Design of Wearable Textile Electrodes for the Monitorization of Patients with Heart Failure.

Heart failure is a severe medical condition with an important worldwide incidence that occurs when the heart is unable to efficiently pump the patient's blood throughout the body. The monitoring of edema in the lower limbs is one of the most efficient ways to control the evolution of the condition. Impedance spectroscopy has been proposed as an efficient technique to monitor body volume in patients with heart failure. It is necessary to research new wearable devices for remote patient monitoring, which can be easily worn by patients in a continuous way. In this work, we design and implement new wearable textile electrodes for the monitoring of edema evolution in patients with heart failure. Impedance spectroscopy measurements were carried out in 5 healthy controls and 2 patients with heart failure using our wearable electrodes for 3 days. The results show the appropriateness of impedance spectroscopy and our wearable electrodes to monitor body volume evolution. Impedance spectroscopy is shown to be an efficient marker of the presence of edema in heart failure patients. Initial patient positive feedback was obtained for the use of the wearable device.

Selectively Modified Lactose and N-Acetyllactosamine Analogs at Three Key Positions to Afford Effective Galectin-3 Ligands.

Galectins constitute a family of galactose-binding lectins overly expressed in the tumor microenvironment as well as in innate and adaptive immune cells, in inflammatory diseases. Lactose ((ß-D-galactopyranosyl)-(1→4)-ß-D-glucopyranose, Lac) and N-Acetyllactosamine (2-acetamido-2-deoxy-4-O-ß-D-galactopyranosyl-D-glucopyranose, LacNAc) have been widely exploited as ligands for a wide range of galectins, sometimes with modest selectivity. Even though several chemical modifications at single positions of the sugar rings have been applied to these ligands, very few examples combined the simultaneous modifications at key positions known to increase both affinity and selectivity. We report herein combined modifications at the anomeric position, C-2, and O-3' of each of the two sugars, resulting in a 3'-O-sulfated LacNAc analog having a Kd of 14.7 µM against human Gal-3 as measured by isothermal titration calorimetry (ITC). This represents a six-fold increase in affinity when compared to methyl ß-D-lactoside having a Kd of 91 µM. The three best compounds contained sulfate groups at the O-3' position of the galactoside moieties, which were perfectly in line with the observed highly cationic character of the human Gal-3 binding site shown by the co-crystal of one of the best candidates of the LacNAc series.

Controlled (Co)Polymerization of Methacrylates Using a Novel Symmetrical Trithiocarbonate RAFT Agent Bearing Diphenylmethyl Groups.

Herein, we report a novel type of symmetrical trithiocarbonate chain transfer agent (CTA) based diphenylmethyl as R groups. The utilization of this CTA in the Reversible Addition-Fragmentation chain Transfer (RAFT) process reveals an efficient control in the polymerization of methacrylic monomers and the preparation of block copolymers. The latter are obtained by the (co)polymerization of styrene or butyl acrylate using a functionalized macro-CTA polymethyl methacrylate (PMMA) previously synthesized. Data show low molecular weight dispersity values (D < 1.5) particularly in the polymerization of methacrylic monomers. Considering a typical RAFT mechanism, the leaving groups (R) from the fragmentation of CTA should be able to re-initiate the polymerization (formation of growth chains) allowing an efficient control of the process. Nevertheless, in the case of the polymerization of MMA in the presence of this symmetrical CTA, the polymerization process displays an atypical behavior that requires high [initiator]/[CTA] molar ratios for accessing predictable molecular weights without affecting the D. Some evidence suggests that this does not completely behave as a common RAFT agent as it is not completely consumed during the polymerization reaction, and it needs atypical high molar ratios [initiator]/[CTA] to be closer to the predicted molecular weight without affecting the D. This work demonstrates that MMA and other methacrylic monomers can be polymerized in a controlled way, and with "living" characteristics, using certain symmetrical trithiocarbonates.

Catalytic surface radical in dye-decolorizing peroxidase: a computational, spectroscopic and site-directed mutagenesis study.

Dye-decolorizing peroxidase (DyP) of Auricularia auricula-judae has been expressed in Escherichia coli as a representative of a new DyP family, and subjected to mutagenic, spectroscopic, crystallographic and computational studies. The crystal structure of DyP shows a buried haem cofactor, and surface tryptophan and tyrosine residues potentially involved in long-range electron transfer from bulky dyes. Simulations using PELE (Protein Energy Landscape Exploration) software provided several binding-energy optima for the anthraquinone-type RB19 (Reactive Blue 19) near the above aromatic residues and the haem access-channel. Subsequent QM/MM (quantum mechanics/molecular mechanics) calculations showed a higher tendency of Trp-377 than other exposed haem-neighbouring residues to harbour a catalytic protein radical, and identified the electron-transfer pathway. The existence of such a radical in H2O2-activated DyP was shown by low-temperature EPR, being identified as a mixed tryptophanyl/tyrosyl radical in multifrequency experiments. The signal was dominated by the Trp-377 neutral radical contribution, which disappeared in the W377S variant, and included a tyrosyl contribution assigned to Tyr-337 after analysing the W377S spectra. Kinetics of substrate oxidation by DyP suggests the existence of high- and low-turnover sites. The high-turnover site for oxidation of RB19 (k(cat) > 200 s⁻¹) and other DyP substrates was assigned to Trp-377 since it was absent from the W377S variant. The low-turnover site/s (RB19 k(cat) ~20 s⁻¹) could correspond to the haem access-channel, since activity was decreased when the haem channel was occluded by the G169L mutation. If a tyrosine residue is also involved, it will be different from Tyr-337 since all activities are largely unaffected in the Y337S variant.

Deciphering the transcriptional regulation of cholesterol catabolic pathway in mycobacteria: identification of the inducer of KstR repressor.

Cholesterol degradation plays a prominent role in Mycobacterium tuberculosis infection; therefore, to develop new tools to combat this disease, we need to decipher the components comprising and regulating the corresponding pathway. A TetR-like repressor (KstR) regulates the upper part of this complex catabolic pathway, but the induction mechanism remains unknown. Using a biophysical approach, we have discovered that the inducer molecule of KstR in M. smegmatis mc(2)155 is not cholesterol but 3-oxo-4-cholestenoic acid, one of the first metabolic intermediates. Binding this compound induces dramatic conformational changes in KstR that promote the KstR-DNA interaction to be released from the operator, retaining its dimeric state. Our findings suggest a regulatory model common to all cholesterol degrading bacteria in which the first steps of the pathway are critical to its mineralization and explain the high redundancy of the enzymes involved in these initial steps.

Structural implications of the C-terminal tail in the catalytic and stability properties of manganese peroxidases from ligninolytic fungi.

The genome of Ceriporiopsis subvermispora includes 13 manganese peroxidase (MnP) genes representative of the three subfamilies described in ligninolytic fungi, which share an Mn(2+)-oxidation site and have varying lengths of the C-terminal tail. Short, long and extralong MnPs were heterologously expressed and biochemically characterized, and the first structure of an extralong MnP was solved. Its C-terminal tail surrounds the haem-propionate access channel, contributing to Mn(2+) oxidation by the internal propionate, but prevents the oxidation of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS), which is only oxidized by short MnPs and by shortened-tail variants from site-directed mutagenesis. The tail, which is anchored by numerous contacts, not only affects the catalytic properties of long/extralong MnPs but is also associated with their high acidic stability. Cd(2+) binds at the Mn(2+)-oxidation site and competitively inhibits oxidation of both Mn(2+) and ABTS. Moreover, mutations blocking the haem-propionate channel prevent substrate oxidation. This agrees with molecular simulations that position ABTS at an electron-transfer distance from the haem propionates of an in silico shortened-tail form, while it cannot reach this position in the extralong MnP crystal structure. Only small differences exist between the long and the extralong MnPs, which do not justify their classification as two different subfamilies, but they significantly differ from the short MnPs, with the presence/absence of the C-terminal tail extension being implicated in these differences.

Chitosan-coated magnetic nanoparticles prepared in one-step by precipitation in a high-aqueous phase content reverse microemulsion.

Chitosan-coated magnetic nanoparticles (CMNP) were prepared in one-step by precipitation in a high-aqueous phase content reverse microemulsion in the presence of chitosan. The high-aqueous phase concentration led to productivities close to 0.49 g CMNP/100 g microemulsion; much higher than those characteristic of precipitation in reverse microemulsions for preparing magnetic nanoparticles. The obtained nanoparticles present a narrow particle size distribution with an average diameter of 4.5 nm; appearing to be formed of a single crystallite; furthermore they present superparamagnetism and high magnetization values; close to 49 emu/g. Characterization of CMNP suggests that chitosan is present as a non-homogeneous very thin layer; which explains the slight reduction in the magnetization value of CMNP in comparison with that of uncoated magnetic nanoparticles. The prepared nanoparticles show high heavy ion removal capability; as demonstrated by their use in the treatment of Pb2+ aqueous solutions; from which lead ions were completely removed within 10 min.

Prognostic value of electrical bioimpedance measured with a portable and wireless device in acute heart failure. / Valor pronóstico de la bioimpedancia eléctrica medida con el dispositivo IVOL en la insuficiencia cardiaca aguda.

INTRODUCTION AND OBJECTIVES: The current evaluation of acute heart failure (HF) does not allow an adequate prediction of its evolution. The electrical bioimpedance (BI) allows knowing the state of blood volume, until now only with fixed equipment. We have developed and validated a portable and wireless device to measure BI at the ankle (IVOL). The objective of the study is to know the long-term prognostic value of the point measurement of BI with IVOL in patients with acute HF. METHODS: A prospective cohort study of unselected patients admitted for acute HF in a tertiary hospital. The association between BI and different clinical, analytical and echocardiographic variables on admission and clinical evolution were analyzed. RESULTS: 76 patients were included (mean age 66.1 years, 71.1% men, 68.4% hypertensive, 34.2% diabetic, mean NT-ProBNP: 7,103 pg / ml). Of these, 52.6% with non-preserved left ventricular ejection fraction (LVEF) (<50%) and 56.6% with right ventricular (RV) dysfunction. 26.3% died during a mean follow-up of 35.8 months. Survival in patients with BI≤21,8Ω was lower, globally and in the subgroups of patients without preserved LVEF and with RV dysfunction, P<.008). In the multivariate analysis, a BI≥21.8Ω was an independent survival factor (HR: 0.242; 95% CI: 0.86-0.681; P=.007). CONCLUSIONS: BI values measured with IVOL may be an independent predictor of long-term mortality in patients hospitalized for acute HF. This prognostic value is maintained in patients without preserved LVEF function and with RV dysfunction.

Synthesis, insecticidal activity, and ensembled docking of nitroguanidines bearing S- and R-proline.

BACKGROUND: The amino acids R- and S-proline were used to synthesize novel neonicotinoid derivatives that, after being characterized by 1 H, DEPTQ 135, and HRMS-QTOF, were evaluated for use as insecticides against Galleria mellonella (caterpillar), Sitophilus zeamais, Xylosandrus morigerus, Xyleborus affinis, and Xyleborus ferrugineus. RESULTS: Comparisons of biological activity and absolute configuration showed that the R enantiomer had excellent and outstanding insecticidal activity against the insects tested, with up to 100% mortality after 12 h compared with dinotefuran at the same concentration. CONCLUSIONS: The results suggest that compound R6 is an excellent lead enantiopure insecticide for future development in the field of crop protection. Furthermore, intermolecular interactions between nicotinic acetylcholine receptors and the R enantiomer displays a lower score which mean a higher affinity to the nAChR receptor and the π-π interactions are more stable than the S derivative. © 2023 Society of Chemical Industry.

Effect of transcriptional activators SoxS, RobA, and RamA on expression of multidrug efflux pump AcrAB-TolC in Enterobacter cloacae.

Control of membrane permeability is a key step in regulating the intracellular concentration of antibiotics. Efflux pumps confer innate resistance to a wide range of toxic compounds such as antibiotics, dyes, detergents, and disinfectants in members of the Enterobacteriaceae. The AcrAB-TolC efflux pump is involved in multidrug resistance in Enterobacter cloacae. However, the underlying mechanism that regulates the system in this microorganism remains unknown. In Escherichia coli, the transcription of acrAB is upregulated under global stress conditions by proteins such as MarA, SoxS, and Rob. In the present study, two clinical isolates of E. cloacae, EcDC64 (a multidrug-resistant strain overexpressing the AcrAB-TolC efflux pump) and Jc194 (a strain with a basal AcrAB-TolC expression level), were used to determine whether similar global stress responses operate in E. cloacae and also to establish the molecular mechanisms underlying this response. A decrease in susceptibility to erythromycin, tetracycline, telithromycin, ciprofloxacin, and chloramphenicol was observed in clinical isolate Jc194 and, to a lesser extent in EcDC64, in the presence of salicylate, decanoate, tetracycline, and paraquat. Increased expression of the acrAB promoter in the presence of the above-described conditions was observed by flow cytometry and reverse transcription-PCR, by using a reporter fusion protein (green fluorescent protein). The expression level of the AcrAB promoter decreased in E. cloacae EcDC64 derivates deficient in SoxS, RobA, and RamA. Accordingly, the expression level of the AcrAB promoter was higher in E. cloacae Jc194 strains overproducing SoxS, RobA, and RamA. Overall, the data showed that SoxS, RobA, and RamA regulators were associated with the upregulation of acrAB, thus conferring antimicrobial resistance as well as a stress response in E. cloacae. In summary, the regulatory proteins SoxS, RobA, and RamA were cloned and sequenced for the first time in this species. The involvement of these proteins in conferring antimicrobial resistance through upregulation of acrAB was demonstrated in E. cloacae.

Emergency department prescription of sinus rhythm maintenance therapy for patients treated for atrial fibrillation: a secondary analysis of the HERMES-AF study / Análisis del tratamiento para mantener el ritmo sinusal en pacientes con fibrilación auricular prescrito en los servicios de urgencias: subanálisis del estudio HERMES-AF

OBJECTIVES: The maintenance of sinus rhythm by means of antiarrhythmic drugs and/or upstream therapy to counter cardiac remodeling is fundamental to the management of atrial fibrillation (AF). This study aimed to analyze this approach and its appropriateness in the setting of hospital emergency departments. MATERIAL AND METHODS: Secondary analysis of data from the multicenter observational cross-sectional HERMES-AF study carried out in 124 hospitals representative of the Spanish national health service in 2011. Included were consecutive patients with AF restored to sinus rhythm who were discharged home from emergency care. RESULTS: A total of 449 patients were included; 204 (45.4%) were already on sinus rhythm maintenance therapy. Of ,the 245 remaining patients, 107 (43.67%) were prescribed maintenance treatment in the emergency department, as follows: 41, an antiarrhythmic drug; 19, upstream therapy; and 49, both treatments. The selection of an antiarrhythmic drug did not follow guideline recommendations in 10 patients (11.8%). Antiarrhythmic drug prescription was associated with having had a prior episode of AF (odds ratio [OR], 2.024; 95% CI, 1.196-3.424; P = .009); a heart rate of more than 110 beats/min (OR, 2.147; 95% CI, 1.034-4.456, P = 0.40); and prescription of anticoagulation on discharge (OR, 1.862; 95% CI, 1.094-3.170; P = .022). Upstream therapy prescription was associated only with a heart rate over 110 beats/min (OR, 2.187; 95% CI, 1.005-4.757; P = .018). In total, 311 patients (69.23%) were discharged from the emergency department with sinus rhythm maintenance therapy: 87 with an antiarrhythmic drug, 117 with an upstream therapy, and 107 with both. CONCLUSION: Treatment to prevent the recurrence of AF is underprescribed in emergency departments. Increasing such prescription and ensuring the appropriateness of antiarrhythmic therapy prescribed are points emergency departments can improve in the interest of better sinus rhythm maintenance.

OBJETIVO: El mantenimiento del ritmo sinusal (RS) con fármacos antiarrítmicos (FAA) y/o tratamiento del remodelado (TRM) es parte fundamental en la estrategia de control del ritmo en la fibrilación auricular (FA). Este estudio analiza estas estrategias y su adecuación en los servicios de urgencias hospitalarios (SUH). METODO: Análisis secundario del estudio multicéntrico observacional transversal HERMES-AF, desarrollado en 124 SUH representativos del sistema sanitario español en 2011. Se incluyeron pacientes consecutivos con FA que revirtieron a RS y fueron dados de alta desde urgencias. RESULTADOS: Se incluyeron 449 pacientes: 204 (45,4%) ya realizaban tratamiento para mantenimiento del RS. De los 245 restantes se prescribió tratamiento en el SUH a 107 (43,7%): 41 con FAA, 19 TRM y en 47 ambas terapias. En 10 casos (11,8%) la selección del FAA no era acorde a las recomendaciones de las guías. La prescripción de FAA se asoció a FA previa [odds ratio (OR) 2,024, IC 95%: 1,196-3,424, p = 0,009], frecuencia cardiaca > 110 lpm (OR 2,147, IC 95%: 1,034-4,456, p = 0,040) y anticoagulación al alta (OR 1,862, IC 95%: 1,094-3,170, p = 0,022). El TRM se asoció a frecuencia cardiaca > 110 lpm (OR 2,187, IC 95%: 1,005-4,757, p = 0,018). En total, al alta del SUH 311 pacientes (69,2%) recibían tratamiento para mantenimiento del RS (87 con FAA, 117 con TRM y 107 con ambas terapias). CONCLUSIONES: La prescripción de tratamiento para evitar las recurrencias de la FA es insuficiente en los SUH. Extender esta prescripción y mejorar la adecuación del tratamiento antiarrítmico son áreas de mejora de la estrategia de control del ritmo en los SUH.

Coordinative Chain Transfer Polymerization of Sustainable Terpene Monomers Using a Neodymium-Based Catalyst System.

The present investigation involves the coordinative chain transfer polymerization (CCTP) of biobased terpenes in order to obtain sustainable polymers from myrcene (My) and farnesene (Fa), using the ternary Ziegler-Natta catalyst system comprising [NdV3]/[Al(i-Bu)2H]/[Me2SiCl2] and Al(i-Bu)2H, which acts as cocatalyst and chain transfer agent (CTA). The polymers were produced with a yield above 85% according to the monomeric consumption at the end of the reaction, and the kinetic examination revealed that the catalyst system proceeded with a reversible chain transfer mechanism in the presence of 15-30 equiv. of CTA. The resulting polyterpenes showed narrow molecular weight distributions (Mw/Mn = 1.4-2.5) and a high percent of 1,4-cis microstructure in the presence of 1 equiv. of Me2SiCl2, having control of the molecular weight distribution in Ziegler-Natta catalytic systems that maintain a high generation of 1,4-cis microstructure.

Synthesis of copolyesters based on substituted and non-substituted lactones towards the control of their crystallinity and their potential effect on hydrolytic degradation in the design of soft medical devices.

A series of copolymers based on ε-caprolactone (ε-CL) in combination with lactone monomers substituted with alkyl groups (4 and 6 carbon atoms), specifically δ-decalactone (δ-DL), ε-decalactone (ε-DL) and δ-dodecalactone (δ-DD), as well as a copolymer using two substituted lactone monomers with alkyl groups (ε-DL and δ-DD) were synthesized in different molar ratios. The objective of the synthesis of these copolymers was to evaluate the effects of branching in the polymer backbone on the crystallinity and the thermal properties of the synthesized materials. All copolymers were obtained via ring-opening polymerization with high conversion values for both comonomers using neodymium isopropoxide (Nd(i-Pr)3) as the initiator, and their compositions were determined by 1H NMR and 13C NMR. The molar masses (M n and M w) and distributions were obtained by GPC measurements. Such measurements showed that a majority of the copolymers exhibited dispersities (Ɖ) in the range of 1.2-1.6 and M n in the range of 15-40 kDa. First- and second-order transitions such as melting, crystallization and glass transition, as well as the crystallization degree (melting enthalpy), were determined by DSC analysis. Copolymers based on ε-CL developed interesting behaviors, wherein the copolymers with higher percentages of this monomer exhibited semicrystalline behavior, while the copolymers with a higher percentage of the comonomers ε-DL, δ-DL or δ-DD showed amorphous behavior. In contrast, the copolymers synthesized using both monomers from the alkyl group-substituted lactone developed fully amorphous features, regardless of their composition. These changes in the crystalline features of the synthesized copolymers suggest that the content of short branchings on the copolymer backbone will significantly modify their rates of hydrolytic degradation and their potential use in the development of different soft medical devices.

Characterization of the KstR-dependent promoter of the gene for the first step of the cholesterol degradative pathway in Mycobacterium smegmatis.

The KstR-dependent promoter of the MSMEG_5228 gene of Mycobacterium smegmatis, which encodes the 3-ß-hydroxysteroid dehydrogenase (3-ß HSD(MS)) responsible for the first step in the cholesterol degradative pathway, has been characterized. Primer extension analysis of the P5228 promoter showed that the transcription starts at the ATG codon, thus generating a leaderless mRNA lacking a 5' untranslated region (5'UTR). Footprint analyses demonstrated experimentally that KstR specifically binds to an operator region of 31 nt containing the quasi-palindromic sequence AACTGGAACGTGTTTCAGTT, located between the -5 and -35 positions with respect to the transcription start site. This region overlaps with the -10 and -35 boxes of the P5228 promoter, suggesting that KstR represses MSMEG_5228 transcription by preventing the binding of RNA polymerase. Using a P5228-ß-galactosidase fusion we have demonstrated that KstR is able to work as a repressor in a heterologous system like Escherichia coli. A 3D model of the KstR protein revealed folding typical of TetR-type regulators, with two domains, i.e. a DNA-binding N-terminal domain and a regulator-binding C-terminal domain composed of six helices with a long tunnel-shaped hydrophobic pocket that might interact with a putative highly hydrophobic inducer. The finding that similar P5228 promoter regions have been found in all mycobacterial strains examined, with the sole exception of Mycobacterium tuberculosis, provides new clues about the role of cholesterol in the pathogenicity of this micro-organism.

Fully Bio-Based Elastomer Nanocomposites Comprising Polyfarnesene Reinforced with Plasma-Modified Cellulose Nanocrystals.

This article proposes a process to prepare fully bio-based elastomer nanocomposites based on polyfarnesene and cellulose nanocrystals (CNC). To improve the compatibility of cellulose with the hydrophobic matrix of polyfarnesene, the surface of CNC was modified via plasma-induced polymerization, at different powers of the plasma generator, using a trans-ß-farnesene monomer in the plasma reactor. The characteristic features of plasma surface-modified CNC have been corroborated by spectroscopic (XPS) and microscopic (AFM) analyses. Moreover, the cellulose nanocrystals modified at 150 W have been selected to reinforce polyfarnesene-based nanocomposites, synthesized via an in-situ coordination polymerization using a neodymium-based catalytic system. The effect of the different loading content of nanocrystals on the polymerization behavior, as well as on the rheological aspects, was evaluated. The increase in the storage modulus with the incorporation of superficially modified nanocrystals was demonstrated by rheological measurements and these materials exhibited better properties than those containing pristine cellulose nanocrystals. Moreover, we elucidate that the viscoelastic moduli of the elastomer nanocomposites are aligned with power-law model systems with characteristic relaxation time scales similar to commercial nanocomposites, also implying tunable mechanical properties. In this foreground, our findings have important implications in the development of fully bio-based nanocomposites in close competition with the commercial stock, thereby producing alternatives in favor of sustainable materials.

Loading of doxorubicin on poly(methyl methacrylate-co-methacrylic acid) nanoparticles and release study.

Nanoparticles (NP) of 12.7 nm in diameter of the poly(methyl methacrylate (MMA)-co-methacrylic acid (MAA)) copolymer were prepared. 13C-NMR results showed a MMA:MAA molar ratio of 0.64:0.36 in the copolymer, which is similar to the poly(MMA-co-MAA) commercially known as the FDA approved Eudragit S100 (0.67:0.33). The NP prepared in this study were loaded at pH 5 with varying amounts (from 0.54 to 6.91%) of doxorubicin (DOX), an antineoplastic drug. 1H-NMR results indicated the electrostatic interactions between the ionized carboxylic groups of the MAA units in the copolymer and the proton of the glycosidic amine in DOX. Measurements by QLS and TEM indicated that the loading destabilizes the NP, and that for increase stability, they aggregate in a reversible way, forming aggregates with a diameter up to 99.5 nm at a DOX load of 6.91%. The analysis of drug release data at pH 7.4 showed that loaded NP with at least 4.38% DOX release the drug very slowly and follows the Higuchi model; the former suggests that they could remain for long periods in the bloodstream to reach and destroy cancer cells.

Evidence for conformational changes in the yeast deoxyhypusine hydroxylase Lia1 upon iron displacement from its active site.

The unique amino acid hypusine is formed exclusively in eIF5A by the successive action of deoxyhypusine synthase and deoxyhypusine hydroxylase (yeast Lia1, human DOHH). Although the first enzyme has been extensively studied, both Lia1 structure and the mechanism of action remain unclear. Hence, a multi-approach was used to evaluate Lia1 catalysis, metal/substrate binding, structural conformation and stability. Mutational analyses of Lia1 revealed fine differences in the mode of substrate binding between the human and yeast counterparts. Like human DOHH, recombinant Lia1 is an iron metalloenzyme. Iron is essential for enzyme activity since its loss renders the enzyme totally inactive. The separation of iron-free and iron-bound forms by gel filtration and native electrophoresis suggests differences in Lia1 tertiary structure related to the iron binding. The ability of Lia1 to undergo conformational changes prompted us to use a set of complementary spectroscopic approaches and SAXS to obtain detailed information on the processes underlying dissociation of iron from Lia1 at different levels of the protein organization. The additive effect of weak interactions, especially within the metal center, resulted in an active enzyme in a stabilized and compact three-dimensional fold. Loss of tertiary contacts upon iron displacement led to an elongated conformation of Lia1, in which the N- and C-terminal domains are no longer in close proximity to guarantee the proper orientation of the active groups within the active site pocket. Our results demonstrate an essential structural role for iron binding in addition to its contribution to the catalysis of hypusine formation in the eIF-5A precursor.

Introducing random bio-terpene segments to high cis-polybutadiene: making elastomeric materials more sustainable.

In this work, we explore the statistical copolymerization of 1,3-butadiene with the terpenic monomers myrcene and farnesene, carried out via coordination polymerization using a neodymium-based ternary catalytic system. The resultant copolymers, poly(butadiene-co-myrcene) and poly(butadiene-co-farnesene), were synthesized at different monomer ratios, elucidating the influence of the bio-based monomer content over the kinetic variables, molecular and thermal properties, and the reactivity constants (Fineman-Ross and Kelen-Tüdös methods) of the resultant copolymers. The results indicate that through the herein employed conditions, it is possible to obtain "more sustainable" high-cis (≈95%) polybutadiene elastomers with random and tunable content of bio-based monomer. Moreover, the polymers exhibit fairly high molecular weights and a rather low dispersity index. Upon copolymerization, the T g of high-cis PB can be shifted from -106 to -75 °C (farnesene) or -107 to -64 °C (myrcene), without altering the microstructure control. This work contributes to the development of more environmentally friendly elastomers, to form "green" rubber materials.

Bio-elastomer nanocomposites reinforced with surface-modified graphene oxide prepared via in situ coordination polymerization.

This article proposes a method to produce bio-elastomer nanocomposites, based on polyfarnesene or polymyrcene, reinforced with surface-modified graphene oxide (GO). The surface modification is performed by grafting alkylamines (octyl-, dodecyl-, and hexadecylamine) onto the surface of GO. The successful grafting was confirmed via spectroscopic (FTIR and Raman) and X-ray diffraction techniques. The estimated grafted amines appear to be around 30 wt%, as calculated via thermogravimetric analysis, increasing the inter-planar spacing among the nanosheets as a function of alkyl length in the amine. The resulting modified GOs were then used to prepare bio-elastomer nanocomposites via in situ coordination polymerization (using a ternary neodymium-based catalytic system), acting as reinforcing additives of polymyrcene and polyfarnesene. We demonstrated that the presence of the modified GO does not affect significantly the catalytic activity, nor the microstructure-control of the catalyst, which led to high cis-1,4 content bio-elastomers (>95%). Moreover, we show via rheometry that the presence of the modified-GO expands the capacity of the elastomer to store deformation or applied stress, as well as exhibit an activation energy an order of magnitude higher.

Bio-elastomers based on polyocimene synthesized via coordination polymerization using neodymium-based catalytic systems.

Towards the development of eco-friendly alternatives of elastomeric materials, which can replace petroleum-based materials, it is crucial to explore different monomers and catalytic systems in order to find the best possible combinations for specific applications. Herein, we report the synthesis of polyocimene via coordination polymerization using two different neodymium-based catalysts (NdV3 and Nd(Oi-Pr)3), activated by alkylaluminums/organoboron compounds. By varying the type of co-catalyst species, halide donors, and reaction parameters, we have demonstrated the possibility to obtain polymers with a controlled microstructure and tunable properties, in terms of molecular weight characteristics and kinetics. Our results provide important insights towards the search for the optimum catalytic system to produce bio-elastomers.