[Molecular mechanisms of quinolone resistance in non-typhoidal Salmonella].

By conducting retrospective analysis, this study aim to investigate the resistance mechanism of quinolones in non-typhoidal Salmonella (NTS). A total of 105 strains of NTS isolated from clinical specimens from the Fifth Affiliated Hospital of Southern Medical University from May 2020 to February 2021 were used as research objects. VITEK2 Compact automatic identification drug sensitivity analysis system and serological test were used to identify the strains. The sensitivity of the strains to ciprofloxacin, levofloxacin and nalidixic acid was detected by AGAR dilution method. The whole genome of 105 strains of NTS was sequenced. Abricate and other softwares were used to analyze drug-resistant genes, including plasmid-mediated quinolone resistance gene (PMQR) and Quinolone resistance determination region (QRDR). Serotypes and ST types were analyzed using SISTR and MLST, and phylogenetic trees were constructed. The results showed that the NTS isolated in this region were mainly ST34 Salmonella typhimurium (53.3%). The drug sensitivity results showed that the drug resistance rates of NTS to ciprofloxacin, levofloxacin and nalidixic acid were 30.4%, 1.9% and 22.0%, respectively, and the intermediate rates of ciprofloxacin and levofloxacin were 27.6% and 54.2%.A total of 46 (74.2%) of the 62 quinolone non-susceptible strains carried the PMQR gene, mainly qnrS1 (80.4%), followed by aac(6')-Ib-cr(15.2%); there were 14 NTS and 8 NTS had gyrA and parC gene mutations, respectively. The gyrA was mutations at the amino acid position 87, Asp87Tyr, Asp87Asn, Asp87Gly, and Thr57Ser mutations were detected in parC. In conclusion, this study found that NTS had relatively high resistance to quinolones, carrying qnrS1 gene mainly resulted in decreased sensitivity of NTS to ciprofloxacin and levofloxacin, and gyrA:87 mutation mainly resulted in NTS resistance to Nalidixic acid; Salmonella typhimurium in clinical isolates showed clonal transmission and required further epidemiological surveillance.

[Factor analysis of effective platelet-producing ability of fetal liver-derived cells].

Objective: To study the different factors affecting platelet production post transplantation of hematopoietic stem cells (HSCs) isolated from different sources in order to explore novel options for treating platelet depletion following HSCs transplantation. Methods: HSCs and their downstream derivatives including myeloid and lymphoid cells (i.e., collective of mononuclear cells (MNCs)), were isolated from E14.5 fetal liver (FL) and bone marrow (BM) of 8-week-old mice by Ficoll separation technique. These cells were subsequently transplanted into the tibia bone marrow cavity of recipient mice post lethal myeloablative treatment in order to construct the FL-MNCs and BM-MNCs transplantation mouse model. Routine blood indices were examined in these recipient mice. The chimeric rate of donor cells in recipient peripheral blood cells were determined by flow cytometry. Different groups of cells involved in platelet reconstruction were analyzed. CD41+megakaryocytes were sorted from fetal liver or bone marrow using magnetic beads, which were then induced to differentiate into platelets in an in vitro assay. Quantitative RT-PCR was used to detect the expression of platelet-related genes in CD41+megakaryocytes from the two sources. Results: Both the FL-MNCs and the BM-MNCs transplantation groups resumed normal hematopoiesis at the 4th week after transplantation, and the blood cells of the recipient mice were largely replaced by the donor cells. Compared with the mice transplanted with BM-MNCs, the platelet level of mice transplanted with FL-MNCs recovered faster and were maintained at a higher level. At week 4, the PLT level of the FL-MNCs group was (1.45±0.37)×1012/L, and of the BM-MNCs group was (1.22±0.24)×1012/L, P<0.05. The FL-MNCs contain a higher proportion of hematopoietic stem cells (Lin-Sca-1+c-Kit+)(7.60%±1.40%) compared to the BM-MNCs (1.10%±0.46%), P<0.01; the proportion of the megakaryocyte progenitor cells (Lin-Sca-1-c-Kit+CD41+CD150+) and mature megakaryocyte cells (CD41+CD42b+), also differ significantly between the FL-MNCs (3.05%±0.22%, 1.60%±0.06%, respectively) and the BM-MNCs (0.15%±0.02%, 0.87%±0.11%, respectively) groups, both P<0.01. In vitro functional studies showed that FL-MNCs-CD41+megakaryocytes could produce proplatelet-like cells more quickly after induction, with proplatelet-like cells formation on day 3 and significant platelet-like particle formation on day 5, in contrast to bone marrow-derived BM-MNCs-CD41+megakaryocytes that failed to form proplatelet-like cell on day 5. In addition, FL-MNCs-CD41+cells expressed higher levels of platelet-related genes, Mpl (3.25-fold), Fog1 (3-fold), and Gata1 (1.5-fold) (P<0.05). Conclusion: Compared with the BM-MNCs group, the FL-MNCs transplantation group appears to have a more efficient platelet implantation effect in the HSCs transplantation recipient in vivo, as well as a higher platelet differentiation rate in vitro. This might be related to a higher proportion of megakaryocytes and higher expression levels of genes such as Mpl, Fog1, and Gata1 that could be important for platelet formation in FL-MNCs-CD41+cells. Further exploration of the specific functions of these genes and the characteristics of the different proportions of the donor cells will provide valuable clues for the future treatment of platelets reconstitution after HSCs transplantation clinically.

[The effect of DNA hydroxymethylase Tet2 on γ globin activation in the treatment of ß-thalassemia].

Objective: To study the function of ten-eleven translocation 2 (Tet2) in γ globin gene expression in patients with ß- thalassemia. Methods: Gamma globin expression was induced by 5-azacytidine and Tet2 gene expression was knocked down by short hairpin RNA (shRNA) in a human immortalized myelogenous leukemia K562 cell line. The global 5-hydroxymethylcytosine (5hmC) level was measured by an ELISA kit. 5hmC level of γ globin gene was quantified by sulfite sequencing. The mRNA level of Tet2, γ globin, and related transcription factors Nfe4 and Klf1 were quantified by real-time PCR. Results: Tet2 knockdown resulted in a decreased global 5hmC level from 0.14% to 0.03% as of the control group in K562 cells. The expression of γ globin was enhanced after 5-azacytidine treatment in vitro. However, γ globin mRNA level in Tet2 knockdown cells was only 55% as that in control group. The CG sites on γ globin gene were unmethylated. As Tet2 was down-regulated, the expression levels of Nfe4 and Klf1 decreased by about 80% and increased to 3.5 folds, respectively. Conclusions: Tet2 appears to maintain 5hmC level and facilitates γ globin gene activation. Moreover, Tet2 more likely regulates γ globin expression via affecting transcription factors rather than the gene itself. Thus, Tet2 could be a potential therapeutic target for ß thalassemias.

Genetic diversity of HLA-DRB1 alleles in the Tujia population of Wufeng, Hubei Province, China.

We established a genetic database by investigating human leukocyte antigen (HLA)-DRB1 allelic frequencies in a disease-association study in the Tujia population in Wufang, Hubei, China. The allele frequencies of the HLA-DRB1 locus in 262 healthy, unrelated Tujia individuals living in the Wufeng region of the Hubei Province were analyzed using the Luminex HLA sequence-specific oligonucleotide method with a WAKFlow HLA typing kit. A total of 13 alleles were detected at the HLA-DRB1 locus. HLA-DRB1*09 was the most common allele (22.52%), followed by DRB1*08 and DRB1*15 (11.07%), and DRB1*12 and DRB1*04 (10.69%). These data were compared with the results obtained for 10 other ethnic groups living in other regions as well as to Han groups using neighbor-joining dendrograms and principal component analysis. The results showed that the Tujia population has a close genetic relationship with the Middle Han population at the HLA-DRB1 locus. This information will be useful for HLA-DRB1-linked disease-association studies.

First Report of the Root-Knot Nematode Meloidogyne enterolobii Infecting Jujube in China.

Jujube (Ziziphus jujuba Mill.) is an economically-important fruit crop grown in Europe, Australia, and southern/eastern Asia. In China, it is often called red date and the fruit is used in traditional Chinese herbal medicine and wine. In February 2014, jujube plants growing in a sandy soil in Sanya, Hainan Province, China, were observed exhibiting symptoms of decline, including stunting, wilting, and no flowering or fruit set. Roots systems of sick plants (n = 20) had many galls, the typical symptoms of root-knot nematode infection, and the incidence of infection was 100%. These galls were formed in the primary, secondary, and tertiary roots. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 72 females on average (n = 20). The perineal patterns of females (n = 10) were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. Second-stage juveniles (n = 20) had large and triangular lateral lips and broad, bluntly rounded tail tips. These morphological characteristics are the same as those for Meloidogyne enterolobii Yang & Eisenback 1983 (5). Identification was further confirmed after DNA extraction from 12 nematodes. Part of the rDNA spanning the internal transcribed spacer (ITS) 1, 5.8S gene, and ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (4). A 764-bp fragment was amplified, which was 100% identical to sequences of M. enterolobii (GenBank Accession Nos. KJ146863, KF418369, JQ082448, and JX024149) in GenBank. Species identification was confirmed by using PCR to amplify mitochondrial (mt) DNA and rDNA intergenic spacers (IGS) 2 with primers C2F3/1108 (GGTCAATGTTCAGAAATTTGTGG/TACCTTTGACCAATCACGCT) (3) and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), respectively (2). The PCR products were approximately 700 bp for mtDNA and 200 bp for rDNA-IGS2, which were also identical to those previously reported for M. enterolobii (2,3). M. enterolobii is considered as one of the most damaging root-knot nematode species due to its wide host range, high reproduction rate, and ability to overcome the resistance genes (Mi-1, Mh, Mir1, N, Tabasco, and Rk) in several crops (1). It is reported that over 20 plant species from eight families (Annonaceae, Apiaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae) in China are hosts for M. enterolobii. To our knowledge, this is the first report of jujube as a host of M. enterolobii and the first record of M. enterolobii as a parasite of a plant in the family Rhamnaceae in China. References: (1) P. Castagnone-Sereno. Nematology 14:133, 2002. (2) H. Long et al. Acta Phytopathol. Sinica 36:109, 2006. (3) T. O. Powers and T. S. Harris. J. Nematol. 25:1, 1993. (4) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Effect of rehabilitation on the long-term efficacy of botulinum toxin-A for spastic cerebral palsy.

OBJECTIVE: To investigate the long-term effects of botulinum toxin-A (BTX-A) nerve block on relaxation of spasticity in cerebral palsy. PATIENTS AND METHODS: From June 2015 to December 2018, 52 children, aged 20-56 months, with spastic cerebral palsy were treated with BTX-A. The dose of BTX-A was selected based on the weight of the child and the modified Ashworth scale (MAS). The injection dose ranged from 45 IU to 150 IU (average 68.0±31.6 IIU). The muscle tone and motor functions of all children were evaluated before the block. The spasticity was measured using the MAS, and the motor function was measured using the Physician Rating Scale (PRS) and the gross motor function measure (GMFM). After two years, all children were re-evaluated. RESULTS: No significant difference was observed between the trial and control groups in terms of age, weight, MAS, PRS, and GMFM measurements before the block (p>0.05). The PRS and GMFM improved significantly in both groups after two years (p<0.05). The PRS and GMFM in the trial group increased more significantly than those in the control group (p<0.05). CONCLUSIONS: The BTX-A block showed a long-term positive effect. Rehabilitation training after the block could help children to improve their motor functions.

A Hemodynamic Mechanism Correlating with the Initiation of MCA Bifurcation Aneurysms.

BACKGROUND AND PURPOSE: Previous studies have reported that MCA bifurcation aneurysms usually emerge on inclined bifurcations; however, the reason is unclear. We designed this study to explore hemodynamic mechanisms that correlate with the initiation of MCA bifurcation aneurysms. MATERIALS AND METHODS: Fifty-four patients with unilateral MCA bifurcation aneurysms and 54 control patients were enrolled in this study after propensity score matching, and their clinical and CTA data were collected. We extracted the morphologic features of aneurysmal MCA bifurcations to build a simplified MCA bifurcation model and performed a computational fluid dynamics analysis. RESULTS: The presence of MCA aneurysms correlated with smaller parent-daughter angles of MCA bifurcations (P < .001). Aneurysmal MCA bifurcations usually presented with inclined shapes. The computational fluid dynamics analysis demonstrated that when arterial bifurcations became inclined, the high-pressure regions and low wall shear stress regions shifted from the apexes of the arterial bifurcations to the inclined daughter arteries, while the initial sites of MCA bifurcation aneurysms often overlapped with the shifted high-pressure regions and low wall shear stress regions. CONCLUSIONS: Our results suggest that the initiation of MCA bifurcation aneurysms may correlate with shifts of high-pressure regions and low wall shear stress regions that occur on inclined MCA bifurcations.

Molecular epidemiology of the novel coronavirus that causes severe acute respiratory syndrome.

BACKGROUND: Severe acute respiratory syndrome (SARS) is a newly emerged disease caused by a novel coronavirus (SARS-CoV), which spread globally in early 2003, affecting over 30 countries. We have used molecular epidemiology to define the patterns of spread of the virus in Hong Kong and beyond. METHODS: The case definition of SARS was based on that recommended by WHO. We genetically sequenced the gene for the S1 unit of the viral spike protein of viruses from patients with SARS in Hong Kong (138) and Guangdong (three) in February to April, 2003. We undertook phylogenetic comparisons with 27 other sequences available from public databases (Genbank). FINDINGS: Most of the Hong Kong viruses (139/142), including those from a large outbreak in an apartment block, clustered closely together with the isolate from a single index case (HKU-33) who came from Guangdong to Hong Kong in late February. Three other isolates were genetically distinct from HKU-33 in Hong Kong during February, but none of these contributed substantially to the subsequent local outbreak. Viruses identified in Guangdong and Beijing were genetically more diverse. INTERPRETATION: The molecular epidemiological evidence suggests that most SARS-CoV from the outbreak in Hong Kong, as well as the viruses from Canada, Vietnam, and Singapore, are genetically closely linked. Three viruses found in Hong Kong in February were phylogenetically distinct from the major cluster, which suggests that several introductions of the virus had occurred, but that only one was associated with the subsequent outbreak in Hong Kong, which in turn spread globally.

Correlation of expression of binding sites for synthetic blood group A-, B- and H-trisaccharides and for sarcolectin with survival of patients with bronchial carcinoma.

Carrier-immobilised carbohydrates were used to monitor the presence of specific carbohydrate-binding sites in tissue sections. Sarcolectin, an interferon-alpha/beta antagonist and growth regulator, had been shown to bind the lymphokine macrophage migration inhibitory factor (MIF). The lectin is thus a MIF-specific probe. Biotinylated sarcolectin, neoglycoproteins with lactose or N-acetylglucosamine residues, and polyacrylamide-attached trisaccharides, that represent the ABH histo-blood group antigens, were applied to sections of 187 primary lung carcinomas. The panel of cases consisted of 57 epidermoid carcinomas, 55 adenocarcinomas, 43 large cell anaplastic carcinomas and 32 small cell anaplastic carcinomas. 47 cases with intrapulmonary metastatic tumours were also included. Expression of binding sites of both sarcolectin and trisaccharides of histo-blood group antigens A and H correlated with patient survival in lung cancer. In view of the widely performed analysis of the presence of histo-blood group antigens, concomitant profiling of binding sites for these sugar components is suggested to be of potential benefit.

Differential expression of calcyclin and its accessible ligands in various types of cutaneous tumors.

Calcyclin is the product of a gene that is regulated in dependence of the cell cycle in fibroblasts in vitro. It has recently been proven to be a sialic acid-binding protein in vitro and in the case of mammalian tissues to bind specifically to annexin II, annexin VI, annexin XI, and glyceraldehyde-3-phosphate dehydrogenase in a Ca(2+)-dependent manner. Since calcyclin can be labelled without impairment of its binding activity, it can be employed as a histochemical tool to localize its accessible ligands. Concomitantly, immunohistochemical localization of calcyclin with a specific antibody is warranted. By using histochemical and immunohistochemical techniques, the expression of calcyclin and its accessible binding sites are demonstrated in serial sections of normal skin and benign, pre-cancerous and malignant tumors of the skin, namely in verruca vulgaris, papillary hidradenoma, syringoma, keratoacanthoma, Bowen's disease, squamous cell carcinoma, melanocytic naevi, primary and metastatic malignant melanoma and non-Hodgkin lymphoma (NHL) of the skin. Cytoplasmic and nuclear expression of calcyclin and its ligands is unexceptionally found in normal skin, epithelial tumors and benign melanocytic tumors. Presence of calcyclin and calcyclin-binding sites is detected in more than 80% of tumor cells in the epithelial lesions. In the group of melanomas and lymphomas heterogeneity is obvious. The application of annexin-specific antibodies raises evidence that members of this protein family co-localize with calcyclin in situ to some extent. These findings suggest that calcyclin and accessible calcyclin-binding molecules, like certain annexins, may be differentially regulated in melanomas and lymphomas in contrast to epithelial lesions with presently undefined biological implications.

Detection of sarcolectin-specific receptors like the cytokine macrophage migration inhibitory factor in rheumatoid nodules.

The objective of this study was the evaluation of the relation between the N-acetyl-neuraminic acid-binding endogenous lectin sarcolectin and the cytokine macrophage migration inhibitory factor (MIF) during development of rheumatoid nodules (RN) in seropositive rheumatoid arthritis (RA). Sarcolectin was purified and biotinylated. The binding patterns of this probe were analyzed in RN from patients with RA (n = 23) and compared with the distribution of antibodies with specificity for MIF, fibrin, fibronectin. In early RN, all areas of the inflammatory tissue displayed presence of receptors for sarcolectin. Macrophages were especially positive. In mature rheumatoid nodules binding of sarcolectin was restricted to the periphery of necrotic areas, to endothelial cells and perivascular connective tissue of marginal zones. Distribution patterns of MIF were similar but not identical. The histological staining characteristics demonstrate sarcolectin-binding receptors in RN that are altered upon disease progression. The finding suggests that specific interactions between this endogenous lectin and MIF may be involved in the course of RA.

Structure-function analysis of muscarinic acetylcholine receptors.

The structural basis underlying the G protein coupling selectivity of different muscarinic receptor subtypes was analyzed by using a combined molecular genetic/biochemical approach. These studies led to the identification of key residues on the receptors as well as the associated G proteins that are critically involved in determining proper receptor/G protein recognition. Mutational analysis of the m3 muscarinic receptor showed that most native cysteine residues are not required for productive receptor/G protein coupling. The putative extracellular disulfide bond was found to be essential for efficient trafficking of the receptor protein to the cell surface but not for receptor-mediated G protein activation.

The complete genome sequence of severe acute respiratory syndrome coronavirus strain HKU-39849 (HK-39).

The complete genomic nucleotide sequence (29.7kb) of a Hong Kong severe acute respiratory syndrome (SARS) coronavirus (SARS-CoV) strain HK-39 is determined. Phylogenetic analysis of the genomic sequence reveals it to be a distinct member of the Coronaviridae family. 5' RACE assay confirms the presence of at least six subgenomic transcripts all containing the predicted intergenic sequences. Five open reading frames (ORFs), namely ORF1a, 1b, S, M, and N, are found to be homologues to other CoV members, and three more unknown ORFs (X1, X2, and X3) are unparalleled in all other known CoV species. Optimal alignment and computer analysis of the homologous ORFs has predicted the characteristic structural and functional domains on the putative genes. The overall nucleotides conservation of the homologous ORFs is low (<5%) compared with other known CoVs, implying that HK-39 is a newly emergent SARS-CoV phylogenetically distant from other known members. SimPlot analysis supports this finding, and also suggests that this novel virus is not a product of a recent recombinant from any of the known characterized CoVs. Together, these results confirm that HK-39 is a novel and distinct member of the Coronaviridae family, with unknown origin. The completion of the genomic sequence of the virus will assist in tracing its origin.

Structure-function analysis of muscarinic receptors and their associated G proteins.

Each member of the muscarinic receptor family (M1-M5) can interact only with a limited subset of the many structurally closely related heterotrimeric G proteins expressed within a cell. To understand how this selectivity is achieved at a molecular level, we have used the G(i/0)-coupled M2 and the Gq/11-coupled M3 muscarinic receptors as model systems. We developed a genetic strategy involving the coexpression of wild type or mutant muscarinic receptors with hybrid or mutant G protein alpha subunits to identify specific, functionally relevant receptor/G protein contact sites. This approach led to the identification of N- and C-terminal amino acids on alpha(q) and alpha(i) that are critical for maintaining proper receptor/G protein coupling. Moreover, several receptor sites were identified that are likely to be contacted by these functionally critical G alpha residues. To gain deeper insight into muscarinic receptor structure, we recently developed a cysteine disulfide cross-linking strategy, using the M3 muscarinic receptor as a model system. Among other structural modifications, this approach involves the removal of most native cysteine residues by site-directed mutagenesis, the insertion of three factor Xa cleavage sites into the third intracellular loop, and systematic 'reintroduction' of pairs of cysteine residues. Following treatment of receptor-containing membrane preparations with factor Xa and oxidizing agents, disulfide cross-linked products can be identified by immunoprecipitation and immunoblotting studies. This approach should greatly advance our knowledge of the molecular architecture of muscarinic and other G protein-coupled receptors.

Detection of the lymphokine migration inhibitory factor in normal and disease-affected lung by antibody and by its major binding protein, the interferon antagonist sarcolectin.

Human migration inhibitory factor (MIF) is suggested to play a notable role in regulation of macrophage functions in host defense. A major binding component for the lymphokine in human tissue is the interferon antagonist sarcolectin. This high-affinity interaction gives access to MIF by affinity chromatography on immobilized sarcolectin and may be of significance for in situ activity of MIF. Localization of MIF is one step towards answering this question. Labelled sarcolectin and MIF-specific antibodies can be employed to analyze the expression of the factor. Surgical specimens of 74 patients, who underwent lobe/lung resection or diagnostic biopsy, were fixed with buffered formalin and embedded in paraffin. The material consisted of 36 cases of morphologically normal lung parenchyma of patients, suffering from bronchial carcinoma, of 16 cases with sarcoidosis, of 15 cases with tuberculosis and of 7 cases with idiopathic interstitial pneumonitis. The two types of probe to visualize presence of MIF invariably showed the same level of reactivity, underscoring the potential physiological significance of sarcolectin-MIF interaction. In detail, all cases with pneumonitis, most tuberculosis-affected as well as normal cases and 44% of the cases with sarcoidosis were positive. All positive cases with sarcoidosis and some cases from the other groups revealed accessible binding sites for biotinylated MIF.

Correlation of galectin-3/galectin-3-binding sites with low differentiation status in head and neck squamous cell carcinomas.

The accurate determination of levels of differentiation is of prognostic value in human head and neck squamous cell carcinomas (HNSCCs). Because the deliberate selection of biochemical determinants accompanying certain stages of differentiation can refine the predictive power of histochemical assessments, the application of the quantitative evaluation of staining distribution and intensity by computer-assisted microscopy is one prerequisite to potential improvements. We used 2 innovative approaches with peanut agglutinin based on encouraging results with respect to common lectin-histochemistry. First, we used a custom-made neoglycoprotein to monitor the presence of Thomsen-Friedenreich (T) antigen-binding sites. Second, we measured the presence of 2 galectins immunohistochemically and, at the same time, measured lectin-histochemically the presence of accessible ligands for the endogenous lectins. We also monitored the presence of calcyclin, a protein with relevance to cell cycle progression or exocytosis. With 61 cases of HNSCC as their basis, including 31 oral, 20 laryngeal, and 10 hypopharyngeal lesions, the data show that the main modifications observed in connection with a loss of differentiation are related to a modification in the levels of both galectin-3/galectin-3-binding site and T-antigen/T-antigen-binding site expressions. The data obtained also suggest that galectin-3 could act as an acceptor site for the T antigen. Because the level of differentiation is known to be indicative of the recurrence rate in HNSCCs and our data clearly indicate that galectin-3 and the T antigen (and their respective binding sites) are involved in dedifferentiation processes, further investigation is warranted into the roles of galectins in HNSCC tumor progression and recurrence analysis.

Selection of in vitro produced, transgenic embryos by nested PCR for efficient production of transgenic goats.

The production of valuable pharmaceutical proteins using transgenic animals as bioreactors has become one of the goals of biotechnology. However, the efficiency of producing transgenic animals by means of pronuclear microinjection is low. This may be attributed in part to the low integration rate of foreign DNA. Therefore, a large number of recipients are required to produce transgenic animals. We recently developed a transgenic procedure that combined the techniques of goat oocyte in vitro maturation (IVM), in vitro fertilization (IVF), microinjection, preimplantation selection of the transgenic embryos with nested PCR and transferring the transgenic embryos into the recipient goat uterus to produce transgenic goats. Thirty-seven transgenic embryos determined by nested PCR were transferred to thirty-two recipient goats. In the end, four live-born kids were produced. As predicted, all the live kids were transgenic as identified by PCR as well as Southern blot hybridization, The integration rate was 100% (4/4) which was completely in accordance with the results of embryo preimplantation detection. The results showed a significant decrease in the number of recipients required as only 8 recipients (32/4) were needed to obtain one live transgenic goat. We suggest that the transgenic system described herein may provide an improved way to efficiently produce transgenic goats on a large scale.

Sialic acid-binding proteins: characterization, biological function and application.

The last decade has witnessed steadily growing support for the notion that the carbohydrate portion of glycoconjugates is not merely an inert structural addition to the protein or lipid backbone. Considerable attention has been given to the chemical composition of glycosidic residues in such heteropolymers. Sialic acids are frequently occurring components of oligosaccharide side chains in glycoconjugates of most higher animals and a few microorganisms. They appear to play an important role as ligands in glycobiological interactions. Mediation of a proposed protein-carbohydrate recognition will necessarily involve a binding protein with the respective specificity. Such proteins thus are able to serve as receptors for certain types of carbohydrate moieties like sialic acids in vivo. Various members of this class of proteins have already proven their value as analytical tools in studying expression and localization of defined sialoglycoconjugates. These proteins attract much attention due to both their functions in situ and their potential as laboratory tools in glycoconjugate research in areas like biochemistry or histology. We present a survey of the purification, characterization and application of this class of proteins to illustrate the status of knowledge and the current directions of research in this field.

Study of the RNA splicing defect in the common Chinese beta-thalassemia gene, IVS-II nt. 654 C-->T by using mRNA/PCR.

With direct sequencing of the amplified cDNA, we analysed the transcript and mRNA splicing defect in a common Chinese beta-thalassemia mutant (IVS-II nt. 654 C-->T). The result shows that this mutant gene would not only produce abnormally processed beta-globin mRNA, but also transcribes a small amount of normally spliced mRNA, hence leading to beta+ thalassemia. The method described herein provides a simple and sensitive approach to the studies of gene expression and molecular defects in genetic diseases at transcriptional level.

Treatment of beta-thalassemia with hydroxyurea (HU)--effects of HU on globin gene expression.

A newly developed method of RT-PCR/competitive PCR for measuring the relative and absolute content of globin mRNAs as well as micro-globin chain biosynthetic assay have been used to study the alterations of globin gene expressions in the patients with beta-thalassemia pre- and post-hydroxyurea (HU) treatment. It was found for the first time that HU had the effect of enhancing beta-globin gene expression in some patients. Two cases with beta-thalassemia who were subjected to HU treatment for over two years showed a marked increase in beta-globin mRNA level and beta-globin chain synthesis, resulting in more effective erythropoiesis and the alleviation of clinical symptoms.