A dry lunar mantle reservoir for young mare basalts of Chang'e-5.

The distribution of water in the Moon's interior carries implications for the origin of the Moon1, the crystallization of the lunar magma ocean2 and the duration of lunar volcanism2. The Chang'e-5 mission returned some of the youngest mare basalt samples reported so far, dated at 2.0 billion years ago (Ga)3, from the northwestern Procellarum KREEP Terrane, providing a probe into the spatiotemporal evolution of lunar water. Here we report the water abundances and hydrogen isotope compositions of apatite and ilmenite-hosted melt inclusions from the Chang'e-5 basalts. We derive a maximum water abundance of 283 ± 22 µg g-1 and a deuterium/hydrogen ratio of (1.06 ± 0.25) × 10-4 for the parent magma. Accounting for low-degree partial melting of the depleted mantle followed by extensive magma fractional crystallization4, we estimate a maximum mantle water abundance of 1-5 µg g-1, suggesting that the Moon's youngest volcanism was not driven by abundant water in its mantle source. Such a modest water content for the Chang'e-5 basalt mantle source region is at the low end of the range estimated from mare basalts that erupted from around 4.0 Ga to 2.8 Ga (refs. 5,6), suggesting that the mantle source of the Chang'e-5 basalts had become dehydrated by 2.0 Ga through previous melt extraction from the Procellarum KREEP Terrane mantle during prolonged volcanic activity.

Structural basis for coupling of the WASH subunit FAM21 with the endosomal SNX27-Retromer complex.

Endosomal membrane trafficking is mediated by specific protein coats and formation of actin-rich membrane domains. The Retromer complex coordinates with sorting nexin (SNX) cargo adaptors including SNX27, and the SNX27-Retromer assembly interacts with the Wiskott-Aldrich syndrome protein and SCAR homolog (WASH) complex which nucleates actin filaments establishing the endosomal recycling domain. Crystal structures, modeling, biochemical, and cellular validation reveal how the FAM21 subunit of WASH interacts with both Retromer and SNX27. FAM21 binds the FERM domain of SNX27 using acidic-Asp-Leu-Phe (aDLF) motifs similar to those found in the SNX1 and SNX2 subunits of the ESCPE-1 complex. Overlapping FAM21 repeats and a specific Pro-Leu containing motif bind three distinct sites on Retromer involving both the VPS35 and VPS29 subunits. Mutation of the major VPS35-binding site does not prevent cargo recycling; however, it partially reduces endosomal WASH association indicating that a network of redundant interactions promote endosomal activity of the WASH complex. These studies establish the molecular basis for how SNX27-Retromer is coupled to the WASH complex via overlapping and multiplexed motif-based interactions required for the dynamic assembly of endosomal membrane recycling domains.

SNX27-Retromer directly binds ESCPE-1 to transfer cargo proteins during endosomal recycling.

Coat complexes coordinate cargo recognition through cargo adaptors with biogenesis of transport carriers during integral membrane protein trafficking. Here, we combine biochemical, structural, and cellular analyses to establish the mechanistic basis through which SNX27-Retromer, a major endosomal cargo adaptor, couples to the membrane remodeling endosomal SNX-BAR sorting complex for promoting exit 1 (ESCPE-1). In showing that the SNX27 FERM (4.1/ezrin/radixin/moesin) domain directly binds acidic-Asp-Leu-Phe (aDLF) motifs in the SNX1/SNX2 subunits of ESCPE-1, we propose a handover model where SNX27-Retromer captured cargo proteins are transferred into ESCPE-1 transport carriers to promote endosome-to-plasma membrane recycling. By revealing that assembly of the SNX27:Retromer:ESCPE-1 coat evolved in a stepwise manner during early metazoan evolution, likely reflecting the increasing complexity of endosome-to-plasma membrane recycling from the ancestral opisthokont to modern animals, we provide further evidence of the functional diversification of yeast pentameric Retromer in the recycling of hundreds of integral membrane proteins in metazoans.

Apolipoprotein E deficiency leads to the polarization of splenic macrophages towards M1 phenotype by increasing iron content.

Apolipoprotein E (ApoE) plays a crucial role in iron homeostasis in the body, while macrophages are the principal cells responsible for handling iron in mammals. However, it is unknown whether ApoE can affect the functional subtypes and the iron handling capacity of splenic macrophages (SM). Here, we investigated the effects of ApoE deficiency (ApoE-/-) on the polarization and iron content of SM and its potential mechanisms. ApoE-/- was found to induce a significant increase in the expressions of M1 marker genes CD86, IL-1ß, IL-6, IL-12, TNF-α and iNOS and a reduction in M2 marker genes CD206, Arg-1, IL-10 and Ym-1 in SM of mice aged 28 weeks, Meanwhile, ApoE-/- caused a significant increase in iron content and expression of ferritin, transferrin receptor 1 (TfR1), iron regulatory protein 1 (IRP1) and heme oxygenase-1 (HO-1) and a reduction in ferroportin1 (Fpn1) in spleen and/or SM of mice aged 28 weeks. It was concluded that ApoE-/- can increase iron content through increased iron uptake mediated by TfR/ IRPs and decreased iron release mediated by Fpn1, leading to polarization of the SM to M1 phenotype.

Genome-wide identification of R2R3-MYB transcription factor subfamily genes involved in salt stress in rice (Oryza sativa L.).

BACKGROUND: R2R3-MYB transcription factors belong to one of the largest gene subfamilies in plants, and they are involved in diverse biological processes. However, the role of R2R3-MYB transcription factor subfamily genes in the response of rice (Oryza sativa L.) to salt stress has been rarely reported. RESULTS: In this study, we performed a genome-wide characterization and expression identification of rice R2R3-MYB transcription factor subfamily genes. We identified a total of 117 R2R3-MYB genes in rice and characterized their gene structure, chromosomal location, and cis-regulatory elements. According to the phylogenetic relationships and amino acid sequence homologies, the R2R3-MYB genes were divided into four groups. qRT-PCR of the R2R3-MYB genes showed that the expression levels of 10 genes significantly increased after 3 days of 0.8% NaCl treatment. We selected a high expression gene OsMYB2-115 for further analysis. OsMYB2-115 was highly expressed in the roots, stem, leaf, and leaf sheath. OsMYB2-115 was found to be localized in the nucleus, and the yeast hybrid assay showed that OsMYB2-115 has transcriptional activation activity. CONCLUSION: This result provides important information for the functional analyses of rice R2R3-MYB transcription factor subfamily genes related to the salt stress response and reveals that OsMYB2-115 may be an important gene associated with salt tolerance in rice.

A long non-coding RNA functions as a competitive endogenous RNA to modulate TaNAC018 by acting as a decoy for tae-miR6206.

Increasing evidence indicates a strong correlation between the deposition of cuticular waxes and drought tolerance. However, the precise regulatory mechanism remains elusive. Here, we conducted a comprehensive transcriptome analysis of two wheat (Triticum aestivum) near-isogenic lines, the glaucous line G-JM38 rich in cuticular waxes and the non-glaucous line NG-JM31. We identified 85,143 protein-coding mRNAs, 4,485 lncRNAs, and 1,130 miRNAs. Using the lncRNA-miRNA-mRNA network and endogenous target mimic (eTM) prediction, we discovered that lncRNA35557 acted as an eTM for the miRNA tae-miR6206, effectively preventing tae-miR6206 from cleaving the NAC transcription factor gene TaNAC018. This lncRNA-miRNA interaction led to higher transcript abundance for TaNAC018 and enhanced drought-stress tolerance. Additionally, treatment with mannitol and abscisic acid (ABA) each influenced the levels of tae-miR6206, lncRNA35557, and TaNAC018 transcript. The ectopic expression of TaNAC018 in Arabidopsis also improved tolerance toward mannitol and ABA treatment, whereas knocking down TaNAC018 transcript levels via virus-induced gene silencing in wheat rendered seedlings more sensitive to mannitol stress. Our results indicate that lncRNA35557 functions as a competing endogenous RNA to modulate TaNAC018 expression by acting as a decoy target for tae-miR6206 in glaucous wheat, suggesting that non-coding RNA has important roles in the regulatory mechanisms responsible for wheat stress tolerance.

Elevated Cancer-Associated Hyaluronan Correlates With Diagnosis and Lymph Node Metastasis of Papillary Thyroid Cancer.

The glycosaminoglycan hyaluronan (HA) plays an important role in tumor progression. However, its biological and clinical significance in papillary thyroid cancer (PTC) remains unknown. Immunohistochemistry was performed to examine HA expression in tissues from PTC patients. Two PTC cell lines were treated with HA synthesized inhibitor against HA production to assess its function. Serum HA levels from 107 PTC patients, 30 Hashimoto thyroiditis patients, and 45 normal controls (NC) were measured by chemiluminescence immunoassay. HA levels in fine needle aspiration (FNA) washouts obtained from thyroid nodules and lymph nodes (LNs) were measured by chemiluminescence immunoassay. Area under the curve (AUC) was computed to evaluate HA's clinical value. HA was highly expressed in PTC. Reducing HA production significantly inhibited PTC cell proliferation and invasion. Importantly, serum HA levels in PTC were significantly higher than those in NCs and Hashimoto thyroiditis and allowed distinguishing of thyroid cancers from NCs with high accuracy (AUC = 0.782). Moreover, elevated serum HA levels in PTC correlate with LN metastasis. HA levels in FNA washouts from PTC patients were significantly higher than those in benign controls, with a high AUC value (0.8644) for distinguishing PTC from benign controls. Furthermore, HA levels in FNA washouts from metastatic LN were significantly higher than those in nonmetastatic LN, with a high AUC value (0.8007) for distinguishing metastatic LNs from nonmetastatic LNs. HA levels in serum and FNA washout exhibited a potential significance for PTC diagnosis and an indicator for LN metastasis in patients with PTC.

Identifying SLC2A6 as the novel protective factor in breast cancer by TP53-related genes affecting M1 macrophage infiltration.

The high heterogeneity of breast cancer (BC) caused by pathogenic gene mutations poses a challenge to immunotherapy, but the underlying mechanism remains unknown. The difference in the infiltration of M1 macrophages induced by TP53 mutations has a significant impact on BC immunotherapy. The aim of this study was to develop a TP53-related M1 macrophage infiltration molecular typing risk signature in BC and evaluate the biological functions of the key gene to find new immunotherapy biomarkers. Weighted correlation network analysis (WGCNA) and negative matrix factorization (NMF) were used for distinguishing BC subtypes. The signature and the nomogram were both constructed and evaluated. Biological functions of the novel signature gene SLC2A6 were confirmed through in vitro and in vivo experiments. RNA-Sequencing and protein profiling were used for detecting the possible mechanism of SLC2A6. The results suggested that four BC subtypes were distinguished by TP53-related genes that affect M1 macrophage infiltration. The signature constructed by molecular typing characteristics could evaluate BC's clinical features and tumor microenvironment. The nomogram could accurately predict the prognosis. The signature gene SLC2A6 was found to have an abnormally low expression in tumor tissues. Overexpression of SLC2A6 could inhibit proliferation, promote mitochondrial damage, and result in apoptosis of tumor cells. The HSP70 family member protein HSPA6 could bind with SLC2A6 and increase with the increased expression of SLC2A6. In summary, the risk signature provides a reference for BC risk assessment, and the signature gene SLC2A6 could act as a tumor suppressor in BC.

Characterization of the intestinal microbiota in MSM with HIV infection.

BACKGROUND: HIV-infected persons demonstrate notable disturbances in their intestinal microbiota; however, the impact of intestinal microbiota on HIV susceptibility in men who have sex with men (MSM), as well as the effects of HIV and antiretroviral therapy (ART) on their gut microbiota, remains under active study. Thus, our research focuses on clarifying the distinctions in intestinal microbiota composition among uninfected MSM and non-MSM healthy controls, investigating the alterations in early-stage intestinal microbial communities following HIV infection, and assessing how ART affects the intestinal microbiota. METHODS: This study enrolled four participant groups: uninfected MSM, Recent HIV-1 infection (RHI) MSM, MSM on ART, and non-MSM healthy controls, with 30 individuals in each group. We utilized 16S ribosomal DNA (16S rDNA) amplicon sequencing to analyze fecal microbiota and employed Luminex multiplex assays to measure plasma markers for microbial translocation (LBP, sCD14) and the inflammatory marker CRP. FINDINGS: Comparing uninfected MSM to non-MSM healthy controls, no substantial variances were observed in α and ß diversity. Uninfected MSM had higher average relative abundances of Bacteroidetes, Prevotella, and Alloprevotella, while Bacteroides, Firmicutes, and Faecalibacterium had lower average relative abundances. MSM on ART had lower intestinal microbiota diversity than RHI MSM and uninfected MSM. In MSM on ART, Megasphaera and Fusobacterium increased, while Faecalibacterium and Roseburia decreased at genus level. Additionally, treatment with a non-nucleoside reverse transcriptase inhibitor (NNRTI) led to significant alterations in intestinal microbiota diversity and composition compared to RHI MSM. The random forest model showed that HIV infection biomarkers effectively distinguished between newly diagnosed HIV-infected MSM and HIV-negative MSM, with an ROC AUC of 76.24% (95% CI: 61.17-91.31%). CONCLUSIONS: MSM showed early intestinal microbiota imbalances after new HIV infection. MSM on ART experienced worsened dysbiosis, indicating a combined effect of HIV and ART. NNRTI-based treatment notably changed intestinal microbiota, suggesting a potential direct impact of NNRTI drugs on intestinal microbiota.

Glycemic Status and Myocardial Strain by Cardiac MRI in Patients With ST-Segment Elevation Myocardial Infarction.

BACKGROUND: It is uncertain how various degree of glycemic status affect left ventricular (LV) myocardial strain in ST-segment elevation myocardial infarction (STEMI) patients undergoing primary percutaneous coronary intervention (PPCI). PURPOSE: To investigate the relationship of glycemic status and myocardial strain in STEMI patients. STUDY TYPE: Prospective cohort study. POPULATION: 282 STEMI patients with cardiac magnetic resonance imaging 5 ± 2 days post-PPCI. Patients were divided into three groups based on the level of glycated hemoglobin A1c (HbA1c) (group 1: HbA1c < 5.7%; group 2: 5.7% ≤ HbA1c < 6.5%; group 3: HbA1c ≥ 6.5%). FIELD STRENGTH/SEQUENCE: 3.0-T; late gadolinium enhancement, balanced steady-state free precession cine sequence, black blood fat-suppressed T2-weighted. ASSESSMENT: LV function, myocardial strain, and infarct characteristics (infarct size, microvascular obstruction, and intramyocardial hemorrhage) were compared among the three groups by one-way analysis of variance (ANOVA) or Wilcoxon rank sum test. Intraobserver and interobserver reproducibility of LV myocardial strain was evaluated. STATISTICAL TESTS: ANOVA or Wilcoxon rank sum test, Pearson chi-square or Fisher's exact test, Spearman's correlation analyses and multivariable linear regression analysis. A two-tailed P value <0.05 was considered statistically significant. RESULTS: Infarct characteristics were similar among the three groups (P = 0.934, P = 0.097, P = 0.533, respectively). Patients with HbA1c ≥ 6.5% had decreased LV myocardial strain compared with HbA1c 5.7%-6.4%, as evidenced by global radial (GRS), global circumferential (GCS), and global longitudinal (GLS) strain. However, no significant differences in myocardial strain were observed between patients with HbA1c 5.7%-6.4% and HbA1c < 5.7% (P = 0.716; P = 0.294; P = 0.883, respectively). After adjustment for confounders, HbA1c as a continuous variable (beta coefficient [ß] = -0.676; ß = 0.172; ß = 0.205, respectively) and HbA1c ≥ 6.5% (ß = -3.682; ß = 0.552; ß = 0.681, respectively) were both independently associated with decreased GRS, GCS, and GLS. DATA CONCLUSION: Patients with uncontrolled blood glucose (categorized in group HbA1c ≥ 6.5%) had worse myocardial strain. The level of HbA1c appeared to be independently associated with decreased myocardial strain in STEMI patients. LEVEL OF EVIDENCE: 2 TECHNICAL EFFICACY STAGE: 2.

Inhibition of FAAH suppresses RANKL-induced osteoclastogenesis and attenuates ovariectomy-induced bone loss partially through repressing the IL17 pathway.

Fatty amide hydrolase (FAAH) is a key degradation enzyme of the endocannabinoid system, mainly responsible for the hydrolysis of arachidonic acid ethanolamine (AEA). Previous investigations have shown that FAAH is involved in a series of biological processes, such as inflammation, immune regulation, and transmembrane signal transduction of neurons. Endogenous cannabinoids and cannabinoid receptors have been reported to participate in the regulation of bone homeostasis by regulating the differentiation of osteoblasts and osteoclasts. We hypothesized that FAAH may play an important role in osteoclastogenesis based on the above evidence. The present study found that the FAAH expression was increased at both mRNA and protein levels during RANKL-induced osteoclastogenesis. Pharmacological and genetic inhibition of FAAH in bone marrow-derived macrophages (BMMs) inhibited osteoclastogenesis, F-actin ring formation, bone resorption, and osteoclast-specific gene expression in vitro. Moreover, intragastric administration of the FAAH inhibitor PF-04457845(PF) ameliorated ovariectomy (OVX)-induced bone loss in mice. Further investigation revealed that nuclear factor κB (NF-κB) and mitogen-activated protein kinase (MAPK) pathways were inhibited by PF treatment and FAAH knockdown. RNAseq indicated that the IL17 pathway was blocked by PF, and administration of recombinant murine IL17 protein could partially restore osteoclastogenesis and activate NF-κB and MAPK pathways. To sum up, our findings demonstrate that targeting FAAH could be a promising candidate strategy for treating osteoclast-related diseases, especially osteoporosis.

Iron biology.

Iron is a fundamental element for biological life, starting from bacteria till humans. Iron is essential for cell function and survival, energy production and metabolism, whereas increased levels cause oxidative stress. It is also a constituent of haemoglobin and thus it is necessary for oxygen transportation through the body. Given these multiple functions, the regulation of iron metabolism is complex and tight coupled with oxygen homeostasis at tissue and cellular levels, thanks to the interaction with the hypoxia inducible factor (HIF) system. In patients with chronic kidney disease (CKD), iron deficiency significantly contributes to anaemia development. This frequently overlaps with chronic inflammation, causing iron- restricted erythropoiesis. To add further complexity, metabolic hyperferritinemia may, on one side, increase the risk for CKD and, on the other, overlaps with functional iron deficiency. Excessive intracellular iron in certain cell types during CKD can also mediate cellular death (called ferroptosis), and contribute to the pathogenesis of kidney damage, atherosclerosis and vascular calcifications. This review is aimed at broadening the perspective of iron metabolism in the setting of CKD not just as a contributor to anaemia in CKD patients, but also as an important player with an impact on cell metabolism, renal fibrosis, and the cardiovascular system.

The prevalence and factors of willingness to accept circumcision among MSM in Maanshan City, China.

To investigate the prevalence of male circumcision and the willingness to undergo male circumcision and influencing factors among MSM in Maanshan City, we conducted a cross-sectional study from June 2016 to December 2019. Respondent-driven sampling (RDS) was used to recruit participants. Influential factors of willingness to accept circumcision were identified by a multivariable logistic regression model. The multivariable logistic regression model revealed that five variables were independent influential factors for willingness to participate. The factors include that used condoms during last anal intercourse (OR = 1.87, 95% CI:1.03-3.41, P = 0.04), sex with female sex partners (OR = 0.499, 95% CI:0.298-0.860, P = 0.012, level of education (junior college: OR = 0.413, 95% CI:0.200-0.854, P = 0.017; bachelor's degree or higher: OR = 0.442, 95% CI:0.208-0.938, P = 0.033), condom use during oral sex in the last six months (OR = 4.20, 95% CI:1.47-12.0, P = 0.007) and level of knowledge of PrEP (OR = 5.09, 95% CI:1.39-18.7, P = 0.014). Given the willingness of MSM to accept circumcision was low in China, establishing a proper understanding of circumcision is essential if it is to be used as a strategy to prevent HIV infection among MSM. Therefore, publicity and education on the operation should be strengthened to increase the willingness to undergo male circumcision.

Carbon Nanotubes as Controllable Electric-Field-Induced Bipolar Electrodes for Efficient Water Purification.

Advanced oxidation processes (AOPs) are the most efficient water cleaning technologies, but their applications face critical challenges in terms of mass/electron transfer limitations and catalyst loss/deactivation. Bipolar electrochemistry (BPE) is a wireless technique that is promising for energy and environmental applications. However, the synergy between AOPs and BPE has not been explored. In this study, by combining BPE with AOPs, we develop a general approach of using carbon nanotubes (CNTs) as electric-field-induced bipolar electrodes to control electron transfer for efficient water purification. This approach can be used for permanganate and peroxide activation, with superior performances in the degradation of refractory organic pollutants and excellent durability in recycling and scale-up experiments. Theoretical calculations, in situ measurements, and physical experiments showed that an electric field could substantially reduce the energy barrier of electron transfer over CNTs and induce them to produce bipolar electrodes via electrochemical polarization or to form monopolar electrodes through a single particle collision effect with feeding electrodes. This approach can continuously provide activated electrons from one pole of bipolar electrodes and simultaneously achieve "self-cleaning" of catalysts through CNT-mediated direct oxidation from another pole of bipolar electrodes. This study provides a fundamental scientific understanding of BPE, expands its scope in the environmental field, and offers a general methodology for water purification.

Hypoxia-inducible factor-1α/vascular endothelial growth factor signaling pathway-based ulcer-healing mechanism of Astragalus Aqueous extract in diabetic foot rats.

The main objective of this work was to investigate the mechanism of Astragalus aqueous extract ulcer healing in diabetic foot model rats through the hypoxia-inducible factor 1-alpha (HIF-1ɑ)/vascular endothelial growth factor (VEGF) signalling pathway. Fifty specific-pathogen-free male Sprague Dawley rats were divided into blank (A), model control (B), Astragalus extract (C) and mupirocin (D) treatment groups. Group A received a regular diet, whereas the other groups received a high-fat/high-sugar diet and intraperitoneal streptozotocin injections to induce diabetes. Diabetic foot ulcers were created via skin excision. Subsequently, ulcers were debrided daily. Groups B, C and D received wet saline gauze, wet gauze with Astragalus extract and gauze with mupirocin, respectively, on the affected area. Group A received no treatment. After 14 days, the rats were assessed for ulcer healing and general condition. Immunohistochemistry was used to detect HIF-1ɑ and VEGF levels in the dorsalis pedis artery, and ELISA was used to determine serum IL-6 and CRP levels. The results revealed that Groups C and D had significantly faster ulcer healing compared with Group B (p < 0.01), and ulcer healing was faster in Group C than in Group D (p < 0.01). Group C exhibited notably higher HIF-1ɑ and VEGF protein expression levels compared with Groups B and D (p < 0.01). IL-6 and CRP expression levels in Groups C and D were significantly lower than those in Group B (p < 0.01). In summary, Astragalus aqueous extract effectively treats diabetic foot ulcers by up-regulating HIF-1ɑ and VEGF expression, activating the HIF-1ɑ/VEGF pathway, improving local tissue ischaemia and hypoxia, promoting collateral circulation and enhancing dorsalis pedis artery formation, thereby accelerating ulcer repair in diabetic rats.

Isotoosendanin inhibits triple-negative breast cancer metastasis by reducing mitochondrial fission and lamellipodia formation regulated by the Smad2/3-GOT2-MYH9 signaling axis.

Triple-negative breast cancer (TNBC) is incurable and prone to widespread metastasis. Therefore, identification of key targets for TNBC progression is urgently needed. Our previous study revealed that isotoosendanin (ITSN) reduced TNBC metastasis by targeting TGFßR1. ITSN is currently used as an effective chemical probe to further discover the key molecules involved in TNBC metastasis downstream of TGFßR1. The results showed that GOT2 was the gene downstream of Smad2/3 and that ITSN decreased GOT2 expression by abrogating the activation of the TGF-ß-Smad2/3 signaling pathway through directly binding to TGFßR1. GOT2 was highly expressed in TNBC, and its knockdown decreased TNBC metastasis. However, GOT2 overexpression reversed the inhibitory effect of ITSN on TNBC metastasis both in vitro and in vivo. GOT2 interacted with MYH9 and hindered its binding to the E3 ubiquitin ligase STUB1, thereby reducing MYH9 ubiquitination and degradation. Moreover, GOT2 also enhanced the translocation of MYH9 to mitochondria and thus induced DRP1 phosphorylation, thereby promoting mitochondrial fission and lamellipodia formation in TNBC cells. ITSN-mediated inhibition of mitochondrial fission and lamellipodia formation was associated with reduced GOT2 expression. In conclusion, ITSN prevented MYH9-regulated mitochondrial fission and lamellipodia formation in TNBC cells by enhancing MYH9 protein degradation through a reduction in GOT2 expression, thus contributing to its inhibition of TNBC metastasis.

Effective Treatment of Anlotinib Combined With Chemotherapy in Children With Desmoplastic Small Round Cell Tumor: A Case Series in a Single-center and Literature Review.

INTRODUCTION: Desmoplastic small round cell tumor (DSRCT) is a highly aggressive primitive sarcoma with a 5-year survival rate estimated at only 15% to 30%. Although few curative treatment options exist, patients are most often treated with a combination of aggressive chemotherapy, radiation, and surgery. Targeted therapy inhibitors of platelet-derived growth factor A, insulin-like growth factor receptor 1, and vascular endothelial growth factor receptor-2, which are almost uniformly overexpressed in DSRCT, have largely failed in clinical trials. Anlotinib is a multitarget receptor tyrosine kinase inhibitor that inhibits vascular endothelial growth factor receptor 1-3, fibroblast growth factor receptor 1-4, platelet-derived growth factor receptor α/ß, c-Kit, and Met. In this study, we presented 3 cases of DSRCT treated effectively with anlotinib combined with chemotherapy. CASE PRESENTATION: Three children DSRCT patients were enrolled from September 2020 to December 2021 and monitored until August 30, 2022. The clinical data were prospectively studied. The peritoneal cancer index classified all 3 patients as stage IV. After surgery, all 3 patients received anlotinib in combination with chemotherapy and reacted to the medication. For all 3 patients, clinical symptoms were substantially eased, and the size of the masses was reduced. Patient 1 and patient 3's progression-free survival had been extended, and anlotinib was continued as a maintenance medication in the 2 patients who were in good health at the end of the follow-up. Patient 2 died of postoperative complications 1 month after second-stage surgery. The main side effects of anlotinib were fatigue and hypertension. However, its toxicity was controllable and tolerable in children patients. CONCLUSIONS: This is the first report that anlotinib is effective in children with DSRCT. This report may provide an additional option for the treatment of metastatic DSRCT.

The relationship between serum creatinine/cystatin C ratio and mortality in hypertensive patients.

BACKGROUND AND AIMS: Sarcopenia is a disease characterized by loss of skeletal muscle mass and function that is closely associated with cardiovascular disease. The serum creatinine/cystatin C (Cr/CysC) ratio has been shown to be a simplified indicator for identifying low muscle mass (LMM) or sarcopenia. The aim of this study was to investigate whether the Cr/CysC ratio helps to predict prognostic information in hypertensive patients. METHODS AND RESULTS: This cohort study included 2509 patients with hypertension from the National Health and Nutrition Survey 1999-2002. To evaluate the association between Cr/CysC ratio and mortality, we used Kaplan Meier estimates to calculate cumulative survival probabilities for all-cause mortality and cardiovascular mortality, Cox regression analyses, and hazard ratio (HR) and 95% confidence interval (CI) were calculated. Over a median follow-up of 11.76 years, lower Cr/CysC ratio was associated with lower risk of all-cause mortality (per 0.1 increase, HR:0.81, 95% CI: 0.77-0.85, P < 0.001) and cardiovascular mortality (per 0.1 increase, HR:0.80, 95% CI: 0.72-0.89, P < 0.001). Compared with patients with normal muscle mass, all-cause mortality, and cardiovascular mortality HR for patients with LMM diagnosed by Cr/CysC ratio were 1.57 (95% CI: 1.36-1.82, P < 0.001) and 1.64 (95% CI: 1.12-2.42, P = 0.012), respectively. CONCLUSION: We found that low muscle mass shown by lower Cr/CysC ratio was an independent risk factor for poor prognosis in hypertensive patients. We recommend routine screening of Cr/CysC ratio in hypertensive patients and early intervention for low muscle mass or sarcopenia.

Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization.

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.

Multiple sclerosis and COVID-19: a northern China survey.

BACKGROUND: There is insufficient data on severe acute respiratory syndrome coronavirus type-2 (SARS-CoV-2) infection in Chinese patients with multiple sclerosis (pwMS). This study aims to explore the manifestation of pwMS during the Coronavirus disease 2019 (COVID-19) pandemic and the effect of SARS-CoV-2 infection on the prognosis of MS in northern China. METHODS: In this cross-sectional study, an online self-administered questionnaire and telephone interviews were conducted among pwMS of northern China. Clinical correlation of SARS-CoV-2 infection since the onset of the COVID-19 pandemic in northern China was analyzed. RESULTS: 164 patients with an average age of 38.9 ± 12.2 years were included, of which 57.3% had a disease course ≤ 5 years. 33.5% of the patients were COVID-19 vaccinated. 87.2% received disease-modifying therapy (DMT), and the average immunotherapy duration was 1.9 ± 1.6 years. 83.5% were SARS-CoV-2 infected, 14.6% reported worsening of their original condition after infection, and 5.1% had a relapse of MS. Shorter disease course was independently related to infection risk (P = 0.046), whereas increasing age was related to aggravated behavioral symptoms (P = 0.008). However, gender, vaccination, and DMT were not associated with susceptibility or poor prognosis. CONCLUSION: A shorter disease course is independently associated with an increased risk of SARS-CoV-2 infection, and age is associated with worsening disability. It seems to be safe and necessary to use DMT during the pandemic, however, the use of B cell-depletion agents should be approached with caution.