First Leptophobic Dark Matter Search from the Coherent-CAPTAIN-Mills Liquid Argon Detector.

We report the first results of a search for leptophobic dark matter (DM) from the Coherent-CAPTAIN-Mills (CCM) liquid argon (LAr) detector. An engineering run with 120 photomultiplier tubes (PMTs) and 17.9×10^{20} protons on target (POT) was performed in fall 2019 to study the characteristics of the CCM detector. The operation of this 10-ton detector was strictly light based with a threshold of 50 keV and used coherent elastic scattering off argon nuclei to detect DM. Despite only 1.5 months of accumulated luminosity, contaminated LAr, and nonoptimized shielding, CCM's first engineering run has already achieved sensitivity to previously unexplored parameter space of light dark matter models with a baryonic vector portal. With an expected background of 115 005 events, we observe 115 005+16.5 events which is compatible with background expectations. For a benchmark mediator-to-DM mass ratio of m_{V_{B}}/m_{χ}=2.1, DM masses within the range 9 MeV≲m_{χ}≲50 MeV are excluded at 90% C. L. in the leptophobic model after applying the Feldman-Cousins test statistic. CCM's upgraded run with 200 PMTs, filtered LAr, improved shielding, and 10 times more POT will be able to exclude the remaining thermal relic density parameter space of this model, as well as probe new parameter space of other leptophobic DM models.

Antibiofilm and anti-quorum sensing activities of eugenol and linalool from Ocimum tenuiflorum against Pseudomonas aeruginosa biofilm.

AIMS: The aim of this study is to determine the ability of two bioactive compounds, namely, eugenol and linalool, purified from leaves of Ocimum tenuiflorum for eradication of biofilm produced by Pseudomonas aeruginosa. METHODS AND RESULTS: The phytoextract of O. tenuiflorum (KT), a common ethno-botanical plant of India, was purified through high-performance liquid chromatography and was analysed using ultraviolet (UV) spectroscopy and gas chromatography-mass spectrometry (GC-MS). Eugenol and linalool were found to be the most active amongst all phytocompounds present in phytoextract and showed a significant reduction in the viability of sessile cells of P. aeruginosa and the minimum revival after withdrawal of phyto-challenge. They could bring about notable reduction in the protein and carbohydrate content of exopolysaccharide of biofilm. Eugenol and linalool could affect the synthesis of quorum sensing (QS) proteins like LasA and LasB as well as virulence factors such as pyocyanin, and rhamnolipids, which seriously hamper the formation of biofilm. The biofilm framework was extremely affected by the phytocompounds through the reduction of protein and carbohydrate content of extracellular polymeric substance (EPS). Another interesting found out was that they brought about maximum inhibition to the genomic DNA and RNA content. The studies were supported by in silico interaction between eugenol and linalool with the QS proteins. The antibiofilm efficacies of eugenol, linalool and phytoextract (KT) were further confirmed by microscopic studies with scanning electron microscopy (SEM), atomic force microscopy and fluorescence confocal microscopy microscopic studies. CONCLUSIONS: The phytocompounds are proved to be more effective than conventional antibiotics in inhibiting the biofilm forming sessile cells and can be used as a replacement for antibiotic. SIGNIFICANCE AND IMPACT OF THE STUDY: Pure eugenol extracted from common basil leaves can be used as a safe substitute for common antibiotic for treatment of chronic infections caused by P. aeruginosa. It will be cost effective, devoid of notable side effects and will not generate antibiotic resistance in host body.

Single-Quantum-Dot Heat Valve.

We demonstrate gate control of electronic heat flow in a thermally biased single-quantum-dot junction. Electron temperature maps taken in the immediate vicinity of the junction, as a function of the gate and bias voltages applied to the device, reveal clearly defined Coulomb diamond patterns that indicate a maximum heat transfer at the charge degeneracy point. The nontrivial bias and gate dependence of this heat valve results from the quantum nature of the dot at the heart of device and its strong coupling to leads.

Plasticity in host utilization by two host-associated populations of Aphis gossypii Glover.

Biological and morphological plasticity in polyphagous insect herbivores allow them to exploit diverse host plant species. Geographical differences in resource availability can lead to preferential host exploitation and result in inconsistent host specialization. Biological and molecular data provide insights into specialization and plasticity of such herbivore populations. In agricultural landscapes, Aphis gossypii encounters several crop and non-crop hosts, which exist in temporal and spatial proximity. We investigated the host-specialization of two A. gossypii host-associated populations (HAPs), which were field collected from cotton and squash (cotton-associated population and melon-associated population), and later maintained separately in the greenhouse. The two aphid populations were exposed to seven plant species (cotton, okra, watermelon, squash, cucumber, pigweed, and morning glory), and evaluated for their host utilization plasticity by estimating aphid's fitness parameters (nymphal period, adult period, fecundity, and intrinsic rate of increase). Four phenotypical characters (body length, head capsule width, hind tibia length and cornicle length) were also measured from the resulting 14 different HAP × host plant combinations. Phylogenetic analysis of mitochondrial COI sequences showed no genetic variation between the two HAPs. Fitness parameters indicated a significant variation between the two aphid populations, and the variation was influenced by host plants. The performance of melon-aphids was poor (up to 89% reduction in fecundity) on malvaceous hosts, cotton and okra. However, cotton-aphids performed better on cucurbitaceous hosts, squash and watermelon (up to 66% increased fecundity) compared with the natal host, cotton. Both HAPs were able to reproduce on two weed hosts. Cotton-aphids were smaller than melon-aphids irrespective of their host plants. Results from this study suggest that the two HAPs in the study area do not have strict host specialization; rather they exhibit plasticity in utilizing several hosts. In this scenario, it is unlikely that host-associated A. gossypii populations would evolve into host-specific biotypes.

Predicting the risk of cucurbit downy mildew in the eastern United States using an integrated aerobiological model.

Cucurbit downy mildew caused by the obligate oomycete, Pseudoperonospora cubensis, is considered one of the most economically important diseases of cucurbits worldwide. In the continental United States, the pathogen overwinters in southern Florida and along the coast of the Gulf of Mexico. Outbreaks of the disease in northern states occur annually via long-distance aerial transport of sporangia from infected source fields. An integrated aerobiological modeling system has been developed to predict the risk of disease occurrence and to facilitate timely use of fungicides for disease management. The forecasting system, which combines information on known inoculum sources, long-distance atmospheric spore transport and spore deposition modules, was tested to determine its accuracy in predicting risk of disease outbreak. Rainwater samples at disease monitoring sites in Alabama, Georgia, Louisiana, New York, North Carolina, Ohio, Pennsylvania and South Carolina were collected weekly from planting to the first appearance of symptoms at the field sites during the 2013, 2014, and 2015 growing seasons. A conventional PCR assay with primers specific to P. cubensis was used to detect the presence of sporangia in rain water samples. Disease forecasts were monitored and recorded for each site after each rain event until initial disease symptoms appeared. The pathogen was detected in 38 of the 187 rainwater samples collected during the study period. The forecasting system correctly predicted the risk of disease outbreak based on the presence of sporangia or appearance of initial disease symptoms with an overall accuracy rate of 66 and 75%, respectively. In addition, the probability that the forecasting system correctly classified the presence or absence of disease was ≥ 73%. The true skill statistic calculated based on the appearance of disease symptoms in cucurbit field plantings ranged from 0.42 to 0.58, indicating that the disease forecasting system had an acceptable to good performance in predicting the risk of cucurbit downy mildew outbreak in the eastern United States.

Thermal Conductance of a Single-Electron Transistor.

We report on combined measurements of heat and charge transport through a single-electron transistor. The device acts as a heat switch actuated by the voltage applied on the gate. The Wiedemann-Franz law for the ratio of heat and charge conductances is found to be systematically violated away from the charge degeneracy points. The observed deviation agrees well with the theoretical expectation. With a large temperature drop between the source and drain, the heat current away from degeneracy deviates from the standard quadratic dependence in the two temperatures.

A Risk Assessment Model for Bacterial Leaf Spot of Pepper (Capsicum annuum), Caused by Xanthomonas euvesicatoria, Based on Concentrations of Macronutrients, Micronutrients, and Micronutrient Ratios.

The phytopathogenic bacterium Xanthomonas euvesicatoria causes bacterial leaf spot (BLS) of pepper and has a worldwide distribution. BLS is difficult to control and an integrated management strategy that incorporates crop rotation, use of clean seed and clean plants, weed control, resistant varieties, applications of bactericides, biocontrol agents, and systemic acquired resistance (SAR) inducers is generally recommended. However, even with that arsenal of weapons, BLS can still be responsible for severe losses under favorable environmental conditions. Thus, additional tools need to be added to an overall integrated management strategy to combat BLS. In this article, we developed several models from 2012 to 2014 that were based on how macronutrients, micronutrients, and micronutrient ratios affect BLS severity. Factors used to select a model for validation included highly significant P values, high adjusted R2 values, low variance inflation factor values (<5), root mean square error, Mallow's Cp, and high Akaike's information criterion correction values. In addition, salicylic acid (SA) concentrations and relative expression of nonexpresser pathogenesis-related gene1 (NPR1) and pathogenesis-related protein 1 (PR1) in pepper tissues were also considered in model selection. A model (ECGA1) consisting of concentrations of copper, manganese, potassium, and the iron/zinc ratio as independent variables was used for validation in three different commercial pepper fields in Georgia: Colquitt County and Worth County in 2015 and Tift County in 2016. When area under the disease progress curve (AUDPC) values for two field sites (Colquitt and Worth Counties) in 2015 were pulled together and plotted against ECGA1-predicted values for both sites, the resulting relationship was highly significant (P = 0.0001) with an R2 value of 0.92. A significant relationship between observed AUDPC versus predicted values was also observed in Tift County in 2016 (P < 0.001; adjusted R2 = 0.98). Relative gene expression of both NPR1 and PR1 genes was significantly (P < 0.01) higher in pepper grown in predicted low-risk sites compared with pepper from high-risk sites in Colquitt, Worth, and Tift Counties. Although BLS severity will fluctuate depending on environmental conditions, the data indicate that the level of risk at a particular location may be influenced by how macronutrient and micronutrient concentrations affect plant disease resistance genes in the SAR pathway.

Ab initio Prediction of Martensitic and Intermartensitic Phase Boundaries in Ni-Mn-Ga.

Despite the importance of martensitic transformations of Ni-Mn-Ga Heusler alloys for their magnetocaloric and shape-memory properties, the martensitic part of their phase diagrams is not well determined. Using an ab initio approach that includes the interplay of lattice and vibrational degrees of freedom we identify an intermartensitic transformation between a modulated and a nonmodulated phase as a function of excess Ni and Mn content. Based on an evaluation of the theoretical findings and experimental x-ray diffraction data for Mn-rich alloys, we are able to predict the phase diagram for Ni-rich alloys. In contrast to other mechanisms discussed for various material systems in the literature, we herewith show that the intermartensitic transformation can be understood solely using thermodynamic concepts.

Temperature dependent magnon-phonon coupling in bcc Fe from theory and experiment.

An ab initio based framework for quantitatively assessing the phonon contribution due to magnon-phonon interactions and lattice expansion is developed. The theoretical results for bcc Fe are in very good agreement with high-quality phonon frequency measurements. For some phonon branches, the magnon-phonon interaction is an order of magnitude larger than the phonon shift due to lattice expansion, demonstrating the strong impact of magnetic short-range order even significantly above the Curie temperature. The framework closes the previous simulation gap between the ferro- and paramagnetic limits.

Role of blossom colonization in pepper seed infestation by Xanthomonas euvesicatoria.

Colonization of Xanthomonas euvesicatoria was investigated in pepper blossoms and the relationship between inoculum concentrations and seed infestation was determined. Inoculation of blossoms resulted in asymptomatic pepper fruit. However, real-time polymerase chain reaction detected X. euvesicatoria in 39% of the seed lots assayed and viable colonies were recovered from 35% of them. Successful transmission occurred in 16% of the seed lots tested. In a separate experiment, X. euvesicatoria reached populations of up to 1 × 10(5) CFU/blossom on stigmas 96 h after inoculation. Bacteria colonized stylar and ovary tissues with populations ranging from 1 × 10(5) to 1 × 10(6) CFU/blossom 96 h after inoculation. A positive correlation existed between inoculum concentration and percentage of infested seedlots. Blossoms inoculated with Acidovorax citrulli also resulted in infested pepper seedlots. Furthermore, A. citrulli colonized pepper blossoms significantly better than X. euvesicatoria by 96 h postinoculation. It was concluded that pepper blossoms can be a potential site of ingress for X. euvesicatoria into seed, and blossom colonization may be involved in pepper seed infestation. Data also indicated that seed infestation via blossoms may be nonspecific because nonhost plants can be colonized by incompatible pathogens. Thus, host-pathogen interactions may not be important for bacterial ingress through blossoms.

Transmission of Pantoea ananatis and P. agglomerans, causal agents of center rot of onion (Allium cepa), by onion thrips (Thrips tabaci) through feces.

Frankliniella fusca, the tobacco thrips, has been shown to acquire and transmit Pantoea ananatis, one of the causal agents of the center rot of onion. Although Thrips tabaci, the onion thrips, is a common pest of onions, its role as a vector of P. ananatis has been unknown. The bacterium, P. agglomerans, is also associated with the center rot of onion, but its transmission by thrips has not been previously investigated. In this study, we investigated the relationship of T. tabaci with P. ananatis and P. agglomerans. Surface-sterilized T. tabaci were provided with various acquisition access periods (AAP) on onion leaves inoculated with either P. ananatis or P. agglomerans. A positive exponential relationship was observed between thrips AAP duration and P. ananatis (R² = 0.967; P = 0.023) or P. agglomerans acquisition (R² = 0.958; P = 0.017). Transmission experiments conducted with T. tabaci adults indicated that 70% of the seedlings developed center rot symptoms 15 days after inoculation. Immunofluorescence microscopy with antibodies specific to P. ananatis revealed that the bacterium was localized only in the gut of T. tabaci adults. Mechanical inoculation of onion seedlings with fecal rinsates alone produced center rot but not with salivary secretions. Together these results suggested that T. tabaci could efficiently transmit P. ananatis and P. agglomerans.

First Report of Bacterial Blight of Sugar Beet Caused by Pseudomonas syringae pv. aptata in Georgia, USA.

Sugar beet (Beta vulgaris L.) is not currently a commercial crop in Georgia, but experimental plantings as a winter rotational crop are promising in terms of yield and industrial sugar production (T. Brenneman, personal communication). A disease outbreak of suspected bacterial origin occurred in sugar beet plots (experimental lines Beta Seed energy beet 'BTS ENC115,' 'BTS EGC184,' 'BTS EGC195,' and 'BTS 1EN6702') in Tift Co., GA, in December 2012, at ~35% incidence. Foliar symptoms included circular to irregular spots, each with a tan center and dark margin. Ten leaves/experimental line with leaf spot symptoms were collected, and bacterial isolations made on King's B agar medium. After 48 h of incubation, cream-colored, fluorescent yellow, round colonies with smooth margins were isolated. The isolates were each gram negative, oxidase negative, non-pectolytic on potato, arginine dihydrolase negative, produced levan, and gave a hypersensitivity response (HR) on tobacco. These characteristics indicated that the isolates belonged to Pseudomonas syringae van Hall LOPAT group Ia (3). The 16S-23S rRNA (internal transcribed regions) (1) from four foliar isolates (SB-1, SB-2, SB-3, and SB-4), one/experimental line, was amplified, and the resultant PCR products were sequenced and BLAST searched in GenBank. The 16S-23S rRNA sequences matched those of P. syringae pv. syingae (Pss) (KF023189) and P. syringae pv. aptata (Psa) (AY342167.1) with 96 to 98% and 97 to 99% sequence identity, respectively. Also, the percent similarity of the 16S-23S rRNA sequences among the four isolates was >99% (KJ922021 to 24 for SB-1 to SB-4, respectively). The four test isolates also had ≤89 and ≤99% similarity with Pss and Psa, respectively, when tested with BIOLOG (Hayward, CA). In addition, four sugarbeet isolates along with a type strain of Psa (NCPPB 3539) were amplified using a PCR primer pair that detected the presence of the avrPphE gene, an avirulence gene present in Psa but absent in Pss (2). The type strain of Pss (NCPPB 1770) was not amplified using this primer pair. BOX-PCR analysis gave identical banding patterns for the four isolates as that of a type strain of Psa. In two independent experiments, 3-week-old seedlings of the sugar beet cv. Beta EGR099 (n = 10 seedlings/isolate/experiment) were spray-inoculated with a sterilized water suspension of 1 × 108 CFU/ml of each of the isolates. All of the inoculated seedlings developed symptoms (water-soaked lesions that developed into necrotic spots) 10 days after inoculation (DAI) in greenhouse conditions (~30°C and ~80% RH). All of the seedlings inoculated with the type strain of Psa also produced typical bacterial blight symptoms at 10 DAI. In contrast, five control seedlings inoculated with sterilized water remained asymptomatic, and target bacterial colonies were not re-isolated from the leaves of these plants. Bacterial colonies were re-isolated from symptomatic seedlings, and showed similar characteristics based on physiological tests, BIOLOG profile, BOX-PCR analysis, and positive amplification with the avrPphE PCR assay, which indicated that these strains were Psa. To our knowledge, this is the first report of Psa in sugarbeet in Georgia. The fact that a Psa strain was also isolated from a sugar beet seed lot (data not shown) suggested that the pathogen may have been introduced on contaminated seeds. Knowledge of the presence of Psa in the agro-ecosystem of Georgia may encourage scientists to implement integrated management practices for this pathogen. References: (1) C. Guasp et al. Int. J. Syst. Evol. Microbiol. 50:1629, 2000. (2) Y. Inoue and Y. Takikawa. Page 687 in: Presentations 6th Int. Conf. Pseudomonas syringae Pathovars and Related Pathogens, 2003. (3) R. A. Lelliot et al. J. Appl. Bacteriol. 29:470, 1966.

Association of Triglyceride and C-reactive Protein Level with Severity of Angiographically Defined Coronary Artery Disease.

Coronary artery disease (CAD) is considered as a major cause of morbidity and mortality worldwide. Inflammatory cytokines play an important role in the pathogenesis and progression of atherosclerosis. The aim of the study was to find out the association of C-reactive protein (CRP) and triglyceride (TG) level on the severity of CAD in patients with ischemic heart disease (IHD). This cross-sectional study was performed in the Department of Cardiology, National Institute of Cardiovascular Diseases, Dhaka, Bangladesh during the period of March 2018 to February 2021. Total 431 patients with ischemic heart disease were enrolled after taking informed written consent. CRP values were categorized into normal (<6 mg/L), borderline (6-10 mg/L) and high (>10mg/L) and TG level were categorized into normal (<150 mg/dl), borderline (150-199mg/dl) and high (≥200 mg/dl). Patients with ischemic heart disease (IHD) were stratified according to CRP value and TG level. Severity of CAD was assessed by the Gensini score. Most of the patients (33.4%) belonged to age 51-60 years. The mean age was 51.31±10.30 years. The majority (74.5%) of patients were male. Among risk factors, the highest 205(47.6%) patients were smokers followed by hypertension 190(44.1%) and diabetes mellitus 175(40.5%). The association of TG and CRP with the whole spectrum of IHD was found statistically significant (p<0.05). Severe CAD was found higher in high TG and high CRP level group compared with the other groups and was statistically significant. Inflammation assessed by high CRP and hypertriglyceridemia associated with the risk and severity of CAD.

A New Report of Xanthomonas cucurbitae Causing Bacterial Leaf Spot of Watermelon in Georgia, USA.

In June 2012, watermelon leaves (Citrullus lanatus (Thunb.) Matsum. & Nakai) were observed with angular, necrotic spots with chlorotic halos in a field in Telfair County, GA. The field exhibited 20 to 25% disease incidence with no observable symptoms on fruits. Isolations were made from foliar lesions of 30 leaves onto yeast extract-dextrose-CaCO3 (YDC) agar medium (3). Yellow-pigmented, Xanthomonas-like colonies were observed after 48-h incubation at 28°C from 100% of the samples. Bacteria harvested were gram-negative, oxidase-negative, indole-negative, hydrolyzed starch and esculin, and formed pits on crystal violet pectate and carboxymethyl cellulose media. The bacterial isolates did not produce nitrites from nitrates but produced hypersensitive reactions on tobacco upon inoculation with 1 × 108 colony-forming units (CFU)/ml. These characteristics are typical of members of the Xanthomonas campestris group. The genus Xanthomonas was confirmed using conventional PCR with genus-specific primers RST2 (5'AGGCCCTGGAAGGTGCCCTGGA3') and RST3 (5'ATCGCACTGCGTACCGCGCGCGA3'), which produced an 840-bp band. Universal primers fD1 and rD1 (1) were used to amplify the 16S rRNA gene from four isolates and amplified products were sequenced and BLAST searched in GenBank. The nucleotide sequences of the isolates showed 97 to 98% similarity to X. cucurbitae (Accessions AB680438.1 and Y10760), X. campestris (HQ256868.1), X. arboricola (JF835910.1), X. oryzae pv. oryzicola (CP003057.1) and X. campestris pv. raphani (CP002789.1). PCR amplification and sequencing of the atpD gene (ATP synthase, 720 bp) showed 99% similarity with X. cucurbitae when BLAST searched in GenBank (HM568911.1). X. cucurbitae was not present in the database of BIOLOG (Biolog, Hayward, CA); therefore, substrate utilization tests of three isolates were compared with substrate utilization patterns of Xanthomonas groups reported by Vauterin et al. (4). The watermelon isolates displayed 93.7, 89.5, and 89.5% similarity with the reported BIOLOG metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, none of the isolates were amplified using a conventional PCR assay with X. campestris pv. campestris and X. campestris pv. raphani-specific primers (2), indicating a closer relationship with X. cucurbitae. When 2-week old watermelon seedlings cv. Crimson sweet (n = 4/isolate/experiment) were inoculated by spraying with a suspension of 1 × 108 CFU/ml, 100% of the seedlings developed symptoms (water soaked angular lesions that developed into necrotic spots) 14 days after planting under greenhouse conditions (~30°C and ~70% RH). Ten control plants inoculated with sterile water remained asymptomatic. Bacterial colonies were reisolated from symptomatic seedlings that showed similar characteristics to those described above. The identity of isolated colonies was confirmed by amplifying and sequencing the 16S rRNA gene, which showed 97 to 98% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on watermelon in Georgia since the 1950s. References: (1) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (2) Leu et al. Plant Pathol. Bull. 19:137, 2010. (3) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria, 3rd ed. APS Press. St. Paul, MN, 2001. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

First Report of Bacterial Leaf Spot of Pumpkin Caused by Xanthomonas cucurbitae in Georgia, United States.

In August 2012, a commercial pumpkin (Cucurbita maxima L. cv. Neon) field in Terrell County, GA, had a disease outbreak that caused severe symptoms on leaves and fruits. Leaves displayed small (2 to 3 mm), angular, water-soaked, yellow lesions while fruits had small (2 to 3 mm), sunken, circular, dry lesions. The field exhibited 40% disease incidence with observable symptoms on fruits. In severe cases, fruit rots were also observed. Symptomatic leaves and fruits were collected from 25 pumpkin plants and isolations were made on both nutrient agar and yeast extract-dextrose-CaCO3 (YDC) agar medium (1). Xanthomonad-like yellow colonies were observed on both agar plates and colonies appeared mucoid on YDC. Suspect bacteria were gram-negative, oxidase positive, hydrolyzed starch and esculin, formed pits on both crystal violet pectate and carboxymethyl cellulose media, but were indole negative and did not produce nitrites from nitrates. Bacterial isolates also produced hypersensitive reactions on tobacco when inoculated with a bacterial suspension of 1 × 108 CFU/ml. Identity of the isolates were identified as genus Xanthomonas by using primers RST2 (5'AGGCCCTGGAAGGTGCCCTGGA3') and RST3 (5'ATCGCACTGCGTACCGCGCGCGA3') in a conventional PCR assay, which produced an 840-bp band. The 16S rRNA gene of five isolates was amplified using universal primers fD1 and rD1 (3) and amplified products were sequenced and compared using BLAST in GenBank. The nucleotide sequences (1,200 bp) of the isolates matched Xanthomonas cucurbitae (GenBank Accession AB680438.1), X. campestris (HQ256868.1), X. campestris pv. campestris (NR074936.1), X. hortorum (AB775942.1), and X. campestris pv. raphani (CP002789.1) with 99% similarity. PCR amplification and sequencing of a housekeeping gene atpD (ATP synthase, 720 bp) showed 98% similarity with X. cucurbitae (HM568911.1). Since X. cucurbitae was not listed in the BIOLOG database (Biolog, Hayward, CA), substrate utilization tests for three pumpkin isolates were compared with utilization patterns of Xanthomonas groups using BIOLOG reported by Vauterin et al. (4). The isolates showed 94.7, 93.7, and 92.6% similarity to the reported metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, PCR assay with X. campestris- and X. raphani-specific primers (3) did not amplify the pumpkin isolates, indicating a closer relationship with X. cucurbitae. Spray inoculations of five bacterial isolates in suspensions containing 1 × 108 CFU/ml on 2-week-old pumpkin seedlings (cv. Lumina) (n = five seedlings/isolate/experiment) under greenhouse conditions of 30°C and 70% RH produced typical yellow leaf spot symptoms on 100% of the seedlings. Seedlings (n = 10) spray-inoculated with sterile water were asymptomatic. Reisolated bacterial colonies from symptomatic seedlings displayed similar characteristics to those described above. Further confirmation of bacterial identity was achieved by amplifying and sequencing the 16S rRNA gene, which showed 98 to 99% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on pumpkin in Georgia. As this bacterium is known to be seedborne, it is possible that the pathogen might have introduced through contaminated seeds. References: (1) N. W. Schaad et al. Laboratory Guide for the Identification of Plant Pathogenic Bacteria, third edition. APS Press. St. Paul, MN, 2001. (2) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (3) Leu et al. Plant Pathol. Bull. 19:137, 2010. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

Fusion of NUP214 to ABL1 on amplified episomes in T-cell acute lymphoblastic leukemia.

In T-cell acute lymphoblastic leukemia (T-ALL), transcription factors are known to be deregulated by chromosomal translocations, but mutations in protein tyrosine kinases have only rarely been identified. Here we describe the extrachromosomal (episomal) amplification of ABL1 in 5 of 90 (5.6%) individuals with T-ALL, an aberration that is not detectable by conventional cytogenetics. Molecular analyses delineated the amplicon as a 500-kb region from chromosome band 9q34, containing the oncogenes ABL1 and NUP214 (refs. 5,6). We identified a previously undescribed mechanism for activation of tyrosine kinases in cancer: the formation of episomes resulting in a fusion between NUP214 and ABL1. We detected the NUP214-ABL1 transcript in five individuals with the ABL1 amplification, in 5 of 85 (5.8%) additional individuals with T-ALL and in 3 of 22 T-ALL cell lines. The constitutively phosphorylated tyrosine kinase NUP214-ABL1 is sensitive to the tyrosine kinase inhibitor imatinib. The recurrent cryptic NUP214-ABL1 rearrangement is associated with increased HOX expression and deletion of CDKN2A, consistent with a multistep pathogenesis of T-ALL. NUP214-ABL1 expression defines a new subgroup of individuals with T-ALL who could benefit from treatment with imatinib.

Transcatheter Aortic Valve Replacement in Bicuspid Aortic Valve: A Case Report.

Among other valvular heart disease Aortic stenosis (AS) is the most common in the developed world. Transcatheter Aortic Valve Replacement (TAVR) is most acceptable treatment option for patient with severely calcified aortic stenosis with high and intermediate risk group. Among several challenges, one of the main challenges is to deal with bicuspid aortic valve (BAV). Non-circular annulus, bulky leaflets leading to perivalvular leaks and risk for rupture and often very severe calcification may contribute to periprocedural strokes leading to poor clinical outcome. This case, a 68-year-old woman with a history of type 2 diabetes mellitus (DM), hypothyroidism, bicuspid aortic valve and severe aortic stenosis, bronchial asthma, who had repeatedly refused any suggestion for open heart surgery, was our volunteer candidate for TAVR. After successful TAVR the peak pressure gradient decreased from 100mmHg to 17mmHg. So, TAVR could be a viable option for highly selected patients with severe aortic stenosis and bicuspid aortic valve who have favourable anatomy.

Superior Interfacial Contact Yields Efficient Electron Transfer Rate and Enhanced Solar Photocatalytic Hydrogen Generation in M/C3N4 Schottky Junctions.

Various literature studies (Table 6) have reported that dispersion of metal nanoparticles (NPs) on graphitic carbon nitride g-C3N4 (M/CN) has considerably improved the photocatalytic hydrogen yield. It is understood that metal NPs create active sites on the surface of CN and act as a cocatalyst. However, the precise changes induced by different metal NPs on the surface of CN still elude us. Here, we report a thorough understanding and comparison of the morphology, metal-support interactions, interfacial charge transfer kinetics, and band characteristics in different M/CN (M = Pt, Pd, Au, Ag, Cu) correlated with photocatalytic activity. Among all metals, Pt/CN was found to be the best performer both under sunlight and UV-visible irradiation. Under sunlight, maximum H2@ 2.7 mmol/h/g was observed over Pt/CN followed by Pd/CN > Au/CN > Ag/CN > Cu/CN ≈ CN. The present study revealed that among all metals, Pt formed superior interfacial contact with g-C3N4 as compared to other metals. The maximum Schottky barrier height (Φb,Pt) of 0.66 V was observed at Pt/CN followed by Φb,Au/CN (0.46 V) and Φb,Pd/CN (0.05 V). The presence of electron-deficient Pt in Pt-XPS, decrease in the intensity of d-DOS of Pt near the Fermi level in VB-XPS, increase in CB tail states, and cathodic shift in Vfb in MS plots sufficiently confirmed strong metal-support interactions in Pt/CN. Due to the SPR effect, Au and Ag NPs suffered from agglomeration and poor dispersion during photodeposition. Finely dispersed Pt NPs (2-4 nm, 53% dispersion) successfully competed with shallow/deep trap states and drove the photogenerated electrons to active metallic sites in a drastically reduced time period as investigated by femtosecond transient absorption spectroscopy. Typically, an interfacial electron transfer rate, KIET,avg, of 2.5 × 1010 s-1 was observed for Pt/CN, while 0.087 × 1010 s-1 was observed in Au/CN. Band alignment/potentials at M/CN Schottky junctions were derived and most favorable in Pt/CN with CB tail states much above the water reduction potential; however, in the case of Pd, these extend much below the H+/H2 potential and hence behave like deep trap states. Thus, in Pd/CN (τ0 = 4200 ps, 49%) and Ag/CN (3870 ps, 53%), electron deep trapping dominates over charge transfer to active sites. The present study will help in designing futuristic new cocatalyst-photocatalyst systems.

Effect of Duration of Hemostatic Compression on Radial Artery Occlusion after Transradial Percutaneous Coronary Intervention.

Radial artery occlusion (RAO) is now a major concern in transradial approach (TRA). RAO limits future radial artery use for further TRA, for as a conduit during CABG, for invasive hemodynamic monitoring and for creation of arteriovenous fistula for hemodialysis in Chronic Kidney Disease (CKD) patients through same vascular approach. The effect of duration of hemostatic compression of RAO is unknown in Bangladesh. This prospective observational study was conducted in the department of Cardiology, National Institute of Cardiovascular Diseases, Dhaka, Bangladesh (NICVD) from September 2018 to August 2019, to evaluate the effect of duration of hemostatic compression on the incidence of radial artery occlusion (RAO) after transradial percutaneous coronary intervention. A total of 140 patients underwent percutaneous coronary intervention (PCI) through TRA. RAO was defined as an absence of antegrade flow or monophasic flow or invert flow on Duplex study. In this study 70 patients (Group I) received 2 hours hemostatic compression after transradial PCI. Another 70 patients (Group II) received 6 hours hemostatic compression after transradial PCI. Radial arterial blood flow assessed at early (24 hours) and late (30 days) by color duplex study after the procedure in both groups. Early radial artery occlusion occurred in 4.3% of patients in Group I and 12.8% of patients in Group II, (p=0.04). Late radial artery occlusion occurred in 2.8% of patients in Group I and 11.4% of patients in Group II, the difference was statistically significant (p=0.04). From multivariate logistic regression analysis duration of hemostatic compression time 6 hours (p=0.01), post-procedural nitroglycerine use (p=0.03) and procedure time (p=0.03) were predictors of RAO. Shorter duration of hemostatic compression is associated with a lower incidence of early and late radial artery occlusion after transradial intervention.