Detection, Characterization, and Distribution of the First Case of Pepino Mosaic Virus in Aotearoa New Zealand.

Tomato (Solanum lycopersicum L., family Solanaceae) represents one of the most economically valuable horticultural crops worldwide. Tomato production is affected by numerous emerging plant viruses. We identified, for the first time in New Zealand (NZ), Pepino mosaic virus (PepMV) in greenhouse grown tomato crops using a combination of methods from electron microscopy and herbaceous indexing to RT-qPCR and high-throughput sequencing. Phylogenetic and genomic analysis of a near-complete PepMV genome determined that the detected strain belonged to the mild form of the CH2 lineage of the virus. Subsequently, a delimiting survey of PepMV was conducted, and PepMV was detected at four additional locations. PCR-derived sequences obtained from samples collected from different greenhouses and from herbaceous indicator plants were identical to the original sequence. Since PepMV has never been reported in NZ before, seed pathways are speculated to be the most likely source of entry into the country.

Construction of an infectious clone of citrus chlorotic dwarf-associated virus and confirmation of its pathogenicity.

Citrus chlorotic dwarf disease (CCDD) seriously affects the citrus industry. Citrus chlorotic dwarf-associated virus (CCDaV) is speculated to be the causal agent of CCDD. However, this speculation has not been confirmed by fulfilling Koch's postulates. In this study, an infectious clone was constructed that comprises a 1.6-fold tandem CCDaV genome in the binary vector pBinPLUS and agro-inoculated into Eureka lemon (Citrus limon) seedlings through vacuum infiltration. At 60 days post inoculation, 25% of the Eureka lemon seedlings developed symptoms of crinkling and curling that are the same as those associated with the wild-type virus. Western blotting and graft transmission assays confirmed that the infectious clone systemically infected Eureka lemon seedlings. In addition, CCDaV can establish infection on three more Citrus species and one hybrid, although at different infection rates. These findings support that CCDaV is the primary causal agent of CCDD. The infectious CCDaV clone will allow further studies on the functions of viral proteins and molecular interactions of CCDaV with its hosts.

First Report of Cacao Mild Mosaic Virus Associated with Cacao (Theobroma cacao) in Hawai'i, USA.

Cacao, Theobroma cacao, is an important tropical agricultural crop and the key ingredient of chocolate, which has an international trade value of $103 billion/year (Marelli et al. 2019). Cacao mild mosaic virus (CaMMV) is a badnavirus that causes mild symptoms compared with some of the closely related species of Cacao swollen shoot virus (CSSV), the latter of which are currently only found in West Africa (Marelli et al. 2019; Ullah et al. 2021). CaMMV was recently found in symptomatic commercial cacao trees in Mayagüez, Puerto Rico (Puig et al. 2020), and subsequently detected in a USDA ARS (Agricultural Research Service) quarantine greenhouse in Miami, FL (Puig 2021). The USDA ARS germplasm repository in Hilo, Hawai'i, USA serves as a backup collection for Puerto Rico's cacao germplasm, and field trials have been established from cacao germplasm from Miami to evaluate select varieties. To determine if CaMMV is present in the collection in Hilo, greenhouse and field accessions were tested. Using an optimized sampling and PCR protocol established by Puig (2021), three young cacao petioles per tree or seedling were collected and pooled, and DNA was extracted using the NucleoSpin Plant II commercial kit (Macherey-Nagel, Düren, Germany) following the manufacturer's instructions. Samples were molecularly identified via end point PCR, gel electrophoresis, and Sanger sequencing. PCR amplification of CaMMV using the virus-specific primer set Mia-1396F (5'-ACCGTGTCTAYCAGCACTGGA-3') and Mia-1667R (5'-GACCACCGTCAGCCAGAC-3') produced 289 bp amplicons. Of 230 plants sampled, 26 CaMMV positive detections were discovered in greenhouse and field plantings in Hilo. Most CaMMV+ plants contained some form of leaf chlorosis (96.2%). The sequenced PCR products from Hawai'i were deposited in GenBank (accession nos. OQ692890-OQ692891) and showed 99.2% nucleotide identity to CaMMV accessions from Puerto Rico (MW052520; n = 23) and 98.1% nucleotide identity to CaMMV accessions from Florida, USA (MZ409692; n = 3) in BLASTn analysis. For species-level confirmation, the RT-RNase H domain was amplified from 9 isolates using CaMMV-specific primers (Mia5385F, 5'-AGGACAACGGCTTTCTTGGT-3'/Mia6616R, 5'-GAGACTAACTTGGTTAGGGCT-3'), sequenced, and deposited in GenBank (accession nos. PP997461-PP997462). Sequences matched most closely to GenBank isolates from Puerto Rico (MT253659; 98.0%; n = 7) and Trinidad and Tobago (NC_033738; 97.1%; n = 2). CaMMV, previously known as cacao Trinidad virus A, was first reported in 1943 and was associated with 7 to 33% yield reduction, loss of vigor, and tree decline (Posnette 1944; Swarbrick 1961). CaMMV is known to exist in the Americas and was most recently detected in Brazil and Indonesia (Kandito et al. 2022; Ramos­Sobrinho et al. 2021). To the best of our knowledge, this is the first report of CaMMV infecting cacao in Hawai'i. The cacao industry continues to expand in Hawai'i, and cultivation occurs on at least four of the main islands including Hawai'i Island, O'ahu, Maui, and Kaua'i. To develop disease management strategies, further investigation is needed to define CaMMV symptomology, and determine the distribution and effect this virus has on production in Hawai'i. In the meantime, cacao will be screened regardless of visible symptomology to maintain pathogen-free accessions and avoid the transfer of virus-containing germplasm.

Inter- and Intra-Pathogen Interactions Emanating from Coinfection with Different Fungal and Viral strains in Canola Cultivars with Differing Host Resistances.

Few recent investigations examine coinfection interactions between fungal and viral plant pathogens. Here, we investigated coinfections between Leptosphaeria maculans and turnip mosaic virus (TuMV) in canola (Brassica napus). Different combinations of L. maculans isolate P11 and resistance breaking isolates L. maculans UWA192 and TuMV 12.1, were inoculated to three cultivars with differing pathogen resistances/susceptibilities. They were inoculated first to entire or half cotyledons 10-12 days after emergence, and second to opposite entire or half cotyledons on the same day (day 0) or 3 or 7 days afterwards. The parameters measured were L. maculans cotyledon disease index (%CDI), and TuMV systemically infected leaf symptom intensity (SI) and virus concentration (VC). Except when both day 0 inoculations were with isolate UWA192, %CDI values were supressed strongly or only weakly when isolates P11 and/or UWA192 were inoculated to plants with L. maculans single gene resistance (SGR) or polygenic resistance, respectively. However, except when isolate P11 was inoculated first and UWA192 second, these values declined after inoculation day 0 when SGR was absent. TuMV infection suppressed %CDI values, although this decrease was usually smaller following day 0 half cotyledon inoculations. When TuMV temperature sensitive extreme resistance was present and both inoculations were with TuMV, SI and VC values diminished greatly. However, the extent of this decrease was reduced when second inoculations were with L. maculans. SI and VC values were also smaller when SGR was present and second inoculations were with L. maculans. When L. maculans resistance was lacking, SI and VC values were smaller when second inoculations to entire cotyledons were with L. maculans rather than TuMV. This also occurred after second half cotyledon inoculations with isolate P11 but not isolate UWA192. Therefore, diverse inter- or intra-pathogen interactions developed depending upon host resistance, isolate combination, cotyledon inoculation approach and second inoculation timing.

First report of cucumber green mottle mosaic virus infecting Cynanchum rostellatum in China.

Cucumber green mottle mosaic virus (CGMMV) was first discovered on cucumber in the United Kingdom in 1935 (Ainsworth, 1935), and has spread worldwide except to Antarctica (Jones, 2021). Given its extensive damage, it is considered an important pathogen on global cucurbit plants and fruit crops. In China, CGMMV was first reported on pumpkin in Guangxi Province in 2003 (Qin et al., 2005), and occurred on 34 plants species across 23 provinces (Liu et al., 2016). Cynanchum rostellatum is a member of the family Apocynaceae. In July 2021, leaves of C. rostellatum exhibiting virus-like symptoms (yellowing, severe crinkling, deformation) were observed and collected in Liaoning Province, China. Aphids were also observed on the leaves and stems (Fig. S1) of the plants and were collected. Total RNA was extracted from diseased leaves following the CTAB method, followed by the depletion of ribosomal RNAs (rRNA) with TIANSeq rRNA Depletion Kit (Tiangen, China). The RNAs were, then processed into a DNBSEQ LncRNA-Seq library, and sequenced on the MGISEQ-2000 platform at BGI Genomics (Wuhan, China). A total of 106.98 M clean reads were obtained after data filtering using SOAPnuke software (BGI, China). The clean reads were assembled into contigs using CLC Genomics Workbench 11 (Qiagen, USA) and Trinity v2.0.6 (Haas et al., 2013). A contig (4,760 reads, average coverage:73.76) of 6,391 nucleotides was found to share the highest sequence identity (99.83%) with CGMMV isolate GDLZ (MK933286), irrespective of other virus-like contigs related to Polerovirus and Totivirus. Based on the genome of GDLZ isolate, seven specific primers (Table S1) were designed to amplify the full viral genomic sequences using a PrimeScriptTM One-Step RT-PCR Kit. Seven expected amplicons were obtained, cloned, and sequenced. The complete genome was determined to be 6,423 nucleotides (GenBank accession number OR854819) in length and designated as LNMJ isolate. LNMJ shared 96.8%-99.7% nucleotide sequence identities with CGMMV isolates from China. Phylogenetic analysis based on the complete genome sequences showed that LNMJ clustered together with CGMMV isolates hn (GenBank accession number KC851866), GDLZ (GenBank accession number MK933286), and JD8 (GenBank accession number KM873784) from China. The specific primers LM-TJ-3F/3R were designed to determine the virus-symptom association for LNMJ, and all twelve symptomatic C. rostellatum plants collected from fields tested positive for LNMJ. Two out of six randomly selected aphids from the diseased plants also tested positive. To further prove its infectivity, LNMJ was inoculated mechanically onto ten healthy Nicotiana benthamiana plants, and the results indicated a high infection rate of 80% (8/10), at 30 days post-inoculation despite no distinct symptoms observed. To our knowledge, this is the first report of the natural infection of C. rostellatum plants with CGMMV. C. rostellatum is a widespread herb in China (Wei et al., 2019) and more surveys are needed to determine the distribution of CGMMV. The habitats of C. rostellatum span diverse agroecological zones, and thus our study underscores the potential spillover of CGMMV to neighboring crops as a significant risk.

First report of pepper chlorosis-associated virus infecting tobacco (Nicotiana tabacum) plants in Sichuan Province in China.

Tobacco (Nicotiana tabacum) is an economically important crop in China, and more than 30 viruses have been reported to infect tobacco (Yin et al. 2022). In July 2022, we observed interveinal necrosis on tobacco leaves in fields in Sichuan Province (N 27.9172, E 105.6662) (Fig. 1). Total RNA was isolated from multiple leaves of one plant using an RNAprep Pure Polysaccharide Polyphenol Plant Total RNA Extraction Kit (TIANGEN, Beijing, China). Total RNAs were pooled, and a TruSeq Stranded Total RNA with RiboZero Gold Kit (Illumina, San Diego, CA, USA) was used to eliminate ribosomal RNA. An RNA-Seq library was constructed using VAHTS Universal V6 RNA-seq Library Prep (Nanjing Vazyme, China). High-throughput sequencing was performed on the Illumina DNBseq platform (BGI-ShenZhen, China), which yielded 20,102,087 reads with an average length of 150 nt (total size >6 Gb). Unaligned reads were assembled de novo using SPAdes (Bankevich et al. 2012). Contigs with length ≥200 nt were subjected to local BLASTn and BLASTx analyses against the GenBank nt and nr databases, respectively (Wang et al. 2022). A total of 23 contigs were identified through BLASTx (e-value cut-off = 10 -3), ranging from 631 to 1555 bp long, with 82% to 96% coverage to partial genomic sequences of pepper chlorosis-associated virus (PepCaV-Higashitsuno_2021; Accessions: LC719619 to LC719621) and one contig (6459 bp) with 99% similarity to tobacco mosaic virus (Accession: OP525281) isolate DSMZ PV-0109 from Germany. The complete genome sequence of PepCaV was obtained using primers based on the assembled contigs. The 5'- and 3'-terminal regions of the RNA genome were obtained by 5'- and 3'-rapid amplification of cDNA ends. These amplicons were cloned using the pEASY-Blunt Zero Cloning Kit (TRANSGEN, Nangjing, China) and sequenced by Sanger sequencing. Complete genome sequences of tripartite PepCaV from tobacco samples were 7697, 1808, and 1557 nucleotides long (Accession: OR451987 to OR451989) and showed genome organization typical of the genus Ophiovirus in the family Aspiviridae. The complete sequences of RNA1, RNA2 and RNA3 genome segments shared 92.36%, 90.43%, and 95.24%, nucleotide sequence identities, respectively, with the isolate PepCaV-Higashitsuno_2021 pepper isolate (Accession: LC719619 to LC719621) (Shimomoto et al. 2023), but PepCaV has not been reported to infect N. tabacum. In June 2023, 10 plants collected from each place of Macheng (N 27.9094, E 105.6740), Xiangyang (N 28.0936, E 105.6249) and Moni (N 27.8899, E 105.5936) showing interveinal necrosis symptoms were tested using RT-PCR using PepCaV-MP610-F (5'-TGTTCTCTGCTATGCGGTTG -3') and PepCaV-MP610-R (5'-AGCAATCTCGCACCTGAAGT-3') to product 610bp amplicon. Twenty-five tobacco plants were positive for PepCaV. Single sequence from each location was submitted to GenBank (Accession: PP728631 to PP728633). Sap extracts from the original field leaf samples collected from Sichuan Province were used to mechanically inoculate tobacco plants (10 plants) at the four-leaf stage. After 7 days, leaf samples were tested using RT-PCR assay specific to PepCaV and TMV while samples were positive only for TMV but failed to transmit PepCaV by mechanical inoculation. According to previous literature, ophioviruses may be transmitted though soilborne fungus (Jeong et al. 2014). Further research is needed to understand the transmission, epidemiology, and pathological properties of the PepCaV. To our knowledge, this is the first report documenting natural PepCaV infection of tobacco plants in China, providing a scientific basis for PepCaV infection control in tobacco plantations.

First Report of Leek Yellow Stripe Virus Infecting Allium cepa in China.

Onion (Allium cepa), a member of the genus Allium, is widely cultivated throughout the world including China (Zhang et al. 2022). In July 2022, stunted onion (A. cepa 'Weiwang') plants showing typical symptoms of yellow stripe and leaves distortion (Fig. S1) were observed in a vegetable garden in Hohhot, Inner Mongolia, China. The garden is approximately 0.24 ha with around 20,000 onion plants, out of which 140 plants were symptomatic. Diagnosis of the symptomatic plants using negative stain electron microscopy revealed the association of long flexuous virus particles measuring about 11 to 12 nm × 820 to 1000 nm (Fig. S2), which was suggestive of the presence of potyvirus (Chen et al. 2002). Subsequently, the pathogen was identified as the leek yellow stripe virus through RT-PCR combined with Sanger sequencing as described below. The total RNA of each sample was extracted using the MiniBEST plant RNA extraction kit (TaKaRa, Dalian, China), serving as template for synthesis of cDNA using the ABScriptIII RT master mix (ABclonal Biotechnology, Wuhan, China). We then amplified a fragment at the 3' terminus of LYSV using a M5 Hiper superluminal mix (Mei5 Biotechnology, Beijing, China) with the primer pair LYSV-F / LYSV-R (Santosa and Ertunc 2020) which flank the partial NIb gene, the complete coat protein gene and partial 3' untranslated region of LYSV. A unique PCR product of about 1 kb was seen for 10 out of the 140 samples. Five out of the 10 PCR products were randomly selected and cloned using a Zero Background pTOPO-TA cloning kit (Aidlab Technologies, Beijing, China) and E. coli JM109 competent cells were then transformed. Positive colonies were screened by PCR detection of the insert fragments using the primers LYSV-F/-R, and the inserts were sequenced at BGI Genomics (Beijing) using the M13(-21) Forward and M13 Reverse primers. All the obtained sequences were 1032 nt in length, and shared nucleotide sequence identities of 99.2% to 100% (two out of the five sequences were identical to each other). The query sequences were submitted to BLASTn to retrieve homologous sequences from NCBI GenBank databases, and the results showed that the four sequences were homologous to LYSV, suggesting the occurrence of LYSV on onions in Inner Mongolia, China. The sequences were then deposited in GenBank under accession numbers of OQ969953-56, named LYSV isolate Hohhot-1, -2, -3, and -4. In comparison with other published LYSV isolates, the LYSV Hohhot-1, -2, -3, and -4 had the highest nucleotide sequence identity of 87.23%, 86.97%, 87.33%, and 87.23% with LYSV G66 (GenBank accession no. MN059493), respectively, which infects garlic in China. Phylogeny analysis was performed based on 41 complete sequences of the CP gene of LYSV, including the four in this work and another 37 from GenBank of which six isolates were discovered in onions in Turkey (MN070124, MN070126, MN070130, MN070131, MN864794 and MN864795) and the others 31 isolates were from garlics or leeks in 15 different countries (Argentina, Australia, Brazil, China, Ethiopia, Germany, India, Iran, Japan, Mexico, Netherlands, New Zealand, Serbia, South Korea, and Spain), while the CP gene of onion yellow dwarf virus (AJ510223) was employed as an outgroup reference. The tree was reconstructed using the neighbor-joining method of MEGA11 with a bootstrap value of 1,000 replicates. On the tree (Fig. S3), the LYSV Hohhot-1, -2, -3, and -4 were closely related to each other and were distinct from other LYSV isolates including the six isolates in onions in Turkey, suggesting a specific genetic variation of the LYSV isolates in Hohhot. According to Santosa et al. (2023), LYSV Hohhot-1, -2, -3, and -4 were within the S-type lineage. This was the first record of LYSV infecting onions in China, expanding the natural host range of LYSV in China, which offered important information for the management of onion diseases.

Occurrence of grapevine yellow speckle viroid 2 and Australian grapevine viroid in Idaho grapevines.

Grapevine yellow speckle viroid 2 (GYSVd-2; Pospiviroidae, Apscaviroid) causes yellow speckle disease in grapevine (Koltunow et al. 1989) and was found in Australia, Iran, Italy, China, and Nigeria (Koltunow et al. 1989; Habili 2017; Zongoma et al. 2018). In the U.S., GYSVd-2 was found in the State of Washington (Vitis vinifera L. cv. Merlot; Alabi et al., 2012). Australian grapevine viroid (AGVd; Pospiviroidae, Apscaviroid) was reported in Australia, Italy, China, Tunisia, Iran, and in the U.S. wine grapes (V. vinifera) (Habili 2017). In the U.S., AGVd was reported from California (Al Rwahnih et al. 2009), from Washington State (V. vinifera cv. Syrah; GU327604), and from the State of New York (an unknown cv. of V. vinifera; KY081960). In Idaho, two other viroids, hop stunt viroid (HSVd; Pospiviroidae, Hostuviroid) and grapevine yellow speckle viroid 1 (GYSVd-1; Pospiviroidae, Apscaviroid), common in grapevines were previously found in wine grapes (Thompson et al. 2019) but neither GYSVd-2 nor AGVd were identified in the same high-throughput sequencing (HTS) outputs. In September 2020, 16 leaf and petiole samples were collected from six vineyards in Canyon and Nez Perce counties of Idaho, representing six different wine grape cultivars and an unknown table grape cultivar, and subjected to HTS analysis. One of the samples was from a table grape plant at the edge of a declining 'Chardonnay' wine grape block that was grown next to a wine tasting room deck for aesthetic, ornamental purposes; the table grape and 'Chardonnay' plants were own-rooted and planted in 1981. Ribodepleted total RNAs prepared from these samples, as described previously, were subjected to a HTS analysis on a NovaSeq platform (Dahan et al. 2023), producing 15,095,042 to 31,500,611 250-bp paired-end reads per sample. Raw reads were adapter and quality cleaned and mapped against the V. vinifera, reference genome. Unmapped paired-end reads were assembled, and contigs were analyzed using BLASTn and DIAMOND (Buchfink et al. 2021) programs. Fifteen samples were found infected with HSVd and with GYSVd-1, while one was infected with GYSVd-2 and AGVd; in particular, the table grape plant (arbitrarily designated RBTG) was found infected with all four viroid species. The HTS-derived, 490-nt GYSVd-2-specific contig from the table grape sample represented ∼1.35 genome of the Idaho isolate of GYSVd-2 (GYSVd-2-RBTG) and was 100% identical to the GYSVd-2 sequence JQ686716 from Iran. The HTS-derived, 488-nt AGVd-specific contig represented ∼1.32 genome of the Idaho isolate of AGVd (AGVd-RBTG) and was 100% identical to the AGVd sequence KF876037 from Iran. To validate the HTS data and confirm the presence of the four viroids in the original 16 samples, all of them were subjected to RT-PCR using the viroid-specific primers described by Gambino et al. (2014); all 16 samples were found positive for HSVd and GYSVd-1, and one found positive for AGVd. The RBTG sample was confirmed to be infected with HSVd, GYSVd-1, and AGVd by RT-PCR. GYSVd-2 sequence was not amplified, although primers designed by Gambino et al. (2014) matched the HTS-derived GYSVd-2-RBTG sequence; this may be related to a lower concentration of this viroid in the sample and to properties of the primers. The sampled table grape plant was asymptomatic; all four viroids were apparently not associated with any visible abnormalities in this table grape plant, consistent with the findings that viroids found in grapevines typically do not seem to be associated with visible diseases (Habili 2017).

First Report of Beet Western Yellows Virus Infecting Vasconcellea x heilbornii (Caricaceae) in Ecuador.

Vasconcellea x heilbornii, known as babaco, is a hybrid native to Ecuador grown in small orchards in sub-tropical highland regions. Over the last decade, several viruses have been identified in babaco using high-throughput sequencing (HTS) (Cornejo-Franco et al. 2020, (Reyes-Proaño et al. 2023). In 2021, total RNA from a babaco plant showing distinctive leaf yellowing was extracted using the PureLink RNA Mini Kit (Thermo Fischer Scientific, USA) and subjected to HTS on an Illumina NovaSeq6000 system as 150 paired-end reads (Macrogen Inc., South Korea). Library construction was done using the TruSeq Stranded Total RNA Sample kit with Plant Ribo-Zero, as described (Villamor et al. 2022). Reads were processed using BBDuk and de novo assembled using SPAdes 3.15. both implemented in Geneious 2022. Contig analysis was done by BLASTx using the NCBI viral sequence database (as of November 2022). HTS generated 54 million reads, of which 12% assembled into contigs corresponding to genomes of previously reported babaco viruses including babaco virus Q (BabVQ), babaco nucleorhabdovirus 1 (BabRV1) and babaco ilarvirus 1 (BabIV1). Interestingly, 144 reads (0.0003%) assembled into seven contigs ranging from 100 to 480 nucleotides (nt) in length. These contigs showed homology, with 97% amino acid (aa) identity (100% query coverage), to regions of the RNA-dependent-RNA-polymerase (RdRp) of beet western yellows virus (BWYV, Acc. No. NC_004756), a member of the Polerovirus genus. To confirm the occurrence of BWYV in babaco, double-stranded RNA (dsRNA) was extracted from 15 g of leaf tissue from the original sample as described (Dodds et al. 1984) and used as template for reverse-transcription (RT)-PCR using overlapping primers designed to span all short contigs. RT-PCR amplified fragments were cloned into a pGEM®T-easy vector (Promega, USA) and sequenced by the Sanger method (Macrogen Inc., South Korea). The sequences were assembled into a single 2.7 kbp BWYV genome fragment comprising the complete protein 1 (P1) and partial RdRp gene (GenBank Acc. No. PP480670). Sequence alignments between the partially sequenced genome of the babaco isolate and its corresponding fragment from the closest BWYV isolate (NC_004756) revealed 94% and 97% identities at the nt and aa levels, respectively. To assess the prevalence of BWYV in babaco, 30 leaf samples showing yellowing symptoms from Pichincha (n=15) and Azuay (n=15) provinces were tested by RT-PCR using total RNA. Total RNA extraction and reverse transcription were done using the methodology described by Halgren et al. (2007). For RT-PCR, the primer set BWYV_Bab_F: 5'-CAGTGTCCTCCAAGTGCAACAT-3' / BWYV_Bab_R: 5'GGTTCCTTCCCAGTTTGGTGGT-3', which amplifies a 235 nt-long P1 region, was used. Three RT-PCR products from each positive sample were purified using the GeneJET PCR clean-up kit (Thermo Scientific, USA) and sequenced. BWYV was confirmed in 9 out of 15 samples (60%) from Pichincha, and in 10 out of 15 samples (64%) from Azuay. Samples were also tested for additional babaco viruses as described (Reyes-Proaño et al. 2023). All BWYV-infected plants turned out positive for papaya ringspot virus (PRSV), babaco mosaic virus (BabMV), BabVQ, and BabIV1. Hence, the impact of BWYV infection on babaco plants in single and mixed infections warrants further investigation. To the best of our knowledge, this is the first report of BWYV in a crop in Ecuador, and the first time it has been found in a Caricaceae species.

Viromics reveals two novel viruses of the family Closteroviridae in Codiaeum variegatum plant with leaf variegation symptoms.

Codiaeum variegatum is a valuable ornamental plant with distinct bright yellowing and golden spots on dark green leaves, which resemble virus symptoms. To investigate the factors, especially viral agents, associated with the variegated leaf color of Codiaeum variegatum, we performed virome profiling of a single C. variegatum 'Gold Dust' leaf sample collected from Hainan, China using ribosomal RNA-depleted total RNA sequencing on an Illumina NovaSeq 6000 platform. Two novel viruses, with two variants each, belonging to the family Closteroviridae were detected and characterized: Croton golden spot-associated virus C variants 1 and 2 (CGSaVC-v1, and CGSaVC-v2) of the genus Crinivirus and Croton golden spot-associated virus A variants 1 and 2 (CGSaVA-v1 and CGSaVA-v2) of the genus Ampelovirus. Transmission electron microscopy showed long, flexuous, filamentous virus particles approximately 15 nm in diameter and 760-770 nm in length. Molecular screening of ninety-seven variegated individual plant leaves showed a high prevalence of CGSaVA-v1 (90.7%), CGSaVA-v2 (75.3 %), CGSaVC-v1 (70.1%), and CGSaVC-v2 (47.4%), while asymptomatic leaves near the meristem tip were mostly free of the target viruses. To our knowledge, this is the first study to demonstrate the significant association between closterovirids and the golden spots. The findings provide novel insights into the genetic diversity of the family Closteroviridae and inform future germplasm conservation and new cultivar development of Codiaeum Variegatum.

First Report on the Occurrence of Tomato Yellow Leaf Curl Virus in Tennessee.

In the summer of 2021, a field survey of several tomato-growing counties in Tennessee (TN) was conducted for plants exhibiting virus-like symptoms. While scouting in September in Grainger County, one of the largest areas under tomato (Solanum lycopersicum) production in TN, leaves from six tomato plants (cv. BHN 589) growing on a farm located near Rutledge were collected and subsequently stored at -80˚C. Only one of the plants exhibited symptoms typical of tomato yellow leaf curl virus (TYLCV) infection, which included chlorosis, leaf curling, downward cupping, thickening, and mottling. Total DNA was isolated using the DNeasy Plant Mini Kit (Qiagen, Santa Clara, CA) and subjected to PCR using primers TYv2337F (5'-ACGTAGGTCTTGACATCTGTTGAGCTC-3') and TYc138-R: (5'-AAGTGGGTCCCACAATTGCAAGAC-3') and Ex-Taq polymerase (Takara Bio, Mountain View, CA) to amplify a 634-bp genomic fragment of TYLCV (Alkowni et al. 2019). Primers against tomato elongation factor-1 served as internal PCR control (Dias et al. 2023). Each primer set amplified amplicons of expected sizes; however, the TYLCV fragment was detected only from the plant exhibiting typical symptoms of infection. Amplicons were purified with the QIAquick PCR purification kit (Qiagen) and sequenced directly bi-directionally by Eurofins USA using the above primers. The resultant sequences were edited and analyzed with CLC Genomic Workbench v. 24.0.1. Blast analysis of the sequences (606 nts) against those available in GenBank showed 93 TYLCV isolates with over 95% nucleotide sequence identity. Subsequently, the full-length genome was PCR amplified using primers TYBamHIv (5'- GGATCCACTTCTAAATGAATTTCCTG-3') and TYBamHI2c (5'-GGATCCCACATAGTGCAAGACAAAC-3') (Rojas et al. 2007), ligated into pGEM-T (Promega, Madison, WI) and cloned. Plasmids were purified using QIAprep Spin Miniprep kit (Qiagen) and five independent plasmids clones were sequenced using Oxford Nanopore sequencing (v14 library chemistry & R10.4.1 flow cell) by Eurofins USA. The resultant sequences were edited and analyzed with CLC Genomic Workbench and a consensus sequence representing the full-length genome (2,781 nts) was generated and submitted to GenBank (Accession No. PP505780). Blast analysis showed over 98% nucleotide sequence identity with 100 TYLCV isolates from GenBank. The highest sequence identity of 98.6% was with the sequence of an isolate from Florida (AY530931). To the best of our knowledge, this is the first report of the occurrence of TYLCV in TN. The virus was detected in a tomato plant grown from seed. The seed transmissibility of TYLCV remains controversial (Perry 2018; and references therein); thus, the most likely source of infection in this report is transmission by rare viruliferous vectors (Bemisia tabaci). It remains unknown, however, whether TYLCV is endemic in TN, or recently introduced by mobile vectors from neighboring states. The presence of TYLCV has been reported in Alabama (Akad et al. 2007), Kentucky (de Sá et al. 2008), Mississippi (Ingram and Henn 2001), Georgia (Momol et al. 1999) and North Carolina (Polston et al. 2002). The B. tabaci vector of the virus has sporadic occurrences in crops within TN (Li et al. 2021). Tennessee is one of the leading tomato producers exporting globally with production covering over 1,300 hectares and over 430 producers (Dias et al. 2023). Because of the potential threat of TYLCV to tomato industry in the state, additional surveillance measures need to be put in place to determine TYLCV incidence.

First report of cucurbit yellow stunting disorder virus infecting cucurbit crops in Jamaica.

The increasing prevalence of whitefly-transmitted viruses affecting cucurbit crops has emerged as a significant concern for global cucurbit production. Two of the most widely prevalent threats in the Americas are cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV) (Crinivirus, Closteroviridae). These viruses induce similar foliar symptoms on cucurbit crops (Mondal et al., 2023) leading to loss of photosynthetic capability and decreased yields. Cantaloupe (Cucumis melo), watermelon (Citrullus lanatus), and cucumber (Cucumis sativus) are major cucurbit crops in St. Elizabeth, Jamaica, which is the principal fruit and vegetable producing region of the country. In August 2018, foliar symptoms were observed on cantaloupe, watermelon, and cucumber plants in several commercial farms in St. Elizabeth. These symptoms, mainly on the older leaves, consisted of severe yellowing or interveinal mottle and they appeared more pronounced on cantaloupe and cucumber plants compared to watermelon. Growers noticed the production of smaller than normal fruit. Disease incidence ranged from 10 to 100% and whiteflies (Bemisia tabaci Gennadius) were observed in the fields. To identify virus(es) associated with the disease, six plants (cantaloupe [n = 3], cucumber [n = 1] and watermelon [n = 2) exhibiting symptoms were sampled from four fields for preliminary screening. Total RNA was extracted from leaf tissues as described in Tamang et al. (2021) and samples tested by a multiplex reverse transcription RT-PCR method that targeted the RNA-dependent RNA polymerase (RdRp) of the whitefly transmitted viruses, CYSDV, CCYV, squash vein yellowing virus (SqVYV), and the aphid- transmitted cucurbit aphid-borne yellows virus (CABYV) (Mondal et al. 2023). RT-PCR amplified the expected 494-bp fragment of the CYSDV RdRp gene (Mondal et al., 2023) from two symptomatic plants; one cantaloupe, one cucumber, as well as from CYSDV-infected control plants but not from healthy controls. Further testing was conducted during the June-August 2020 growing season after similar symptoms were observed on additional farms in St. Elizabeth and two regions, Manchester and Clarendon, located to the east of St. Elizabeth. Twenty-one cucurbit leaf samples (11 cantaloupe, seven watermelon and two cucumber from St. Elizabeth and one cantaloupe from Clarendon) exhibiting foliar yellowing progressing from the crown outward, and mottling were collected. Whiteflies (5) from these fields in St. Elizabeth and 20 asymptomatic weed samples were also collected and sent to the USDA-ARS laboratory at Salinas, CA. Total RNA from leaf samples was extracted as described above and tested for CYSDV, CCYV, and CABYV. Total leaf DNA was also extracted (Mondal et al. 2016) and assayed with PCR (Gilbertson 2001) to detect the presence of the whitefly-transmitted cucurbit leaf crumple virus (CuLCrV), a begomovirus, commonly found in the southeastern United States (Gadhave et al., 2018; Keinath et al., 2018). Nineteen of the 21 cucurbit samples tested positive for the presence of CYSDV by RT-PCR (Mondal et al. 2023). Of the 19 CYSDV-positive samples, 13 cantaloupe, one cucumber, and five watermelon samples were singly infected with CYSDV, and one cantaloupe sample was infected with both CYSDV and CABYV. Amplicons of the Jamaica isolate from cantaloupe were sequenced (OR399555) and a 494 nt section of the RdRp gene was found to share 100% sequence identity to the Arizona 1 isolate (EF547827.1). The presence of CYSDV, was further confirmed using a second set of primers that amplified a 394-nt portion of the CYSDV coat protein gene (Polston et al., 2008). Among the weed samples, CABYV was detected in one sample from a Leonotis nepetifolia plant (Lamiaceae) and two Cleome sp. (Capparaceae) collected from St. Elizabeth. None of the crop and weed samples tested positive for CCYV or CuLCrV. DNA from whiteflies was extracted and assayed with PCR using species specific primers (Chen et al. 2016). All whiteflies were identified as B. tabaci cryptic species MEAM1, which is widely known an efficient vector of CYSDV (Berdiales, et al. 1999). This is the first report of CYSDV in Jamaica and its first known occurrence in these hosts within the country. Further monitoring of cucurbit crops and the whitefly vector is warranted to better understand the epidemiology.

First report of a new Carlavirus provisionally named rose virus B and apple mosaic virus in mixed infections of Rosa sp. in Mexico.

Rose (Rosa sp.) is an important ornamental plant in the cut flower industry around the world. This species is prone to hosting several viruses since it is propagated vegetatively, mainly by grafting (Mollov et al., 2013). In 2021, rose plants of unidentified variety with mosaic, vein yellowing, chlorotic line patterns, and interveinal chlorosis were observed in a rose plantation established in open field in Temixco, Morelos (Supplementary Figure 1). To determine the cause of symptoms was due to viral infection, nucleic acids were extracted from leaves by in-house CTAB procedure and DNase treated. A pooled RNA sample extracted from 4 symptomatic plants was sent to BGI Genomics (China) for high-throughput sequencing (HTS). A stranded mRNA library was prepared and sequenced on the DNBSEQ platform (BGI). A total number of 13,646,715 paired 150-bp clean reads were generated. The reads were assembled de novo into 79,309 contigs ranging from 78 to 15,817 nucleotides (nt) using SPAdes (Prjibelskiet et al., 2020). The contigs were subjected to BLASTx and BLASTn for annotation. A contig with a length of 8,842 nt (208x average coverage per nt) showed 90.6% identity to rose virus B (RVB) (MT473961), and was deposited in GenBank under accession number ON165234. Additionally, three contigs (ON165235-ON165237) corresponding to RNA1 (3,443 nt; 154x coverage), RNA2 (2,938 nt; 231x coverage), and RNA3 (1,897 nt; 232x coverage) of apple mosaic virus (ApMV) were identified. These contigs showed up to 98.4%, 89.7%, and 98.6% identity, respectively, to each corresponding RNA sequences of ApMV. No other viral sequence was identified from the constructed contigs. Subsequently, the presence of RVB was confirmed by RT-PCR performed with an aliquot of the pooled RNAspan style="font-family:'Times New Roman'; font-size:11pt"> with specific primers targeting the replicase and CP (Diaz-Lara et al., 2021). For ApMV, a new set of primers were designed: ApMV_RNA1F (5'-AAATCTCCCGAAAGGGCCTG-3')/ApMV_RNA1R (5'-TCACTCGTCGCATGGATGGATAGC-3'), ApMV_RNA2F (5'-TTGGTACGAGTCGTGGTTGGTTGG-3')/ApMV_RNA2R (5'-GGAAAACTGACCGCAAACCC-3'), and ApMV_RNA3F (5'-GGAGGTTAGAGGCCCGAATG-3')/ApMV_RNA3R (5'-CGCACAGGTGGTAACTCACT-3') which amplify segments of 444 bp, 546 bp, and 434 bp, respectively. The amplicons obtained for both viruses were subjected to Sanger sequencing, confirming the identity of RVB and ApMV. The sequences from the RVB replicase (ON165241) and CP (ON165240) showed 93.9% and 97.0% nt identity with an RVB isolate reported in the USA (MT473961). On the other hand, sequences from RNA1 (ON165238), RNA2, (OP413436), and RNA3 (ON165239) of ApMV had 99.2%, 89.2%, and 99% nt identity, respectively. Finally, the four symptomatic plants were individually tested by RT-PCR to identify RVB and ApMV. Interestingly, both viruses were detected in all the plants analyzed. ApMV (genus Ilarvirus) is associated with mosaic and mottling symptoms in rose (Thomas, 1984). It has been accepted that ApMV is present in rose plants in Mexico (Cardenas-Alonso, 1994), with no evidence to confirm it. RVB was identified in rose in USA, and this virus was classified as a new species of the genus Carlavirus (Diaz-Lara et al., 2021). In addition to RVB, rose virus A and rose virus C have also been reported in rose; however, the symptomatology linked to these viruses is unknown (Xing et al. 2021; Diaz-Lara et al., 2020). Recently, RVB and ApMV were reported in rose plants in Taiwan (Chen et al., 2022). To our knowledge, this is the first report of RVB and ApMV in a mixed infection in rose in Mexico.

Detection of Beet curly top virus in Solanum jamesii, Artemisia tridentata, Helianthus annuus, and Cannabis sativa in Utah.

Historically, beet curly top virus (BCTV; Geminiviridae, Curtovirus) is known for destroying the sugar beet industry in Utah and has been a persistent problem in the state since then (Ball, 1917). Starting in June of 2022, we began identifying plants in San Juan County, Utah with chlorosis and leaf curling. Of note, Solanum jamesii, the Four Corners potato, Artemisia tridentata, big sagebrush, and Helianthus annuus, common sunflower, were found with general chlorosis, severe leaf curling and in the case of the sage brush, completely lacking in smell whereas nearby sage plants without the yellowing were intensely fragrant. In August 2023, Cannabis sativa plants for hemp production were found with severe leaf curling in Juab County, Utah. Samples were collected and stored at -80°C for future work. DNA was extracted using the IBI Genomic Plant DNA kit (IBI Scientific, Dubuque, IA) and subjected to rolling circle amplification using Phi29 polymerase (NEB, Ipswich, MA). The primer set BCTV2 (Strausbaugh et al. 2008) for BCTV detection was then used on a subset of the RCA-positive samples for either one (A. tridentata, H. annus, and S. jamesii) or two (C. sativa) plants displaying classic BCTV symptoms, to amplify a 518 bp region. This amplicon was then sequenced by the Sanger method to a 4x coverage. The resulting sequences (accession nos. OR698900 to OR698904) share 98.94 to 99.80% nucleotide identity to the Worland strain (accession no. KU892789.1) for all samples. To confirm the detection, a triple antibody sandwich ELISA kit from Nano Diagnostics (San Jose, CA) was used on these, and other plants of similar species and symptoms from across the state. Samples that tested positive include 3/3 symptomatic H. annuus plants, 1/1 symptomatic S. jamesii, 3/3 symptomatic A. tridentata. The A. tridentata samples were collected from Juab, San Juan, and Utah Counties. None of three asymptomatic A. tridentata plants tested were ELISA positive. Of the C. sativa plants tested by ELISA, 9/9 of the plants displaying classic BCTV symptoms in that host were positive and 6/6 of the plants without classic BCTV symptoms were ELISA positive. The findings of these novel hosts indicate the need for increased testing and analysis of economically relevant crops and native flora across the state. These findings represent a concern for conservation in the case of S. jamesii and a potential threat to the growing hemp industry in the state due to the severity of BCTV symptoms on these plants. Additionally, the finding of A. tridentata as a host may represent a significant finding for the epidemiology of BCTV in the Mountain West region as A. tridentata is distributed from Mexico to Canada along the Rocky Mountain range and is found in much of the Western US in arid regions. This is the first report, to our knowledge, of S. jamesii and A. tridentata as hosts for BCTV and the first peer reviewed reports for H. annuus and C. sativa as hosts for BCTV in Utah.

First report of sweepoviruses infecting Ipomeas batatas L. cultivars and landraces in Trinidad.

Root crops, referred to as ground provisions in the Caribbean, are traditional staples in Trinidad. One widely consumed example is sweet potato (Ipomeas batatas L.). The crop is mainly produced by subsistence farming which together with imports from neighboring Caribbean countries meet domestic demand (Singh et al. 2008). The Central Experiment Station, situated in the eastern part of Trinidad, maintains a sweet potato germplasm collection comprising both imported and locally-sourced landraces for cultivar development and distribution of propagules. In May 2017 chlorosis and leaf curling symptoms, typically associated with sweepoviruses, were observed on imported cultivars, Centennial, Jewel, 86 BM 31, TIB 313, TIB 8 21 1, and S128, and the landraces, Kick Up Jenny, John, and Carrot. Leaf samples from these nine symptomatic plants were collected for analysis, along with samples from the asymptomatic landrace, Chickenfoot. Total nucleic acids were extracted (Sharma et al. 2008) and the samples were assayed by PCR using degenerate primers SPG1 and SPG2 (Li et al. 2004) that target the replication associated protein gene (ORF C1), a highly conserved region of sweepoviruses. Amplicons of 912-bp were obtained from two of the nine symptomatic plants (TIB 8 21 1, Kick Up Jenny), but not from the asymptomatic Chickenfoot. The same samples were assayed by PCR amplification using primers SpvF and SpvR (Avelar 2015) which are specific to a highly conserved 632-bp region of the coat protein gene (ORF V1) of sweet potato leaf curl virus (SPLCV). All 10 samples tested positive for SPLCV, including the asymptomatic landrace, Chickenfoot. The ORF V1 PCR products from three of the 10 samples, namely Chickenfoot, TIB 8 21 1, and Kick Up Jenny, were cloned and sequenced (two clones per sample). Comparison of the sequences (GenBank accession nos. OR882007 [Chickenfoot], OR913125 [TIB 8 21 1] and OR913126 [Kick Up Jenny]) identified up to 4% nt sequence variability between samples. In BLASTn analysis, they were most closely related to the SPLCV isolate China:Sichuan (GenBank accession no. KJ013557), sharing 94 to 98% nt identity. Total nucleic extracts from one representative sample (TIB 8 21 1) was used as template for rolling circle amplification (RCA, TempliPhi Amplification Kit, GE Healthcare Life Sciences, Piscataway, NJ, USA). Digestion of the RCA product with StuI (Thermo Scientific, MA, USA) yielded ~2.8 kb DNA fragments indicative of monomeric full length genomes. Digested fragments were cloned, completely sequenced and deposited in GenBank under the accession nos. OR866202 (2,821 nts) and OR866203 (2,828 nts). Two species of sweepoviruses were detected. In BLASTn analysis, OR866202 showed 95% nt identity with sweet potato golden vein associated virus (SPGVaV) US:MS:1B-3 (GenBank accession no. HQ333143.1) which is a recombinant virus comprised of SPLCV and sweet potato leaf curl Georgia virus (SPLCGV) (Zhang and Ling 2011) and in BLASTx analysis OR866202 was most similar (92-99%) to SPLCV isolates from Brazil (GenBank accession nos. ACI23475.1, AGW16179.1, ACY79479.1), Peru (GenBank accession no. ACY79466.1) and China (GenBank accession nos. ACY79439.1). OR866203 shared 96% nt identity with SPLCV China:Henan25(8):2012 (GenBank accession no. KF040465.1) in BLASTn analysis and BLASTx analysis revealed ≥ 94% aa sequence identity with SPLCV from Brazil (GenBank accession nos. ACI23475.1, AGW16179.1, ADZ96559.1), Peru (GenBank accession no. ACY79479.1), China (GenBank accession no. ACY79466.1). and Spain (GenBank accession no. QWQ56365.1). Both Trinidad isolates also showed 90-96% nt identity with SPLCV from Korea (GenBank accession no.s KT992061.1, KT992064.1, unpublished). This is the first detection of sweepoviruses in Trinidad. SPGVaV has been reported in Brazil, the United States and Korea (Kil et al. 2014), while SPLCV has been described in other Caribbean islands, including Cuba, Jamaica, Puerto Rico, St. Vincent (Cuellar et al. 2015), and Barbados (Alleyne et al. 2019), as well as several countries in South America. Although Koch's postulates were not completed, our findings suggest that sweet potato crops in Trinidad harbor sweepoviruses, notwithstanding efforts to distribute pathogen-free materials and, in some instances, the apparent absence of visible symptoms on infected plants. Further studies on the management and impact of these viruses are necessary, including their prevalence in the sweet potato production regions of Trinidad.

First Report of metaplexis yellow mottle-associated virus Infecting Metaplexis japonica (Thunb.) Makino in Shandong, China.

Metaplexis japonica (Thunb.) Makino, commonly known as rough potato, has a wide distribution in China, Japan, Korea, and adjacent Russia. In China, M. japonica is a traditional herbal medicinal plant, which is also cultivated as a vegetable (Shi et al. 2020; Wei et al. 2019). In July 2023, leaves of M. japonica plants growing near a soybean field in Qingdao, Shandong province, exhibited leaf crinkling, mosaic and distorting symptoms of probable virus infection (Supplementary Figure 1). The disease incidence in a 50 m2 area was approximately 40%. To identify the suspected viral etiological agents, symptomatic leaves from 10 M. japonica plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq). TransZol Up Total RNA Extraction Kit (TransGen Biotech, Beijing, China) was used to extract total RNA. Small RNA library construction and high-throughput sequencing (HTS) were performed on Illumina NovaSeq platform by Genepioneer (Nanjing, China) (Li et al. 2024). A total of 17,384,311 raw reads were obtained. Redundant reads were removed by cutadapt software (version 1.18) to obtain 11,580,876 clean reads with 18 to 26 nucleotide (nt) sizes. The clean reads were assembled using velvet software (version 1.1.07). A total of forty-six small contigs from 42 to 283 nt were identified, with 85 to 100% nucleotide sequence identities, respectively, to metaplexis yellow mottle-associated virus (MeYMaV, genus Caulimovirus, family Caulimoviridae, accession numbers: NC_077108.1). Finally, 1,355,955 reads (11.71% mapped ratio of total reads, cover 56.7% over the MeYMaV genome) were mapped to the genome of MeYMaV by bwa software (version 0.7.17-r1188). To confirm the sRNA-Seq results, PCR was performed with specific primers MeYMaV-N-F/MeYMaV-N-R (5'-TGGTATCAGAGCCTAGTTAA-3'/5'-GGAGTTGGTAATGTATTACC-3') and MeYMaV-C-F/MeYMaV-C-R (5'-AATGGAACGGCTGTTAGTAT3'/TTAATTTCTAGCCCTTGGCTACTTAC). Both the primer pairs were designed using GenBank accession numbers: NC_077108.1 (Yang et al. 2021) to obtain the N and C terminals genome fragments of 10 MeYMaV plants. Two amplicons approximately in 4000-, and 3900-bp sizes were amplified (Supplementary Figure 2), sequenced (tsingke, Beijing, China) and aligned to obtain 7,742-nt complete MeYMaV genome sequence (Accession no. PP892524). BLASTn analysis revealed 90.16% and 92.18% sequence identity, respectively, with the MeYMaV isolate LM-Cau-A (NC_077108.1) based on complete genome and coat protein sequences, respectively. Previously, cucumber mosaic virus and MeYMaV were reported in M. japonica from Jiangsu and Liaoning provinces in China, respectively (Yang et al. 2018; 2021). To our knowledge, this is the first natural infection report of MeYMaV in M. japonica in Shandong, China. The natural occurrence of MeYMaV is not only affects the quality of M. japonica, but also poses a potential threat to surrounding crops. This study enriches information on the disease distribution of MeYMaV and will be helpful for disease management.

First report of nectarine virus M in grapefruit (Citrus × paradisi Macfad.) in association with citrus chlorotic blotch disease in Texas, USA.

During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas, USA and sent to USDA-Animal and Plant Health Inspection Service - Plant Protection Quarantine, Plant Pathogen Confirmatory Laboratory at Laurel, Maryland for pathogen identification and confirmatory testing. Ribo-depleted libraries for all four samples were prepared for high-throughput sequencing (HTS) analysis, using the RNA extracts of individual grapefruit samples. HTS yielded 13.6 to 22.8 million 75 bp paired-end raw reads per sample library but failed to identify any potential virus-like agent at the time. Recent advances in bioinformatic tools (Roy et al., 2024) prompted a revisit of the archived HTS data and several virus contigs were identified. The assembled contigs covered approximately 82% of the nectarine marafivirus M (NeVM) genome (GenBank accession KT273413) with read depths of 4.72 to 9.96 per-nt. In addition, a few Caulimoviridae and Retroviridae contigs were also identified in the libraries. NeVM was previously discovered from budwoods of nectarine trees from California using HTS and shown to infect peach (Villamor et al., 2016), but no other biological or serological data were reported. Foliar chlorotic blotch symptoms, reminiscent of the 2019 findings, were observed in adjacent Rio Red grapefruit blocks during September 2023. To know the association of chlorotic blotch symptoms with NeVM, 12 symptomatic and 4 non-symptomatic grapefruit samples were collected for testing (Supplementary Figure 1). A conventional RT-PCR primer pair, Marafi Gen-1F (5´AACATGAAGAACGGSTTCGACG 3´)/NeVM-1R (5´TTCATGGTGTGCATGGCRTTYTG 3´), was designed using HTS-derived NeVM contigs and utilized for the development of a detection assay. The results of the 671 bp amplicon sequencing showed that 13 (12+1) of the 16 grapefruit plants (81.25%) were positive for NeVM and shared 87.63-92.25% nt identities with the nectarine isolates of NeVM (KT273411-13) and 78% with the Canadian prunus isolate 13TF170 (MZ291915). To confirm the first report of NeVM in grapefruit trees, the archived 2019 (TX4) and 2023 leaf tissue samples (LF1 and LF2) from La Feria, TX were selected for genetic analysis. The primer pair Marafi Gen-1F/NeVM-1R targeting the helicase domain of NeVM, successfully amplified the expected 671 bp product. The amplicon sequence of isolate TX4 shared 97.76% and 89.87% nt identities with isolates LF1 and LF2, respectively, while LF1 shared 90.76% nt identity with LF2. Sequence variation was observed for a 1906 bp overlapping amplicon obtained with the primer pairs NeVM-2F (5´CTGTTCGCCGAATGCATCAAYCT 3´)/Marafi Gen-1R (5´AGTAGTACCCGCAGAAGGTGG3´) and Marafi Gen-2F (5´CCACCTTCTGCGGGTACTACT3´)/Marafi Gen-2R (5´CTGGAGGTGTTTTCCTTCACCTG3´), spanning the catalytic domain and tymovirus coat protein region of NeVM. The analysis showed that the 1906 bp amplicon sequence of TX4 shared 94 and 95% nt identities with LF2 and LF1, respectively, but only 91% nt identity between them. Overall, the 1906 bp amplicon of all 3 Texas grapefruit isolates shared 91.08 to 92.29% nt identity with American prunus isolates (KT273411-13) and 75% nt identity with Canadian isolate (MZ291915). Three sequences of 671 bp and 1906 bp amplicons were deposited in GenBank under accession numbers PP767656-61. From the regulatory point of view, NeVM fails to satisfy the criteria to be considered as potential quarantine pests for the European Union because of the absence of information on its biology, distribution, and economic impact (Bragard et al., 2019). However, this report expands the natural host range of NeVM to include grapefruit. From an epidemiological standpoint, more data on host range, varietal susceptibility, and genetic variability among citrus and prunus isolates are needed to conclude the association of NeVM infection with symptoms development.

First report of Tomato Zonate Spot Virus infecting Belamcanda chinensis in China.

Tomato zonate spot virus (TZSV, Orthotospovirus tomatozonae, genus Orthotospovirus, family Tospoviridae) was first reported to infect tomato (Solanum lycopersicum) in China in 2008 (Dong et al. 2008). Belamcanda chinensis (L.) Redouté is a perennial herbaceous medicinal plant of the family Iridaceae, which is widely distributed in China. Its rhizome contains abundant active components, mainly including flavonoids, and has antibacterial, anticancer, and antioxidative effects. In July 2023, four B. chinensis plants with virus-like symptoms were collected in Fuyuan County, Yunnan Province in China. The diseased leaves showed chlorosis and ringspots (Fig. S1). Spherical virus particles with a diameter of 80-100 nm were observed in the saps of diseased leaves under a transmission electron microscope (Fig. S2). The presence of an orthotospovirus was confirmed by the previously reported method to amplify the partial sequence (312 nt) of L segment (Huang et al. 2018) (Fig. S3). BLASTn analysis showed that the obtained 312-nt sequence was 95.62% nucleotide identity with TZSV tomato-YN isolate (accession no. NC_010491.1). To obtain the complete genome of this isolate, total RNA from symptomatic leaves of two single diseased B. chinensis were extracted using Hipure Universal RNA Mini Kit (Magen Biotech) and subjected to high-throughput sequencing with a NovaPE150 (Illumina, USA) at MAGIGENE (Shenzhen, China). A total of 41,144,571 clean reads were obtained after removing low quality reads. Quality-controlled, qualified reads were assembled into contigs using Megahit v1.1.2 software. Thirteen contigs shared nucleotide identity ranging 86.94%-97.73% with the L, S, and M segments of TZSV using BLASTn searches online (https://blast.ncbi.nlm.nih.gov/Blast.cgi). In addition, no contigs were mapped to other viral (taxid:10239) and viroidal (taxid:12884) sequences in GenBank Databases. The full-length L, M, and S RNA segments of TZSV-Bc isolate was determined tbe 8917 nt (PP314222), 4718 nt (PP314223) and 3213 nt (PP314224), respectively. These segments were validated by RT-PCR, and Sanger sequencing. They shared nucleotide sequence identities of 95.9%, 97.2%, and 93.1% of the L (NC_010491.1), M (NC_010490.1), and S (NC_010489.1) segments, of the TZSV tomato-YN isolate, respectively. Compared to the TZSV tomato-YN isolate, there exists a missing segment with 113 nt in the intergenic region of S RNA and a segment with 199 nt in M RNA. To further confirm the TZSV infection on B. chinensis, three primers pairs Tosp10/ Tosp11， Tosp5/Tosp6, and NSs-F/NSs-R were tested by RT-PCR for TZSV based on the previous report (Dong et al, 2008). The sequences of amplicons shared >99% nucleotide identity with the corresponding TZSV-Bc isolate sequences. Total of 14 B. chinensis samples were detected with the primer pair N-F/N-R (5'-ATGTCTAACGTCCGGAGTTTAACA-3'/ 5'-AAAAGACAGATCATTGCTGCTCTT-3') by One Step RT-PCR, 6 samples (42.85%) showed the positive results. The mechanical inoculation and RT-PCR detection confirmed TZSV-Bc isolate can infect N. bethamiana. So far, tomato zonate spot virus has been detected in different plants including tobacco (N. tabacum) (Huang et al. 2017), sticktight (Bidens pilosa) (Xu et al. 2022), pepper (Capsicum annuum) (Li et al. 2023) in China. To our knowledge, it is the first report of TZSV naturally infecting B. chinensis plants, which enriches information on the host range of TZSV and will be helpful for disease management.

First Report of rattail cactus necrosis-associated virus Infecting Prickly pear (Opuntia macrocentra) in the United States.

Black-spined prickly pear (Opuntia macrocentra Engelmann; Cactaceae) is a cactus native to Arizona, New Mexico, Texas, and northwest Mexico. The plant is often grown for ornamental purposes in the United States. In February 2023, virus-like symptoms such as concentric ringspots and chlorotic spots were observed on O. macrocentra plants grown at the vicinity of Maricopa County Cooperative extension, University of Arizona, Phoenix, AZ (33°24'24.6"N, 111°59'15.3"W). Total RNA was extracted from two samples (YPHC-60-A and YPHC-60-B), following the protocol by Tzanetakis et al. (2007). Reverse transcription polymerase chain reaction (RT-PCR) was performed with degenerate tobamovirus, TobamodF/TobamodR (Li et al. 2018) and potexvirus, 1RC, Potex 2RC, and Potex 5 (van der Vlugt and Berendsen 2002) primers. An expected amplicon of ~880 bp was obtained from both samples using TobamodF/TobamodR primers, while no amplification was observed with potexvirus primers. Further, RT-PCR was carried out using species-specific primers to detect cacti related tobamoviruses: cactus mild mottle virus (CMMoV), rattail cactus necrosis-associated virus (RCNaV) (Park et al. 2018) and Opuntia virus 2 (Salgado-Ortiz et al. 2020). Amplicons of ~540 bp were amplified from both samples using RCNaV specific primers, whereas no amplification was obtained using CMMoV and Opuntia virus 2 specific primers. Then, the amplicons from both YPHC-60 (A-B) isolates (~540 bp) were Sanger sequenced and shared 99.22% nucleotide identity to each other. A BLAST search revealed 93% nucleotide identity with RCNaV CP sequences (KY581586.1, JF729471, and MT130378.1). The sequences were submitted in the GenBank (accessions no. OQ914798 and OR828526). Furthermore, complete RCNaV- RNA dependent RNA polymerase (RdRP) gene was amplified using primers 3490-s-5'GTAGGTGGTACCGCATAGCA-3'; 3490as 5'AAACGCAAGTCMRYGACYGA-3' (designed in this study from accession no. JF729471.1, position 3490-3509 and 4905-4925). The expected amplicons of ~1,500 bp were obtained from both YPHC-60 (A-B) samples and sequenced (GenBank: OQ914799 and OR823954) showing 87.5 % identity with RCNaV sequences (JF729471.1 and NC_016442.1). The maximum-likelihood phylogenetic tree clustered YPHC-60 (A-B) isolates in a single clade with other RCNaV isolates. RCNaV virus particles were isolated from YPHC-60 (A-B) and submitted for RNA extraction, testing positive for RCNaV by RT-PCR. Sap extract of YPHC-60 (A-B) prepared in 0.01 M phosphate buffer (pH =7.0) was used to mechanically inoculate 3 indicator plant species (n=10): Phaseolus vulgaris, Medicago sativa, and Cucumis melo. Also, infected tissue was used to graft Opuntia sp. plants. Symptoms such as local lesions were observed on M. sativa and vein thickening on P. vulgaris 14 days post-inoculation, while Opuntia sp. showed chlorosis 30 days after grafting. RCNaV infection in mechanically inoculated P. vulgaris, M. sativa, and Opuntia sp. was also confirmed through RT-PCR. C. melo and non-inoculated control plants did not show any symptoms, nor tested positive through RT-PCR. RCNaV has been reported earlier to infect cactus species in South Korea (Park et al. 2018) and O. albicarpa in Mexico (De La Torre-Almaráz et al. 2016), where it was found in several orchards. To the best of our knowledge, this is the first report of RCNaV infecting O. macrocentra in the United States. This study highlights that RCNaV is easily transmitted mechanically or by grafting, which could impact the nursery industry as most cacti are clonally propagated.

Effect of barley yellow dwarf virus (BYDV) on barley: A precise assessment of reductions in yield components under variable disease severities.

Understanding the effects of barley yellow dwarf virus (BYDV) on crop agronomic traits and yield performance helps breeders balance their selection criteria and farmers decide if pesticides should be applied to control aphids that distribute the virus. To precisely assess the deterioration of different agronomic traits and yield components caused by different levels of BYDV infection, seeds of a BYDV-sensitive barley variety cv. RGT Planet were space sown in a field plot with 10 cm between seeds and 20 cm between rows under two consecutive years. When BYDV symptoms were shown, plants with different levels (0 - 5) of BYDV infection were tagged. For accurate comparisons, the neighbouring non/less-infected plants were also tagged. At maturity, different agronomic traits and yield components were measured on those tagged plants. Results showed a strong linear correlation between BYDV severity and the performance of agronomic traits and yield components. The yield reductions ranged from 30% for the least affected (score of 1) to 90% for the severely affected (score of 5). Our research confirmed previous findings that BYDV seriously affects crop yield and the prediction of yield loss due to BYDV infection should use the percentage of plants with different BYDV symptoms.