Irisin acts through its integrin receptor in a two-step process involving extracellular Hsp90α.

Exercise benefits the human body in many ways. Irisin is secreted by muscle, increased with exercise, and conveys physiological benefits, including improved cognition and resistance to neurodegeneration. Irisin acts via αV integrins; however, a mechanistic understanding of how small polypeptides like irisin can signal through integrins is poorly understood. Using mass spectrometry and cryo-EM, we demonstrate that the extracellular heat shock protein 90α (eHsp90α) is secreted by muscle with exercise and activates integrin αVß5. This allows for high-affinity irisin binding and signaling through an Hsp90α/αV/ß5 complex. By including hydrogen/deuterium exchange data, we generate and experimentally validate a 2.98 Å RMSD irisin/αVß5 complex docking model. Irisin binds very tightly to an alternative interface on αVß5 distinct from that used by known ligands. These data elucidate a non-canonical mechanism by which a small polypeptide hormone like irisin can function through an integrin receptor.

An open-source drug discovery platform enables ultra-large virtual screens.

On average, an approved drug currently costs US$2-3 billion and takes more than 10 years to develop1. In part, this is due to expensive and time-consuming wet-laboratory experiments, poor initial hit compounds and the high attrition rates in the (pre-)clinical phases. Structure-based virtual screening has the potential to mitigate these problems. With structure-based virtual screening, the quality of the hits improves with the number of compounds screened2. However, despite the fact that large databases of compounds exist, the ability to carry out large-scale structure-based virtual screening on computer clusters in an accessible, efficient and flexible manner has remained difficult. Here we describe VirtualFlow, a highly automated and versatile open-source platform with perfect scaling behaviour that is able to prepare and efficiently screen ultra-large libraries of compounds. VirtualFlow is able to use a variety of the most powerful docking programs. Using VirtualFlow, we prepared one of the largest and freely available ready-to-dock ligand libraries, with more than 1.4 billion commercially available molecules. To demonstrate the power of VirtualFlow, we screened more than 1 billion compounds and identified a set of structurally diverse molecules that bind to KEAP1 with submicromolar affinity. One of the lead inhibitors (iKeap1) engages KEAP1 with nanomolar affinity (dissociation constant (Kd) = 114 nM) and disrupts the interaction between KEAP1 and the transcription factor NRF2. This illustrates the potential of VirtualFlow to access vast regions of the chemical space and identify molecules that bind with high affinity to target proteins.

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.

Chemical Modulation of DNA Replication along G-Quadruplex Based on Topology-Dependent Ligand Binding.

Ligands that bind to and stabilize guanine-quadruplex (G4) structures to regulate DNA replication have therapeutic potential for cancer and neurodegenerative diseases. Because there are several G4 topologies, ligands that bind to their specific types may have the ability to preferentially regulate the replication of only certain genes. Here, we demonstrated that binding ligands stalled the replication of template DNA at G4, depending on different topologies. For example, naphthalene diimide derivatives bound to the G-quartet of G4 with an additional interaction between the ligand and the loop region of a hybrid G4 type from human telomeres, which efficiently repressed the replication of the G4. Thus, these inhibitory effects were not only stability-dependent but also topology-selective based on the manner in which G4 structures interacted with G4 ligands. Our original method, referred to as a quantitative study of topology-dependent replication (QSTR), was developed to evaluate correlations between replication rate and G4 stability. QSTR enabled the systematic categorization of ligands based on topology-dependent binding. It also demonstrated accuracy in determining quantitatively how G4 ligands control the intermediate state of replication and the kinetics of G4 unwinding. Hence, the QSTR index would facilitate the design of new drugs capable of controlling the topology-dependent regulation of gene expression.

Using Genome Sequence to Enable the Design of Medicines and Chemical Probes.

Rapid progress in genome sequencing technology has put us firmly into a postgenomic era. A key challenge in biomedical research is harnessing genome sequence to fulfill the promise of personalized medicine. This Review describes how genome sequencing has enabled the identification of disease-causing biomolecules and how these data have been converted into chemical probes of function, preclinical lead modalities, and ultimately U.S. Food and Drug Administration (FDA)-approved drugs. In particular, we focus on the use of oligonucleotide-based modalities to target disease-causing RNAs; small molecules that target DNA, RNA, or protein; the rational repurposing of known therapeutic modalities; and the advantages of pharmacogenetics. Lastly, we discuss the remaining challenges and opportunities in the direct utilization of genome sequence to enable design of medicines.

Expression of the human telomerase reverse transcriptase gene is modulated by quadruplex formation in its first exon due to DNA methylation.

DNA secondary structures and methylation are two well-known mechanisms that regulate gene expression. The catalytic subunit of telomerase, human telomerase reverse transcriptase (hTERT), is overexpressed in ∼90% of human cancers to maintain telomere length for cell immortalization. Binding of CCCTC-binding factor (CTCF) to the first exon of the hTERT gene can down-regulate its expression. However, DNA methylation in the first exon can prevent CTCF binding in most cancers, but the molecular mechanism is unknown. The NMR analysis showed that a stretch of guanine-rich sequence in the first exon of hTERT and located within the CTCF-binding region can form two secondary structures, a hairpin and a quadruplex. A key finding was that the methylation of cytosine at the specific CpG dinucleotides will participate in quartet formation, causing the shift of the equilibrium from the hairpin structure to the quadruplex structure. Of further importance was the finding that the quadruplex formation disrupts CTCF protein binding, which results in an increase in hTERT gene expression. Our results not only identify quadruplex formation in the first exon promoted by CpG dinucleotide methylation as a regulator of hTERT expression but also provide a possible mechanistic insight into the regulation of gene expression via secondary DNA structures.

A novel transition pathway of ligand-induced topological conversion from hybrid forms to parallel forms of human telomeric G-quadruplexes.

The folding topology of DNA G-quadruplexes (G4s) depends not only on their nucleotide sequences but also on environmental factors and/or ligand binding. Here, a G4 ligand, 3,6-bis(1-methyl-4-vinylpyridium iodide)-9-(1-(1-methyl-piperidinium iodide)-3,6,9-trioxaundecane) carbazole (BMVC-8C3O), can induce topological conversion of non-parallel to parallel forms in human telomeric DNA G4s. Nuclear magnetic resonance (NMR) spectroscopy with hydrogen-deuterium exchange (HDX) reveals the presence of persistent imino proton signals corresponding to the central G-quartet during topological conversion of Tel23 and Tel25 G4s from hybrid to parallel forms, implying that the transition pathway mainly involves local rearrangements. In contrast, rapid HDX was observed during the transition of 22-CTA G4 from an anti-parallel form to a parallel form, resulting in complete disappearance of all the imino proton signals, suggesting the involvement of substantial unfolding events associated with the topological transition. Site-specific imino proton NMR assignments of Tel23 G4 enable determination of the interconversion rates of individual guanine bases and detection of the presence of intermediate states. Since the rate of ligand binding is much higher than the rate of ligand-induced topological conversion, a three-state kinetic model was evoked to establish the associated energy diagram for the topological conversion of Tel23 G4 induced by BMVC-8C3O.

A G-Quadruplex Structure in the Promoter Region of CLIC4 Functions as a Regulatory Element for Gene Expression.

The differential transcriptional expression of CLIC4 between tumor cells and the surrounding stroma during cancer progression has been suggested to have a tumor-promoting effect. However, little is known about the transcriptional regulation of CLIC4. To better understand how this gene is regulated, the promoter region of CLIC4 was analyzed. We found that a high GC content near the transcriptional start site (TSS) might form an alternative G-quadruplex (G4) structure. Nuclear magnetic resonance spectroscopy (NMR) confirmed their formation in vitro. The reporter assay showed that one of the G4 structures exerted a regulatory role in gene transcription. When the G4-forming sequence was mutated to disrupt the G4 structure, the transcription activity dropped. To examine whether this G4 structure actually has an influence on gene transcription in the chromosome, we utilized the CRISPR/Cas9 system to edit the G4-forming sequence within the CLIC4 promoter in the cell genome. The pop-in/pop-out strategy was adopted to isolate the precisely-edited A375 cell clone. In CRISPR-modified A375 cell clones whose G4 was disrupted, there was a decrease in the endogenous CLIC4 messenger RNA (mRNA) expression level. In conclusion, we found that the G4 structure in the CLIC4 promoter might play an important role in regulating the level of transcription.

Direct evidence of mitochondrial G-quadruplex DNA by using fluorescent anti-cancer agents.

G-quadruplex (G4) is a promising target for anti-cancer treatment. In this paper, we provide the first evidence supporting the presence of G4 in the mitochondrial DNA (mtDNA) of live cells. The molecular engineering of a fluorescent G4 ligand, 3,6-bis(1-methyl-4-vinylpyridinium) carbazole diiodide (BMVC), can change its major cellular localization from the nucleus to the mitochondria in cancer cells, while remaining primarily in the cytoplasm of normal cells. A number of BMVC derivatives with sufficient mitochondrial uptake can induce cancer cell death without damaging normal cells. Fluorescence studies of these anti-cancer agents in live cells and in isolated mitochondria from HeLa cells have demonstrated that their major target is mtDNA. In this study, we use fluorescence lifetime imaging microscopy to verify the existence of mtDNA G4s in live cells. Bioactivity studies indicate that interactions between these anti-cancer agents and mtDNA G4 can suppress mitochondrial gene expression. This work underlines the importance of fluorescence in the monitoring of drug-target interactions in cells and illustrates the emerging development of drugs in which mtDNA G4 is the primary target.

Structural basis of sodium-potassium exchange of a human telomeric DNA quadruplex without topological conversion.

Understanding the mechanism of Na(+)/K(+)-dependent spectral conversion of human telomeric G-quadruplex (G4) sequences has been limited not only because of the structural polymorphism but also the lack of sufficient structural information at different stages along the conversion process for one given oligonucleotide. In this work, we have determined the topology of the Na(+) form of Tel23 G4, which is the same hybrid form as the K(+) form of Tel23 G4 despite the distinct spectral patterns in their respective nuclear magnetic resonance (NMR) and circular dichroism spectra. The spectral difference, particularly the well-resolved imino proton NMR signals, allows us to monitor the structural conversion from Na(+) form to K(+) form during Na(+)/K(+) exchange. Time-resolved NMR experiments of hydrogen-deuterium exchange and hybridization clearly exclude involvement of the global unfolding for the fast Na(+)/K(+) spectral conversion. In addition, the K(+) titration monitored by NMR reveals that the Na(+)/K(+) exchange in Tel23 G4 is a two-step process. The addition of K(+) significantly stabilizes the unfolding kinetics of Tel23 G4. These results offer a possible explanation of rapid spectral conversion of Na(+)/K(+) exchange and insight into the mechanism of Na(+)/K(+) structural conversion in human telomeric G4s.

Inhibition of cancer cell migration and invasion through suppressing the Wnt1-mediating signal pathway by G-quadruplex structure stabilizers.

WNT1 encodes a multifunctional signaling glycoprotein that is highly expressed in several malignant tumors. Patients with Wnt1-positive cancer are usually related to advanced metastasis. Here, we found that a stretch of G-rich sequences located at the WNT1 promoter region is capable of forming G-quadruplex structures. The addition of G-quadruplex structure stabilizers, BMVC and BMVC4, raises the melting temperature of the oligonucleotide formed by the WNT1 promoter G-rich sequences. Significantly, the expression of WNT1 was repressed by BMVC or BMVC4 in a G-quadruplex-dependent manner, suggesting that they can be used to modulate WNT1 expression. The role of G-quadruplex stabilizers on Wnt1-mediated cancer migration and invasion was further analyzed. The protein levels of ß-catenin, a mediator of the Wnt-mediated signaling pathway, and the downstream targets MMP7 and survivin were down-regulated upon BMVC or BMVC4 treatments. Moreover, the migration and invasion activities of cancer cells were inhibited by BMVC and BMVC4, and the inhibitory effects can be reversed by WNT1-overexpression. Thus the Wnt1 expression and its downstream signaling pathways can be regulated through the G-quadruplex sequences located at its promoter region. These findings provide a novel approach for future drug development to inhibit migration and invasion of cancer cells.

Conformational transition of a hairpin structure to G-quadruplex within the WNT1 gene promoter.

The role of G-quadruplexes (G4s) in biological systems has been widely studied. It is found that they have an important function in gene transcription and regulation. In this work, we have identified two topologies of hairpin and G4 structures formed by a native G-rich sequence (WT22: 5'-GGGCCACCGGGCAGGGGGCGGG-3') from the WNT1 promoter region using nuclear magnetic resonance (NMR) spectroscopy. With the help of site-specific isotope labeling, the topologies of these two structures are unambiguously characterized. Circular dichroism and NMR results are analyzed to determine the kinetics associated with the potassium ion-induced hairpin-to-G4 transition, which is very slow-on the time scale of 4800 s-compared to the previously reported folding kinetics of G4 formation. In addition, the free energies of the unfolding of these two structures are obtained using differential scanning calorimetry. Combining the kinetic and thermodynamic data, we have established the free energy landscape of this two-state folding system. Considering that similar conformational change may exist in other native G-rich sequences, this work highlights an important hairpin to G4 conformational transition which can be used in manipulation of gene regulation or ligand modulation in vivo.

In-cell optical imaging of exogenous G-quadruplex DNA by fluorogenic ligands.

Guanine-rich oligonucleotides (GROs) are promising therapeutic candidate for cancer treatment and other biomedical application. We have introduced a G-quadruplex (G4) ligand, 3,6-bis(1-methyl-4-vinylpyridinium) carbazole diiodide, to monitor the cellular uptake of naked GROs and map their intracellular localizations in living cells by using confocal microscopy. The GROs that form parallel G4 structures, such as PU22, T40214 and AS1411, are detected mainly in the lysosome of CL1-0 lung cancer cells after incubation for 2 h. On the contrary, the GROs that form non-parallel G4 structures, such as human telomeres (HT23) and thrombin binding aptamer (TBA), are rarely detected in the lysosome, but found mainly in the mitochondria. Moreover, the fluorescence resonant energy transfer studies of fluorophore-labeled GROs show that the parallel G4 structures can be retained in CL1-0 cells, whereas the non-parallel G4 structures are likely distorted in CL1-0 cells after cellular uptake. Of interest is that the distorted G4 structure of HT23 from the non-parallel G4 structure can reform to a probable parallel G4 structure induced by a G4 ligand in CL1-0 living cells. These findings are valuable to the design and rationale behind the possible targeted drug delivery to specific cellular organelles using GROs.

A cis-element with mixed G-quadruplex structure of NPGPx promoter is essential for nucleolin-mediated transactivation on non-targeting siRNA stress.

We reported that non-targeting siRNA (NT-siRNA) stress induces non-selenocysteine containing phospholipid hydroperoxide glutathione peroxidase (NPGPx) expression to cooperate with exoribonuclease XRN2 for releasing the stress [Wei,P.C., Lo,W.T., Su,M.I., Shew,J.Y. and Lee,W.H. (2011) Non-targeting siRNA induces NPGPx expression to cooperate with exoribonuclease XRN2 for releasing the stress. Nucleic Acids Res., 40, 323-332]. However, how NT-siRNA stress inducing NPGPx expression remains elusive. In this communication, we showed that the proximal promoter of NPGPx contained a mixed G-quadruplex (G4) structure, and disrupting the structure diminished NT-siRNA induced NPGPx promoter activity. We also demonstrated that nucleolin (NCL) specifically bonded to the G4-containing sequences to replace the originally bound Sp1 at the NPGPx promoter on NT-siRNA stress. Consistently, overexpression of NCL further increased NPGPx promoter activity, whereas depletion of NCL desensitized NPGPx promoter to NT-siRNA stress. These results suggest that the cis-element with mixed G4 structure at the NPGPx promoter plays an essential role for its transactivation mediated by NCL to release cells from NT-siRNA stress.

Molecular engineering of G-quadruplex ligands based on solvent effect of polyethylene glycol.

Because various non-parallel G-quadruplexes of human telomeric sequences in K+ solution can be converted to a parallel G-quadruplex by adding polyethylene glycol (PEG) as a co-solvent, we have taken advantage of this property of PEG to study the covalent attachment of a PEG unit to a G-quadruplex ligand, 3,6-bis(1-methyl-4-vinylpyridinium) carbazole diiodide (BMVC). The hybrid ligand with the PEG unit, BMVC-8C3O or BMVC-6C2O by substituting either the tetraethylene glycol or the triethylene glycol terminated with a methyl-piperidinium cation in N-9 position of BMVC, not only induces structural change from different non-parallel G-quadruplexes to a parallel G-quadruplex but also increases the melting temperature of human telomeres in K+ solution by more than 45°C. In addition, our ligand work provides further confidence that the local water structure plays the key to induce conformational change of human telomere.

The regulatory role of activating transcription factor 2 in inflammation.

Activating transcription factor 2 (ATF2) is a member of the leucine zipper family of DNA-binding proteins and is widely distributed in tissues including the liver, lung, spleen, and kidney. Like c-Jun and c-Fos, ATF2 responds to stress-related stimuli and may thereby influence cell proliferation, inflammation, apoptosis, oncogenesis, neurological development and function, and skeletal remodeling. Recent studies clarify the regulatory role of ATF2 in inflammation and describe potential inhibitors of this protein. In this paper, we summarize the properties and functions of ATF2 and explore potential applications of ATF2 inhibitors as tools for research and for the development of immunosuppressive and anti-inflammatory drugs.

Emulsified BMVC derivative induced filtration for G-quadruplex DNA structural separation.

A novel method based on emulsion/filtration is introduced for G-quadruplex DNA structural separation. We first synthesized a lipophilic analogue of BMVC, 3,6-Bis(1-methyl-4-vinylpyridinium)-9-(12'-bromododecyl) carbazole diiodide (BMVC-12C-Br), which can form an oil-in-water (o/w) phase emulsion. Due to the binding preferences of BMVC-12C-Br emulsion to some specific DNA structures, the large emulsion (∼2 µm) bound DNA was separated from the small free DNA in the filtrate by a 0.22 µm pore size MCE membrane. This method is able to isolate the non-parallel G-quadruplexes from the parallel G-quadruplexes and the linear duplexes from both G-quadruplexes. In addition, this method allows us not only to determine the absence of the parallel G-quadruplexes of d(T(2)AG(3))(4) and the presence of the parallel G-quadruplexes of d(T(2)AG(3))(2) in K(+) solution, but also to verify structural conversion from antiparallel to parallel G-quadruplexes of d[AG(3)(T(2)AG(3))(3)] in K(+) solution under molecular PEG condition. Moreover, this emulsion can separate the non-parallel G-quadruplexes of d(G(3)CGCG(3)AGGAAG(5)CG(3)) monomer from the parallel G-quadruplexes of its dimer in K(+) solution. Together with NMR spectra, one can simplify the spectra for both the free DNA and the bound DNA to establish a spectrum-structure correlation for further structural analysis.

NIN-like protein 7 transcription factor is a plant nitrate sensor.

Nitrate is an essential nutrient and signaling molecule for plant growth. Plants sense intracellular nitrate to adjust their metabolic and growth responses. Here we identify the primary nitrate sensor in plants. We found that mutation of all seven Arabidopsis NIN-like protein (NLP) transcription factors abolished plants' primary nitrate responses and developmental programs. Analyses of NIN-NLP7 chimeras and nitrate binding revealed that NLP7 is derepressed upon nitrate perception via its amino terminus. A genetically encoded fluorescent split biosensor, mCitrine-NLP7, enabled visualization of single-cell nitrate dynamics in planta. The nitrate sensor domain of NLP7 resembles the bacterial nitrate sensor NreA. Substitutions of conserved residues in the ligand-binding pocket impaired the ability of nitrate-triggered NLP7 to control transcription, transport, metabolism, development, and biomass. We propose that NLP7 represents a nitrate sensor in land plants.

Cryo-EM structure of an activated GPCR-G protein complex in lipid nanodiscs.

G-protein-coupled receptors (GPCRs) are the largest superfamily of transmembrane proteins and the targets of over 30% of currently marketed pharmaceuticals. Although several structures have been solved for GPCR-G protein complexes, few are in a lipid membrane environment. Here, we report cryo-EM structures of complexes of neurotensin, neurotensin receptor 1 and Gαi1ß1γ1 in two conformational states, resolved to resolutions of 4.1 and 4.2 Å. The structures, determined in a lipid bilayer without any stabilizing antibodies or nanobodies, reveal an extended network of protein-protein interactions at the GPCR-G protein interface as compared to structures obtained in detergent micelles. The findings show that the lipid membrane modulates the structure and dynamics of complex formation and provide a molecular explanation for the stronger interaction between GPCRs and G proteins in lipid bilayers. We propose an allosteric mechanism for GDP release, providing new insights into the activation of G proteins for downstream signaling.

A biphenyl inhibitor of eIF4E targeting an internal binding site enables the design of cell-permeable PROTAC-degraders.

The eukaryotic translation initiation factor 4E (eIF4E) is the master regulator of cap-dependent protein synthesis. Overexpression of eIF4E is implicated in diseases such as cancer, where dysregulation of oncogenic protein translation is frequently observed. eIF4E has been an attractive target for cancer treatment. Here we report a high-resolution X-ray crystal structure of eIF4E in complex with a novel inhibitor (i4EG-BiP) that targets an internal binding site, in contrast to the previously described inhibitor, 4EGI-1, which binds to the surface. We demonstrate that i4EG-BiP is able to displace the scaffold protein eIF4G and inhibit the proliferation of cancer cells. We provide insights into how i4EG-BiP is able to inhibit cap-dependent translation by increasing the eIF4E-4E-BP1 interaction while diminishing the interaction of eIF4E with eIF4G. Leveraging structural details, we designed proteolysis targeted chimeras (PROTACs) derived from 4EGI-1 and i4EG-BiP and characterized these on biochemical and cellular levels. We were able to design PROTACs capable of binding eIF4E and successfully engaging Cereblon, which targets proteins for proteolysis. However, these initial PROTACs did not successfully stimulate degradation of eIF4E, possibly due to competitive effects from 4E-BP1 binding. Our results highlight challenges of targeted proteasomal degradation of eIF4E that must be addressed by future efforts.