RNA. Small RNA library construction and high-throughput sequencing (HTS) were performed on Illumina NovaSeq platform by Genepioneer (Nanjing, China) (Li et al. 2024). A total of 17,384,311 raw reads were obtained. Redundant reads were removed by cutadapt software (version 1.18) to obtain 11,580,876 clean reads with 18 to 26 nucleotide (nt) sizes. The clean reads were assembled using velvet software (version 1.1.07). A total of forty-six small contigs from 42 to 283 nt were identified, with 85 to 100% nucleotide sequence identities, respectively, to metaplexis yellow mottle-associated virus (MeYMaV, genus Caulimovirus, family Caulimoviridae, accession numbers: NC_077108.1). Finally, 1,355,955 reads (11.71% mapped ratio of total reads, cover 56.7% over the MeYMaV genome) were mapped to the genome of MeYMaV by bwa software (version 0.7.17-r1188). To confirm the sRNA-Seq results, PCR was performed with specific primers MeYMaV-N-F/MeYMaV-N-R (5'-TGGTATCAGAGCCTAGTTAA-3'/5'-GGAGTTGGTAATGTATTACC-3') and MeYMaV-C-F/MeYMaV-C-R (5'-AATGGAACGGCTGTTAGTAT3'/TTAATTTCTAGCCCTTGGCTACTTAC). Both the primer pairs were designed using GenBank accession numbers: NC_077108.1 (Yang et al. 2021) to obtain the N and C terminals genome fragments of 10 MeYMaV plants. Two amplicons approximately in 4000-, and 3900-bp sizes were amplified (Supplementary Figure 2), sequenced (tsingke, Beijing, China) and aligned to obtain 7,742-nt complete MeYMaV genome sequence (Accession no. PP892524). BLASTn analysis revealed 90.16% and 92.18% sequence identity, respectively, with the MeYMaV isolate LM-Cau-A (NC_077108.1) based on complete genome and coat protein sequences, respectively. Previously, cucumber mosaic virus and MeYMaV were reported in M. japonica from Jiangsu and Liaoning provinces in China, respectively (Yang et al. 2018; 2021). To our knowledge, this is the first natural infection report of MeYMaV in M. japonica in Shandong, China. The natural occurrence of MeYMaV is not only affects the quality of M. japonica, but also poses a potential threat to surrounding crops. This study enriches information on the disease distribution of MeYMaV and will be helpful for disease management.

Manipulation of Giant Multipole Resonances via Vortex γ Photons.

Traditional photonuclear reactions primarily excite giant dipole resonances, making the measurement of isovector giant resonances with higher multipolarities a great challenge. In this Letter, the manipulation of collective excitations of different multipole transitions in even-even nuclei via vortex γ photons is investigated. We develop the calculation method for photonuclear cross sections induced by the vortex γ photon beam using the fully self-consistent random-phase approximation plus particle-vibration coupling (RPA+PVC) model based on Skyrme density functional. We find that the electromagnetic transitions with multipolarity J<|m_{γ}| are forbidden for vortex γ photons due to the angular momentum conservation, with m_{γ} being the projection of total angular momentum of γ photon on its propagation direction. For instance, this allows for probing the isovector giant quadrupole resonance without interference from dipole transitions using vortex γ photons with m_{γ}=2. Furthermore, the electromagnetic transition with J=|m_{γ}|+1 vanishes at a specific polar angle. Therefore, the giant resonances with specific multipolarity can be extracted via vortex γ photons. Moreover, the vortex properties of γ photons can be meticulously diagnosed by measuring the nuclear photon-absorption cross section. Our method opens new avenues for photonuclear excitations, generation of coherent γ photon laser and precise detection of vortex particles, and consequently, has significant impact on nuclear physics, nuclear astrophysics and strong laser physics.

ΔI=2 Bifurcation as a Characteristic Feature of Scissors Rotational Bands.

We report microscopic many-body calculations indicating that rotational bands based on nuclear scissors vibrations exhibit systematic splitting between neighboring spin states (ΔI=2 bifurcation) in which the magnitude of the moment of inertia oscillates between states having even and odd spins. We show that this unexpected result is caused by self-organization of the deformed proton and neutron bodies in the scissors motion, which is further amplified by the K^{π}=1^{+} two-quasiparticle configurations near the scissors states. We propose that the puzzling excited state found above the 1^{+} scissors state in ^{156}Gd [Phys. Rev. Lett. 118, 212502 (2017)PRLTAO0031-900710.1103/PhysRevLett.118.212502] is the first evidence of this effect, and predict that bifurcation may generally appear in all other scissors rotational bands of deformed nuclei, and possibly in other systems exhibiting collective scissors vibrations.

Mechanically stretchable metamaterial with tunable mid-infrared optical properties.

Over the past decade, tremendous efforts have been devoted to the design of metamaterials with ultrahigh absorption. These perfect absorbers can realize the annihilation of incident electromagnetic waves by eliminating reflection and transmission of microwaves, infrared, visible, and ultraviolet. However, the optical properties are usually unchanged due to a rigid structure. In this work, we propose a mechanically stretchable metamaterial composed of polydimethylsiloxane and gold with tunable optical properties in the mid-infrared region. A large variation of absorptances with different gold filling ratios is demonstrated as well as the corresponding electric field distributions. Under moderate uniaxial and biaxial tensions, the proposed two-dimensional grating structure has achieved a dynamic tuning of infrared thermal properties, including a sharp reflectance-absorptance switch. This mechanically stretchable metamaterial can serve different optical and sensing functions due to its facile tunability.

Chaos and subharmonic bifurcations of a soft Duffing oscillator with a non-smooth periodic perturbation and harmonic excitation.

Chaotic dynamics and subharmonic bifurcations of a soft Duffing oscillator with a non-smooth periodic perturbation and a harmonic excitation are investigated analytically in this paper. With the Fourier series, the system is expanded to the equivalent smooth system, and chaos arising from heteroclinic intersections is studied with the Melnikov method. The chaotic feature on the system parameters is investigated in detail. Some new interesting dynamic phenomena, such as chaotic bands for some excitation frequencies, are presented. The relationship between the frequency range of chaotic bands and the amplitude of the excitation as well as the damping is obtained analytically. Particularly, for some system parameters satisfying a particular relationship, chaos cannot occur for any excitation amplitudes or frequencies. Subharmonic bifurcations are investigated with a subharmonic Melnikov method. It is analytically proved that the system may undergo chaotic motions through infinite or finite odd order subharmonic bifurcations. Numerical simulations are given to verify the chaos threshold and revolution from subharmonic bifurcations to chaos obtained by analytical methods.

IL-22-Induced Ubiquitin-Specific Protease 15 Promotes Proliferation and Inflammation of Keratinocytes through Stabilization of Squamous Cell Carcinoma Antigen 2.

Ubiquitin-specific protease 15 (USP15) plays a significant role in regulating various biological processes in several autoimmune diseases and cancers. However, its role in psoriatic keratinocytes (KCs) has not been extensively studied. In this study, we described that USP15 promotes proliferation and inflammation in KCs by stabilizing squamous cell carcinoma antigen 2. We discovered that the expression of USP15 and squamous cell carcinoma antigen 2 was elevated in lesions from patients with clinical psoriasis and an imiquimod-induced psoriatic dermatitis mouse model. USP15 was able to bind, deubiquitinate, and stabilize squamous cell carcinoma antigen 2. Knocking down USP15 resulted in reduced KC inflammation and impaired KC viability and clonogenicity. Topically applying USP15 small interfering RNA significantly ameliorated imiquimod-induced psoriatic dermatitis and reduced the infiltration of T cells and neutrophils. In addition, we determined that IL-22 was a key cytokine that upregulated the expression of USP15. These findings provide insights regarding the mechanisms involved in the proliferation and inflammation of KCs mediated by IL-22, suggesting a potential IL-22-USP15-squamous cell carcinoma antigen 2 axis in the pathogenesis of psoriatic KCs.

Fast modulation of surface plasmons based on the photothermal effect of nonvolatile solid thin films.

Nonvolatile phase change materials owing to their robust stability and reversibility have shown significant potential in nanophotonic switches and memory devices. However, their performances deteriorate as the thickness decreases below 10 nm due to the local deformation induced by the phase change, which makes them less compatible with plasmonic nanogaps. Here, we address this issue by photothermally modulating the refractive index of germanium antimony telluride (GST) placed in plasmonic nanogaps, which tunes plasmon resonances in the visible region below the melting point of GST, making such optical switching highly reversible at a rate of up to hundreds of ∼kHz. They are also demonstrated to modulate the waveguiding efficiency of propagating surface plasmons, which is based on the photothermal modulation of plasmons with the assistance of GST. Such hybrid nanoplasmonic system with cost-effective fabrication and efficient operation method provides a promising route towards integrated nanophotonic chips.

Characteristics of bacterial community and ARG profiles in the surface and air environments in a spacecraft assembly cleanroom.

Understanding the microbial communities and antibiotic resistance genes (ARGs) in spacecraft assembly cleanrooms is crucial for spacecraft microbial control and astronaut safety. However, there have been few reports of ARG profiles and their relationship with microbiomes in such environments. In the present study, we assessed the bacterial community and ARGs in the air dust and surface environments of a typical spacecraft assembly cleanroom. Our results show a significant difference in bacterial composition between surfaces and air dust, as they belong to two distinct ecostates. Bacillus and Acinetobacter were significantly enriched in the air samples. Bacterial community network analysis revealed lower topological parameters and robustness of bacterial networks in the air samples. We also observed different distribution patterns of some typical ARGs between surface and air dust samples. Notably, the ermB gene exhibited a relatively high copy number and was enriched in the surface environment, compared to that in the air. Overall, our study provides insight into the complex microbial community and the distribution and transfer of ARGs in spacecraft assembly cleanrooms, and offers important input for developing control strategies against ARGs.

Accelerated Water Transportation Phenomenon through a Hydrophilic Metal Roll.

Passive water transport by taking advantage of capillary forces is vital for various applications such as solar-driven interfacial evaporation, evaporative cooling, and atmospheric water harvesting. Surface engineering and structure design with a hydrophilic surface and enhanced capillary force will facilitate passive water transport. Herein, we demonstrate a hydrophilic Cu/CuO foil-based roll for accelerated water transportation. The roll was fabricated by rolling up a typical 2D Cu/CuO film, which transforms the water climbing behavior by significantly enhancing the capillary force between each Cu/CuO film layer. The simple spatial transformation for a 2D film, from planar foil to 3D structure, has extensively facilitated water transportation performance and broadened its practical application potential. The Cu/CuO film with a blade-like nanostructure and excellent hydrophilicity ensures water supply to a limited area, while the capillary effect between different layers of the Cu/CuO foil extends the water transportation height. Consequently, the Cu/CuO foil-based roll demonstrated a high fluidic transport velocity. This design derived from the 2D planar film can be potentially employed for a large range of applications such as evaporating in a confined space and evaporation-driven energy harvest.

Identification and characterization of bone/cartilage-associated signatures in common fibrotic skin diseases.

Background: Fibrotic skin diseases are characterized by excessive accumulation of the extracellular matrix (ECM) and activation of fibroblasts, leading to a global healthcare burden. However, effective treatments of fibrotic skin diseases remain limited, and their pathological mechanisms require further investigation. This study aims to investigate the common biomarkers and therapeutic targets in two major fibrotic skin diseases, namely, keloid and systemic sclerosis (SSc), by bioinformatics analysis. Methods: The keloid (GSE92566) and SSc (GSE95065) datasets were downloaded from the Gene Expression Omnibus (GEO) database. Differentially expressed genes (DEGs) were identified, followed by functional enrichment analysis using Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG). We then constructed a protein-protein interaction (PPI) network for the identification of hub genes. We explored the possibility of further functional enrichment analysis of hub genes on the Metascape, GeneMANIA, and TissueNexus platforms. Transcription factor (TF)-hub gene and miRNA-hub gene networks were established using NetworkAnalyst. We fixed GSE90051 and GSE76855 as the external validation datasets. Student's t-test and receiver operating characteristic (ROC) curve were used for candidate hub gene validation. Hub gene expression was assessed in vitro by quantitative real-time PCR. Results: A total of 157 overlapping DEGs (ODEGs) were retrieved from the GSE92566 and GSE95065 datasets, and five hub genes (COL11A1, COL5A2, ASPN, COL10A1, and COMP) were identified and validated. Functional studies revealed that hub genes were predominantly enriched in bone/cartilage-related and collagen-related processes. FOXC1 and miR-335-5p were predicted to be master regulators at both transcriptional and post-transcriptional levels. Conclusion: COL11A1, COL5A2, ASPN, COL10A1, and COMP may help understand the pathological mechanism of the major fibrotic skin diseases; moreover, FOXC1 and miR-355-5p could build a regulatory network in keloid and SSc.

Dome-arrayed chitosan/PVA hydrogel-based solar evaporator for steam generation.

Water evaporation systems with solar energy as the primary driving energy have received extensive attention in recent years. This work studies the preparation method and performance of hydrogel evaporators using chitosan and polyvinyl alcohol (PVA) as a framework and carbon nanoparticles (CNPs) as the photothermal material. The evaporation rate of CPC (chitosan/PVA and CNPs) hydrogel obtained reaches 2.28 kg m-2 h-1. Simultaneously, a three-dimensional structure is designed based on the two-dimensional double-layer evaporation system in this study. An evaporator with a tiny-pool structure and a hydrogel with a dome-arrayed structure is designed. These two structures achieve highly efficient evaporation rates of 2.28 kg m-2 h-1 and 3.80 kg m-2 h-1, respectively. These optimized designs improve the evaporation rate of the overall system by ~ 66.7%. The developed evaporation devices provide a promising pathway for developing the double-layer evaporators, which promote the new development of water purification with a solar-driven evaporation system.

Optically Triggered Nanoscale Plasmonic Dynamite.

Photons as energy carriers are clean and abundant, which can be conveniently applied for nanoactuation but the response is usually slow with very low energy efficiency/density. Here, we underpin the concept of robust nanoscale plasmonic dynamite by incorporating fullerene (C60). The Au@C60 core-shell nanoparticles can be triggered to explode in nanoscale with synergy of plasmon-enhanced photochemical and photothermal effects. It is suggested that a sensible amount of CO2 was generated and pressurized in nanometric volume in an extremely short time scale (∼ns), which triggers the nanoexplosion, rendering the ejection of Au NPs at the speed over 300 m/s. The ejection generates extremely large local forces (∼1 µN) with thermomechanical energy efficiency up to ∼30%, which is demonstrated as a powerful nanoengine for controlled mobilization of micro-objects on solid surfaces. Such nanoscale plasmonic dynamite is highly exploitable for different types of nanomachines, which provides a powerful energy source for nanoactuation and nanomigration.

Effective Approximation Method for Nanogratings-induced Near-Field Radiative Heat Transfer.

Nanoscale radiative thermal transport between a pair of metamaterial gratings is studied within this work. The effective medium theory (EMT), a traditional method to calculate the near-field radiative heat transfer (NFRHT) between nanograting structures, does not account for the surface pattern effects of nanostructures. Here, we introduce the effective approximation NFRHT method that considers the effects of surface patterns on the NFRHT. Meanwhile, we calculate the heat flux between a pair of silica (SiO2) nanogratings with various separation distances, lateral displacements, and grating heights with respect to one another. Numerical calculations show that when compared with the EMT method, here the effective approximation method is more suitable for analyzing the NFRHT between a pair of relatively displaced nanogratings. Furthermore, it is demonstrated that compared with the result based on the EMT method, it is possible to realize an inverse heat flux trend with respect to the nanograting height between nanogratings without modifying the vacuum gap calculated by this effective approximation NFRHT method, which verifies that the NFRHT between the side faces of gratings greatly affects the NFRHT between a pair of nanogratings. By taking advantage of this effective approximation NFRHT method, the NFRHT in complex micro/nano-electromechanical devices can be accurately predicted and analyzed.

Mechanoluminescence from an Ion-Irradiated Single Crystal of Lithium Niobium Oxide.

Mechanoluminescence (ML) is a well-known phenomenon that has a wide range of applications in security monitoring, biomechanical sensing, and displays. Although several mechanisms relating to ML have been proposed, significant ambiguity persists due to the coexistence of crystal boundaries, luminescence centers, and defects within the samples, making them hard to disentangle. Here we preclude such ambiguity by using a Kr+-irradiated single crystal of lithium niobium oxide (LiNbO3) as the ML materials so that oxygen vacancies are retained to modulate the ML properties. We explore the ion concentration- and species-dependent ML properties along with the band calculations to explicitly reveal that it is the trapped electrons at the oxygen vacancies that are transferred to the conduction band under the piezopotentials of LiNbO3, which combine with holes in the valence band and emit photons. This in-depth understanding not only clarifies the long-standing obscurity of the ML mechanism but also paves a rational and scalable way for the design of advanced ML materials with superior performances.

Hydrogen-bonding-assisted toughening of hierarchical carboxymethyl cellulose hydrogels for biomechanical sensing.

Herein we present a CMC based hydrogel that can be engineered for texture by applying a soaking strategy after freeze-thaw. These two processes lead to a hierarchal structure within the CMC polymer hydrogels. Such hydrogels can be strain hardening; that is the gel modulus increases with higher strain levels. Both the failure stress and energy are high (1.54 MPa and 9.94 kJm-2 respectively). At sub-failure strains, the hydrogels show a high degree of recoverability as evidenced by their minimal hysteresis in a stress-strain test. Furthermore, these hydrogels are electrically conductive making them good candidates for tough sensors and wearable electronic devices.

Fully Biomass-Based Hybrid Hydrogel for Efficient Solar Desalination with Salt Self-Cleaning Property.

Solar-driven interfacial steam generation provides an opportunity for solar harvesting and freshwater yield as a promising and eco-friendly technology. Here, we demonstrate a sustainable, nontoxic, and highly efficient fully biomass-based GG/CI hydrogel evaporator consisting of gellan gum (GG) hydrogel as the matrix and cuttlefish ink (CI) as the photothermal material. Induced by the ice-template method and freeze-drying method, vertically aligned microchannels are generated along the ice crystal growth direction. Efficient photothermal conversion is enabled by the natural black cuttlefish ink powder and enhanced by the light trapping effect within vertical microchannels. The hydrophilic property of the gellan gum hydrogel and water capillary force in those microchannels boost water pumping to the top interfacial evaporation region. Effective rapid salt self-cleaning behavior is achieved due to the rapid ion diffusion within vertical microchannels. An evaporation rate of 3.1 kg m-2 h-1 under one sun irradiance is demonstrated by this fully biomass-based GG/CI hydrogel evaporator. This work offers a promising alternative for eco-friendly and sustainable freshwater generation with abundant natural biomasses.

Superhydrophobic and Recyclable Cellulose-Fiber-Based Composites for High-Efficiency Passive Radiative Cooling.

Passive daytime radiative cooling (PDRC) involves cooling down an object by simultaneously reflecting sunlight and thermally radiating heat to the cold outer space through the Earth's atmospheric window. However, for practical applications, current PDRC materials are facing unprecedented challenges such as complicated and expensive fabrication approaches and performance degradation arising from surface contamination. Herein, we develop scalable cellulose-fiber-based composites with excellent self-cleaning and self-cooling capabilities, through air-spraying ethanolic poly(tetrafluoroethylene) (PTFE) microparticle suspensions embedded partially within the microsized pores of the cellulose fiber to form a dual-layered structure with PTFE particles atop the paper. The formed superhydrophobic PTFE coating not only protects the cellulose-fiber-based paper from water wetting and dust contamination for real-life applications but also reinforces its solar reflectivity by sunlight backscattering. It results in a subambient cooling performance of 5 °C under a solar irradiance of 834 W/m2 and a radiative cooling power of 104 W/m2 under a solar intensity of 671 W/m2. The self-cleaning surface of composites maintains their good cooling performance for outdoor applications, and the recyclability of the composites extends their life span after one life cycle. Additionally, dyed cellulose-fiber-based paper can absorb appropriate visible wavelengths to display specific colors and effectively reflect near-infrared lights to reduce solar heating, which synchronously achieves effective radiative cooling and esthetic varieties.