Association of genetic loci for migraine susceptibility in the she people of China.

BACKGROUND: The purpose of this study was to investigate the association of the genotype and allele frequencies of the polymorphisms rs4379368, rs10504861, rs10915437, rs12134493 and rs13208321 in She people of China with migraine headache susceptibility. The five alleles were previously identified as being associated with migraine in a Western population, but it was not known if this association would hold in a She population. rs4379368 is in the succinic HMG coenzyme A transferase (C7orf10) gene; rs10504861 is near the matrix metallopeptidase 16 (MMP16) gene; rs10915437 is near the adherens junctions associated protein 1 (AJAP1) gene; rs12134493 is upstream of the tetraspanin 2 (TSPAN2) gene; and rs13208321 is within the four and a half LIM domains protein 5 (FHL5) gene. METHODS: This was a case-controlled study conducted in She people of Fujian province in China. Polymerase chain reaction-restriction fragment length polymorphism and direct sequencing were performed. Univariate and multivariate analyses were used to assess the association of the different genotypes of each SNP with migraine. RESULTS: The rs4379368 T allele was not in Hardy-Weinberg equilibrium and was more common than the C allele in subjects with migraine (58.7 %; P = 0.049), possibly suggesting a selection bias for T allele in this population. In support of this, the CT and TT genotypes were more frequent in the migraine compared with the control groups (54.0 % and 31.7 % vs. 48.0 % and 28.7 %, respectively; P = 0.019). These genotypes were also more common in females with migraines than females without migraines (53.8 % and 30.9 % vs. 46.7 % and 27.6 %; P = 0.026). Univariate and multivariate analyses found the CC genotype of rs4379368 and AA or AG genotype of rs13208321 were associated with a reduced risk of migraine (P values ≤0.039). CONCLUSIONS: Our findings suggest that rs4379368 and rs13208321 are potential genetic markers for migraine in this She population. The findings of this study and others indicate important differences between ethnic populations in regard to genetic markers of migraine susceptibility.

Prevalence of migraine in Han Chinese of Fujian province: An epidemiological study.

Migraine is a relatively common disease that is associated with high disability and reduced quality-of-life. This study aimed to investigate the prevalence, epidemiological characteristics, and risk factors of migraine in Han Chinese from Fujian Province, China.A cross-sectional epidemiological survey study was conducted to evaluate characteristics of migraine in Han Chinese. Demographic and clinical data were collected through a survey administered in face-to-face interviews by trained investigators, and a physical exam and symptom review were performed. Univariate and multivariate regression analyses were performed to assess independent risk factors for migraine.A total of 7860 subjects aged 15 years and older were surveyed, of which 9.1% (n = 717) were diagnosed with migraine. Among these, a higher percentage was female (12.6%) than male (5.3%). Only 114 subjects (15.9%) were diagnosed as having migraine with aura, which was closely associated with family history of migraine. Multivariate regression analysis showed that the odds of migraine were significantly lower in subjects aged ≥50 years compared with those aged <30 years (odds ratio [OR] ranged from 0.40 to 0.64; P ≤.013) and was higher in females compared with males (OR = 2.89, P <.001). The odds of migraine was significantly greater in subjects with a history of alcohol consumption (OR = 1.81, P <.00) and insomnia (OR = 2.77, P <.001).Han Chinese in Fujian province has a relatively high prevalence of migraine, and female gender, <50 years of age, insomnia, and use of alcohol are associated with increased odds of having migraine in this population.

Migraine Susceptibility Genes in Han Chinese of Fujian Province.

BACKGROUND AND PURPOSE: Five single-nucleotide polymorphisms (SNPs) (rs4379368, rs10504861, rs10915437, rs12134493 and rs13208321) were recently identified in a Western population with migraine. These migraine-associated SNPs have not been evaluated in a Han Chinese population. This study investigated the associations of specific SNPs with migraine in a Han population. METHODS: This was a case-control study of Han Chinese residing in Fujian Province. Polymerase chain reaction-restriction-fragment-length polymorphism analysis and direct sequencing were used to characterize the relationships of SNPs in a control group of 200 subjects and in a migraine group of 201 patients. RESULTS: The frequencies of the five SNPs did not differ between patients with migraine and healthy non migraine controls. However, subgroup analysis indicated certain SNPs were more strongly associated with migraine with aura or migraine without aura than with controls. The CT genotype of rs4379368 was more common in migraine patients with aura (75%) than in migraine patients without aura (47.9%) and controls (48.5%) (p<0.05), and the TT genotype of rs10504861 was more common in migraine patients with aura than in controls (8.3% vs. 0.5%) (p<0.05). Meanwhile, the CC genotype of rs12134493 was less common in migraine patients without aura than in controls (80.6% vs. 88%) (p<0.05). CONCLUSIONS: Our findings suggest that the rs4379368 and rs10504861 SNPs are markers for susceptibility to migraine with aura and that rs12134493 is a marker for the risk of migraine without aura in this Han population. Future studies should further explore if these associations vary by ethnicity.

Molecular analysis of SMN1, SMN2, NAIP, GTF2H2, and H4F5 genes in 157 Chinese patients with spinal muscular atrophy.

Spinal muscular atrophy (SMA) is a common and lethal autosomal recessive neurodegenerative disorder, which is caused by mutations of the survival motor neuron 1 (SMN1) gene. Additionally, the phenotype is modified by several genes nearby SMN1 in the 5q13 region. In this study, we analyzed mutations in SMN1 and quantified the modifying genes, including SMN2, NAIP, GTF2H2, and H4F5 by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), multiplex ligation-dependent probe amplification (MLPA), TA cloning, allele-specific long-range PCR, and Sanger sequencing in 157 SMA patients. Most SMA patients (94.90%) possessed a homozygous SMN1 deletion, while 10 patients demonstrated only the absence of exon 7, but the presence of exon 8. Two missense mutations (c.689 C>T and c.844 C>T) were identified in 2 patients who both carried a single copy of SMN1. We found inverse correlations between SMN2, the NAIP copy number, and the clinical severity of the disease. Furthermore, 7 severe type I patients possessed large-scale deletions, including SMN1, NAIP, and GTF2H2. We conclude that SMN1 gene conversion, SMN1 subtle mutations, SMN2 copy number, and the extent of deletion in the 5q13 region should all be considered in the genotype-phenotype analysis of SMA.

Molecular analysis of the dystrophin gene in 407 Chinese patients with Duchenne/Becker muscular dystrophy by the combination of multiplex ligation-dependent probe amplification and Sanger sequencing.

BACKGROUND: Progressive muscular dystrophy is a leading neuromuscular disorder without any effective treatments and a common genetic cause of mortality among teenagers. A challenge exists in the screening of subtle mutations in 79 exons and little is known about the genotype-phenotype correlation. METHODS: Here we adopted multiplex ligation-dependent probe amplification and Sanger sequencing to detect the dystrophin gene in 407 patients and 76 mothers. RESULTS: Sixty-three percent (257/407) of the patients harbored a deletion or duplication mutation, with a de novo mutation frequency of 39.5% in 76 affected patients, and approximately 43.7% of the deletions occurred from exon 45 to 52. To those patients suspected with single exon deletion, combined with Sanger sequencing, five subtle mutations were identified: c.8608C>T, c.2302C>T, c.7148dupT, c.10855C>T and c.2071-2093del AGGGAACAGATCCTGGTAAAGCA; the last three mutations were novel. Furthermore, after genotype-phenotype analysis, the severity of DMD/BMD was associated with the frame shift mutation but not with the deletion, the duplication or the number of deleted exons. CONCLUSION: The majority of patients have a deletion/duplication mutation in the dystrophin gene, with a hot deletion mutation region from exon 45 to 52. Combined with Sanger sequencing, multiplex ligation-dependent probe amplification is capable of detecting part of subtle mutations.

Modification of phenotype by SMN2 copy numbers in two Chinese families with SMN1 deletion in two continuous generations.

BACKGROUND: As a lethal autosomal recessive hereditary disorder, childhood spinal muscular atrophy (SMA) is caused by mutations of the survival motor neuron 1 (SMN1) gene. Most of the patients died at early stage or were seriously disabled, which accounts partly for the scarcity of two continuous generations with SMA. Increasing evidence indicated that SMN2 copy number was a modifier of SMA, but in majority of sporadic patients, the bias of phenotype judgments may largely reduce the accuracy of genotype-phenotype analysis. METHODS: We presented two families with SMN1-deleted individuals in two continuous generations, the father and daughter of family 1 and the mother and daughter of family 2 were determined to be homozygous for the deletion of the SMN1 gene. Quantitative analysis of SMN1 and SMN2 was carried out by real-time fluorescence quantitative PCR and multiplex ligation-dependent probe amplification. RESULTS: Quantitative analysis showed that the father of family 1 possessed three copies of SMN2, and his daughter had only two SMN2 copies; the slightly affected mother of family 2 had three copies of SMN2, but her sick daughter had only two copies of SMN2; we also performed prenatal prediction for family 1 and a healthy boy was born under our suggestion. CONCLUSION: For the phenotypes of patients from different generations within the same family are obviously different, the results of a genotype-phenotype analysis may be more convincing, which strongly support the hypothesis that SMN2 is an important modifier for SMA, and SMN2 copy number should be considered in the prenatal diagnosis situation.