Infectious crystalline keratopathy-clinical-microbiological profile and outcome of management.

PURPOSE: To describe the clinical features, management, and long-term outcome of Infectious crystalline keratopathy (ICK). METHODS: The medical records of clinically diagnosed and microbiologically proven cases of ICK were reviewed from January 2011 to December 2022. Clinical characteristics include the presence of whitish needle-like projections with branching, limited to anterior-mid stroma. Keratoplasty being the most common risk factor, graft-related microbial keratitis during the same period was also studied. The demography, clinical profile, microbiology, treatment, and outcome were analyzed, and compared with secondary graft infiltrate(GI). RESULTS: Medical records of 24 cases with ICK were reviewed. The mean age was 49.3 ± 20.1 years, with 15(62.5%) males. Prior keratoplasty was done in 18 (75%) cases, with a mean graft size of 10.1 ± 1.5 mm, and mean interval between the last graft and presentation was 9.7 ± 6.2 (3-90) months. In comparison to GI (n = 24), ICK patients (n = 18,75%) were less symptomatic, presented late (7.3 ± 6.5 days vs 16.3 ± 19.4, p = 0.003), using frequent topical steroids (> 3 times/day, p = 0.006), smaller infiltrate size < 4 mm (p = 0.008), central (p = 0.02), less associated with epithelial defect (p = 0.0001), hypopyon (p = of 0.0002), corneal perforation (p = 0.0006), and surgical management (p = 0.03). On microbiology, 22 (91.6%) ICK cases were culture positive, 14 (63.6%) gram-positive, 3 (13.6%) gram-negative, 2 (9%) mixed bacteria, and 3 (13.6%) fungus, comparable with GI. CONCLUSION: ICK affects poor ocular surfaces usually following keratoplasty with larger graft size, the use of steroids being the most common association, and it responds to medical management as compared to GI.

Development of antibiotic resistance in the ocular Pseudomonas aeruginosa clone ST308 over twenty years.

Corneal infection caused by a bacteria Pseudomonas aeruginosa is common cause of ocular morbidity. Increasing antibiotic resistance by ocular P. aeruginosa is an emerging concern. In this study the resistome of ocular isolates of Pseudomonas aeruginosa clone ST308 isolated in India in 1997 (PA31, PA32, PA33, PA35 and PA37) and 2018 (PA198 and PA219) were investigated. All the isolates of ST308 had >95% nucleotide similarity. The isolates from 2018 had larger genomes, coding sequences, accessory and pan genes compared to the older isolates from 1997. The 2018 isolate PA219 was resistant to all antibiotics except polymyxin B, while the 2018 isolate PA198 was resistant to ciprofloxacin, levofloxacin, gentamicin and tobramycin. Among the isolates from 1997, five were resistant to gentamicin, tobramycin and ciprofloxacin, four were resistant to levofloxacin while two were resistant to polymyxin B. Twenty-four acquired resistance genes were present in the 2018 isolates compared to 11 in the historical isolates. All isolates contained genes encoding for aminoglycoside (aph(6)-Id, aph(3')-lIb, aph(3″)-Ib), beta-lactam (blaPAO), tetracycline (tet(G)), fosfomycin (fosA), chloramphenicol (catB7), sulphonamide (sul1), quaternary ammonium (qacEdelta1) and fluoroquinolone (crpP) resistance. Isolate PA198 possessed aph(3')-VI, rmtD2, qnrVC1, blaOXA-488, blaPME-1, while PA219 possessed aadA1, rmtB, qnrVC1, aac(6')-Ib-cr, blaTEM-1B, blaVIM-2, blaPAO-1, mph(E), mph(A), msr(E). In both recent isolates qnrVC1 was present in Tn3 transposon. In 219 blaTEM-1 was carried on a transposon and blaOXA-10 on a class 1 integron. There were no notable differences in the number of single nucleotide polymorphisms, but recent isolates carried more insertions and deletions in their genes. These findings suggest that genomes of P. aeruginosa ocular clonal strains with >95% nucleotide identity isolated twenty years apart had changed over time with the acquisition of resistance genes. The pattern of gene mutations also varied with more insertions and deletions in their chromosomal genes which confer resistance to antibiotics.

First report of a new corneal pathogen: Phaeoacremonium parasiticum.

Keratitis is a public health issue in developing countries and a potentially sight-threatening condition. Collagen fibrils in the corneal stroma are parallels to each other. Fundamental substance maintains the same space between collagen fibrils. That is how corneal transparency can be achieved. Any damage which can modify this structure will lead to corneal opacity and loss of vision. Fungal keratitis might appear in up to one-third of cases. Nevertheless, fungal keratitis remains poorly described and understood. Herein, we present the first ever reported case of corneal infection due to Phaeoacremonium parasiticum in a young patient. We describe the clinical and microbial characteristics, and we also discuss the use of confocal microscopy in early diagnosis of this infection.

The clinical and microbiological features and outcomes of fungal keratitis over 9 years in Sydney, Australia.

To describe the clinical features, management and outcomes in patients with fungal keratitis at the Sydney Eye Hospital, Australia, over a 9-year period to guide appropriate initial therapy. A retrospective case review was conducted. Patients diagnosed with fungal keratitis from 1 January 2009 to 31 December 2017 were identified from hospital coding and pathology databases. Data were extracted from the medical records. A total of 55 episodes from 51 patients were included. Mean age was 60 ± 20 years (range: 19-91 years), and 33 were male. The fungal species was not identified in two patients. Predisposing factors included ocular surface disease in 17 eyes (32%); corneal disease, 15 (28%); corneal trauma, 12 (23%); and contact lens wear, 13 (24.5%). Fusarium spp. (15, 27%) and Candida parapsilosis (10, 18%) were the most common isolates. The median visual acuity at presentation was 1.3 logMAR (range: 0 to 3) and after treatment 0.7 logMAR (range: -0.02 to 3) (P = .008). Despite medical therapy, most commonly with natamycin and topical and oral voriconazole, surgical intervention was required in 21 eyes (40%); including antifungal injections in 9 (16%); corneal transplantation, 16 (30%); evisceration, 2 (4%); and enucleation, 1 (2%). A poor visual outcome was recorded in 27 of 43 (63%) patients. Fungal keratitis remains a cause of significant ocular morbidity; the majority of patients face a poor outcome despite intense medical and at times surgical treatment. In our setting, fungal keratitis was more commonly associated with corneal or ocular surface disease.

Staphylococcus aureus alpha-hemolysin impairs corneal epithelial wound healing and promotes intracellular bacterial invasion.

Colonization by Staphylococcus aureus (S. aureus) has been implicated in many infectious and wound healing disorders. This study was performed to characterize the pathogenic role of S. aureus alpha-hemolysin (alpha-toxin) in corneal epithelial wound healing and infectious keratitis in the setting of a corneal wound. The effect of wild-type and isogenic Hla mutant (α-hemolysin gene deleted) S. aureus bacteria and conditioned media on corneal epithelial wound healing was tested in vitro using a scratch assay and in vivo using a murine epithelial debridement model. The invasiveness of wild-type and Hla mutant S. aureus was evaluated in vitro in human corneal epithelial cells and in vivo in a murine model of infectious keratitis following total epithelial debridement. S. aureus and its conditioned media significantly delayed epithelial wound closure both in vitro (P < 0.05) and in vivo (P < 0.05). The effect of S. aureus on wound healing was significantly diminished with the Hla mutant strain (P < 0.05). Likewise, compared to the wild-type strain, the Hla mutant strain demonstrated significantly reduced ability to invade corneal epithelial cells in vitro (P < 0.05) and infect murine corneas following total epithelial debridement in vivo (P < 0.05). In conclusion, S. aureus alpha-hemolysin plays a major role in the pathologic modulation of corneal epithelial wound healing and the intracellular invasion of the bacteria. Limiting colonization by S. aureus and/or blocking alpha-hemolysin may provide a therapeutic approach for corneal wound healing and infectious disorders.

Aspergillus penicillioides Speg. Implicated in Keratomycosis.

The aim of the study was mycological examination of ulcerated corneal tissues from an ophthalmic patient. Tissue fragments were analyzed on potato-glucose agar (PDA) and maltose (MA) (Difco) media using standard laboratory techniques. Cultures were identified using classical and molecular methods. Macro- and microscopic colony morphology was characteristic of fungi from the genus Aspergillus (restricted growth series), most probably Aspergillus penicillioides Speg. Molecular analysis of the following rDNA regions: ITS1, ITS2, 5.8S, 28S rDNA, LSU and ß-tubulin were carried out for the isolates studied. A high level of similarity was found between sequences from certain rDNA regions, i.e. ITS1-5.8S-ITS2 and LSU, what confirmed the classification of the isolates to the species A. penicillioides. The classification of our isolates to A. penicillioides species was confirmed also by the phylogenetic analysis.The aim of the study was mycological examination of ulcerated corneal tissues from an ophthalmic patient. Tissue fragments were analyzed on potato-glucose agar (PDA) and maltose (MA) (Difco) media using standard laboratory techniques. Cultures were identified using classical and molecular methods. Macro- and microscopic colony morphology was characteristic of fungi from the genus Aspergillus (restricted growth series), most probably Aspergillus penicillioides Speg. Molecular analysis of the following rDNA regions: ITS1, ITS2, 5.8S, 28S rDNA, LSU and ß-tubulin were carried out for the isolates studied. A high level of similarity was found between sequences from certain rDNA regions, i.e. ITS1-5.8S-ITS2 and LSU, what confirmed the classification of the isolates to the species A. penicillioides. The classification of our isolates to A. penicillioides species was confirmed also by the phylogenetic analysis.

Listeria monocytogenes and ocular abscess: an atypical but yet potential association.

PURPOSE: To report a farmer's corneal abscess caused by an unusual pathogen: Listeria monocytogenes fluoroquinolone resistant. METHODS: A 78-year-old farmer presented a central corneal abscess associated with 1-mm hypopyon and decreased visual acuity evolving since 2 weeks. First an antibiotic therapy associating oral ofloxacin and topical ciprofloxacin, vancomycin and ceftazidime was started. Different samples of the abscess were performed and sent to different microbiological laboratories. RESULT: Listeria monocytogenes was isolated after 2 days of culture. Antibiotics sensitivity showed resistance to ciprofloxacin, fosfomycin and fusidic acid. Ceftazidime was changed for gentamicin, and after 1 month of treatment the abscess decreased considerably. CONCLUSION: This case demonstrated that even if Listeria is rarely involved in ocular abscess, it must be evocated for people with risk factors as farmers. This suspicion should lead to an extended incubation to identify the pathogen. The analysis of Listeria resistance is essential to start an efficient therapy.

2-O-Sulfated Domains in Syndecan-1 Heparan Sulfate Inhibit Neutrophil Cathelicidin and Promote Staphylococcus aureus Corneal Infection.

Ablation of syndecan-1 in mice is a gain of function mutation that enables mice to significantly resist infection by several bacterial pathogens. Syndecan-1 shedding is induced by bacterial virulence factors, and inhibition of shedding attenuates bacterial virulence, whereas administration of purified syndecan-1 ectodomain enhances virulence, suggesting that bacteria subvert syndecan-1 ectodomains released by shedding for their pathogenesis. However, the pro-pathogenic functions of syndecan-1 ectodomain have yet to be clearly defined. Here, we examined how syndecan-1 ectodomain enhances Staphylococcus aureus virulence in injured mouse corneas. We found that syndecan-1 ectodomain promotes S. aureus corneal infection in an HS-dependent manner. Surprisingly, we found that this pro-pathogenic activity is dependent on 2-O-sulfated domains in HS, indicating that the effects of syndecan-1 ectodomain are structure-based. Our results also showed that purified syndecan-1 ectodomain and heparan compounds containing 2-O-sulfate motifs inhibit S. aureus killing by antimicrobial factors secreted by degranulated neutrophils, but does not affect intracellular phagocytic killing by neutrophils. Immunodepletion of antimicrobial factors with staphylocidal activities demonstrated that CRAMP, a cationic antimicrobial peptide, is primarily responsible for S. aureus killing among other factors secreted by degranulated neutrophils. Furthermore, we found that purified syndecan-1 ectodomain and heparan compounds containing 2-O-sulfate units potently and specifically inhibit S. aureus killing by synthetic CRAMP. These results provide compelling evidence that a specific subclass of sulfate groups, and not the overall charge of HS, permits syndecan-1 ectodomains to promote S. aureus corneal infection by inhibiting a key arm of neutrophil host defense.

EepR Mediates Secreted-Protein Production, Desiccation Survival, and Proliferation in a Corneal Infection Model.

Serratia marcescens is a soil- and water-derived bacterium that secretes several host-directed factors and causes hospital infections and community-acquired ocular infections. The putative two-component regulatory system composed of EepR and EepS regulates hemolysis and swarming motility through transcriptional control of the swrW gene and pigment production through control of the pigA-pigN operon. Here, we identify and characterize a role for EepR in regulation of exoenzyme production, stress survival, cytotoxicity to human epithelial cells, and virulence. Genetic analysis supports the model that EepR is in a common pathway with the widely conserved cyclic-AMP receptor protein that regulates protease production. Together, these data introduce a novel regulator of host-pathogen interactions and secreted-protein production.

The RodA hydrophobin on Aspergillus fumigatus spores masks dectin-1- and dectin-2-dependent responses and enhances fungal survival in vivo.

Aspergillus and Fusarium species are important causes of fungal infections worldwide. Airborne spores (conidia) of these filamentous fungi express a surface protein that confers hydrophobicity (hydrophobin) and covers cell wall components that would otherwise induce a host immune cell response. Using a mutant Aspergillus fumigatus strain (ΔrodA) that does not express the RodA hydrophobin, and Aspergillus and Fusarium conidia from clinical isolates that were treated with hydrofluoric acid (which removes the A. fumigatus RodA protein), we observed increased surface exposure of ß1,3-glucan and α-mannose on Aspergillus and Fusarium conidia. We also found that ΔrodA and hydrofluoric acid-treated conidia stimulate significantly higher NF-κB p65 nuclear translocation and cytokine production by macrophages from C57BL/6, but not from Dectin-1(-/-) or Dectin-2(-/-) mice. Using a murine model of A. fumigatus corneal infection, we showed that ΔrodA conidia induced significantly higher cytokine production, neutrophil infiltration, and more rapid fungal clearance from C57BL/6 corneas compared with the parent G10 strain, which was dependent on Dectin-1 and Dectin-2. Together, these findings identify the hydrophobin RodA as a virulence factor that masks Dectin-1 and Dectin-2 recognition of conidia, resulting in impaired neutrophil recruitment to the cornea and increased fungal survival and clinical disease.

Microbiological study of therapeutic soft contact lenses used in the treatment of recurrent corneal erosion syndrome.

OBJECTIVE: To determine the bacteriological spectrum of the removed therapeutic soft contact lenses (TSCLs) and to establish efficacy of prophylactic antibiotics on TSCLs used for 2 weeks for treatment of patients with recurrent corneal erosion syndrome (RCES). METHODS: This study included idiopathic RCES treated using highly oxygen-permeable silicone hydrogel contact lenses (CLs), and treated 4 times per day with topical tobramycin 3% for 2 weeks. After TSCLs were applied for 2 weeks, the lenses were removed with sterile forceps under which a speculum was inserted, and placed on blood agar with the inner face down. The TSCLs were analyzed for bacterial colonization, and antibiotic susceptibility tests were performed for the isolates, using disk diffusion. RESULTS: Of the 40 lenses analyzed, 9 (22.5%) yielded positive cultures. Staphylococcus epidermidis was the most commonly isolated microorganism; there were five methicillin-sensitive coagulase-negative staphylococci and two methicillin-resistant coagulase-negative staphylococci. Furthermore, we found two lenses that were colonized by Enterobacter gergoviae and Citrobacter freundii. All cultured bacteria showed intermediate or complete sensitivity to ciprofloxacin, tigecycline, and tobramycin. Despite bacterial colonization in 9 CLs, no clinical signs of infectious keratitis were found in any of the patients with prophylactic topical tobramycin 3%. CONCLUSIONS: In case of using TSCLs for 2 weeks, tobramycin or ciprofloxacin may be useful as prophylactic topical antibiotics for preventing secondary corneal infections. Considering currently growing incidence of ciprofloxacin-resistant ocular isolates, tobramycin seems to be a reasonable prophylactic topical antibiotic susceptible broad spectrum of bacteria in clinics.

Equine deep stromal abscesses (51 cases - 2004-2009)--Part 2: the histopathology and immunohistochemical aspect with attention to the histopathologic diagnosis, vascular response, and infectious agents.

PURPOSE: To investigate histopathologic and immunohistochemical aspects of equine deep stromal abscesses (DSA) with a focus on the histopathologic diagnosis, presumptive etiology, and the immunohistochemical expression of three angiogenesis-related factors: vascular endothelial growth factor-A (VEGF-A), pigment epithelium-derived factor (PEDF), and interleukin-1 receptor antagonist (IL-1ra). SAMPLE POPULATION: Paraffin-embedded biopsy samples from 51 DSA. The biopsies were collected from full-thickness penetrating keratoplasty or split-thickness lamellar keratoplasty surgeries at the University of Florida Veterinary Medical Center in the period from 2004 to 2009. PROCEDURE: The histopathologic and immunohistochemical findings were tested for association between each other. Prevalence calculation and test for association with qualitative data analysis was used for data evaluation. RESULTS: Fungal hyphae were found histologically in 47.1% (n = 24) of the DSA cases. Histopathologically, most fungal DSA showed suppurative keratitis (n = 34; 66.7%) and little to no stromal vascularization infiltrating the abscess (negative association, P = 0.005). All three angiogenesis-related factors were expressed to some degree in DSA tissue. A negative association between VEGF-A and PEDF when compared to the presence of fungal hyphae (P < 0.001, P = 0.023) indicated that cases positive for these two factors will most probably not have fungal hyphae present. CONCLUSION: Abnormally decreased VEGF-A expression is suggested as the reason for the slow vascularization and delayed resolution of fungal DSA, whereas PEDF and IL-ra did not seem to have any influence on the vascularization process. Clinical and histopathologic characteristics of DSA make it possible to suggest an etiology for an equine DSA with an unknown etiology.

Equine deep stromal abscesses (51 cases - 2004-2009)--Part 1: the clinical aspects with attention to the duration of the corneal disease, treatment history, clinical appearance, and microbiology results.

OBJECTIVE: To study the equine deep stromal abscesses (DSA) with focus on the duration of the corneal disease, medical treatment, season of presentation, clinical appearance, and the degree of corneal vascularization. MATERIAL AND METHODS: Equine DSA diagnosed, biopsied, and surgically treated at the University of Florida Veterinary Medical Center (UFVMC) from 2004 to 2009 were identified. The medical record, clinical photographic images, and microbiology results for each case were evaluated. Frequency and prevalence calculation as well as qualitative data analysis was performed for clinical and microbiological data. RESULTS: Fifty-one equine DSA were included in the study. Spring (March, April, May; 33.4%) and winter (December, January, February; 31.4%) were the most common seasons for DSA presentation. The 51 cases were divided into four categories of focal opacity from their clinical appearance: focal yellow (45.2%), focal white (23.5%), diffuse yellow/white (23.5%), and focal pink (7.8%). 5.9% of the DSA (n = 3) were culture positive for fungal growth, whereas 17.6% were positive for bacterial growth (n = 9). No association between short-/long-term systemically administered NSAID treatment and the corneal vascular response to the corneal lesion could be appreciated. CONCLUSION: Equine DSA most often present in the spring and winter in the subtropical environment of the state of Florida (USA). The clinical appearance may have a connection with the etiology and pathogenesis of the equine DSA. No connection between short- or long-term systemically administered NSAID and the degree of corneal vascularization of the DSA was noted.

Treatment of six cases of equine corneal stromal abscessation with intracorneal injection of 5% voriconazole solution.

OBJECTIVE: To describe a reproducible technique for intrastromal injection in the standing horse for treatment of corneal stromal abscessation. ANIMAL STUDIED: A retrospective clinical study addressing the history, treatment, and outcome of six equids (six eyes) that received intrastromal voriconazole injection. PROCEDURE: Equids having a deep stromal abscess suspected to be of fungal origin were administered intrastromal injection of 5% voriconazole solution under standing sedation in an effort to bring about enhanced resolution of clinical disease. RESULTS: Intracorneal administration of 5% voriconazole solution resulted in resolution of clinical disease, specifically stromal abscessation and secondary uveitis. All animals displayed decreased blepharospasm and no significant complications in the immediate postinjection period. Convalescent periods were subjectively shorter than anticipated with traditional medical therapy. All animals developed mild to moderate stromal fibrosis relative to the initial severity and depth of abscessation. CONCLUSIONS: Intrastromal injection of 5% voriconazole solution may provide a safe and effective treatment option for corneal stromal abscessation in horses. In all reported cases, administration of injection early in the treatment period appeared to contribute to rapid resolution of clinical disease without significant complications. The authors present this technique as an alternative to traditional surgical intervention, being more economical, having shorter treatment duration, and potentially resulting in less scar formation.

Microbial adhesion to silicone hydrogel lenses: a review.

PURPOSE: Microbial adhesion to contact lenses is believed to be one of the initiating events in the formation of many corneal infiltrative events, including microbial keratitis, that occur during contact lens wear. The advent of silicone hydrogel lenses has not reduced the incidence of these events. This may partly be related to the ability of microbes to adhere to these lenses. The aim of this study was to review the published literature on microbial adhesion to contact lenses, focusing on adhesion to silicone hydrogel lenses. METHODS: The literature on microbial adhesion to contact lenses was searched, along with associated literature on adverse events that occur during contact lens wear. Particular reference was paid to the years 1995 through 2012 because this encompasses the time when the first clinical trials of silicone hydrogel lenses were reported, and their commercial availability and the publication of epidemiology studies on adverse events were studied. RESULTS: In vitro studies of bacterial adhesion to unworn silicone hydrogel lens have shown that generally, bacteria adhere to these lenses in greater numbers than to the hydroxyethyl methacrylate-based soft lenses. Lens wear has different effects on microbial adhesion, and this is dependent on the type of lens and microbial species/genera that is studied. Biofilms that can be formed on any lens type tend to protect the bacteria and fungi from the effects on disinfectants. Fungal hyphae can penetrate the surface of most types of lenses. Acanthamoeba adhere in greater numbers to first-generation silicone hydrogel lenses compared with the second-generation or hydroxyethyl methacrylate-based soft lenses. CONCLUSION: Microbial adhesion to silicone hydrogel lenses occurs and is associated with the production of corneal infiltrative events during lens wear.

Ocular lesions associated with Chlamydia suis in a wild boar piglet (Sus scrofa) from a semi-free range population in Spain.

The role of the wild boar (Sus scrofa) as a reservoir for a large number of pathogens that can affect both domestic animals and humans has been widely studied in the last few years. However, the impact of some of these pathogens on the health of wild boar populations is still being determined. This article presents a clinical case of severe bilateral keratoconjunctivitis affecting a 2-mo-old piglet from a semi-free range population in Spain. Histopathologic and microbiologic analysis revealed lesions in the cornea, choroid, and optical nerve, and Chlamydia suis was detected in the eyes bilaterally. The visual handicap resulting from this type of lesion greatly affects the survival of this affected piglet.

Corticosteroid-Antibiotic Interactions in Bacteria that Cause Corneal Infection.

Purpose: Although a comprehensive knowledge of antibiotic/corticosteroid combinations is essential for the appropriate treatment of eye infections, the impact of their co-administration has not been well studied to date. A systematic pharmacodynamic/pharmacokinetic study to determine the effects of cotreatment with various antibiotics and corticosteroids was conducted. Methods: Four bacterial strains, seven antibiotics, and four corticosteroids were used in the analyses. Drug interactions were evaluated by considering antibacterial effects with a checkerboard assay and intracellular concentrations in human corneal epithelial cells. Results: The drug combinations that showed the most stable effects against Pseudomonas aeruginosa was levofloxacin-prednisolone. Stable combinations against the three types of Gram-positive bacteria were neomycin-prednisolone, ofloxacin-dexamethasone, ofloxacin-prednisolone, and polymyxin-dexamethasone. The cellular concentrations were changed for the gatifloxacin-fluorometholone, moxifloxacin-fluorometholone, tobramycin-dexamethasone, and tobramycin-prednisolone combinations. Conclusions: Loteprednol and fluorometholone reduced the antibacterial effects of all of the tested antibiotics in this study. Dexamethasone and prednisolone showed various effects in this regard, depending on the co-administered antibiotic. Prior knowledge of specific antibiotic/corticosteroid interactions provides valuable information to clinical practitioners by combining data on the antibacterial and intracellular uptake effects of their co-administration. Translational Relevance: When using antibiotics and corticosteroids, drug combinations can be selected by referring to the results of this study.

Syndecan-1 promotes Staphylococcus aureus corneal infection by counteracting neutrophil-mediated host defense.

Many microbial pathogens subvert cell surface heparan sulfate proteoglycans (HSPGs) to infect host cells in vitro. The significance of HSPG-pathogen interactions in vivo, however, remains to be determined. In this study, we examined the role of syndecan-1, a major cell surface HSPG of epithelial cells, in Staphylococcus aureus corneal infection. We found that syndecan-1 null (Sdc1(-/-)) mice significantly resist S. aureus corneal infection compared with wild type (WT) mice that express abundant syndecan-1 in their corneal epithelium. However, syndecan-1 did not bind to S. aureus, and syndecan-1 was not required for the colonization of cultured corneal epithelial cells by S. aureus, suggesting that syndecan-1 does not mediate S. aureus attachment to corneal tissues in vivo. Instead, S. aureus induced the shedding of syndecan-1 ectodomains from the surface of corneal epithelial cells. Topical administration of purified syndecan-1 ectodomains or heparan sulfate (HS) significantly increased, whereas inhibition of syndecan-1 shedding significantly decreased the bacterial burden in corneal tissues. Furthermore, depletion of neutrophils in the resistant Sdc1(-/-) mice increased the corneal bacterial burden to that of the susceptible WT mice, suggesting that syndecan-1 moderates neutrophils to promote infection. We found that syndecan-1 does not affect the infiltration of neutrophils into the infected cornea but that purified syndecan-1 ectodomain and HS significantly inhibit neutrophil-mediated killing of S. aureus. These data suggest a previously unknown bacterial subversion mechanism where S. aureus exploits the capacity of syndecan-1 ectodomains to inhibit neutrophil-mediated bacterial killing mechanisms in an HS-dependent manner to promote its pathogenesis in the cornea.

New strategy for rapid diagnosis and characterization of keratomycosis.

PURPOSE: The first-line therapy for patients with keratitis is different for bacteria, filamentous fungi, and yeasts. The timely onset of treatments depends on rapid and accurate diagnosis. However, fungal cultures produce high rates of false-negative results. Nucleic acid amplification techniques (polymerase chain reaction [PCR]) improve fungal diagnosis performance, but they require complex postamplification procedures to differentiate filamentous fungi from yeasts or to identify the agent. The objective of this work was to develop a new diagnostic strategy based on real-time PCR high-resolution melting (HRM) analysis that in 1 run (a) detects and semiquantifies yeasts and filamentous fungi, (b) differentiates yeasts from filamentous fungi, and (c) discriminates among relevant species of yeasts. DESIGN: Experimental study to compare HRM diagnosis performances with microscopic examination of corneal scrapings and fungal culture. PARTICIPANTS AND CONTROLS: High-resolution melting detection limits and specificity were assessed with (a) isolated strains; (b) agents (other than fungi) producing keratitis; (c) corneal scrapings from fungal keratitis (culture positive and negative); and (d) corneal scrapings from bacterial, viral, or Acanthamoeba keratitis. METHODS: The DNA extracted from cornea specimens was mixed with primers diluted in the MeltDoctor HRM Master Mix (Applied Biosystems, Paris, France) in 2 tubes, the first for yeasts, containing the forward primer CandUn (5'CATGCCTGTTTGAGCGTC) and the reverse primer FungUn2 (5'TCCTCCGCTTATTGATATGCT), and the second for filamentous fungi, containing the forward primer FilamUn1 (5'TGCCTGTCCGAGCGTCAT) and FungUn2. Molecular probes were not necessary. The yields of DNA extraction and the PCR inhibitors were monitored by adding internal controls to each sample. MAIN OUTCOME MEASURES: Detection of fungi in corneal samples by HRM. RESULTS: High-resolution melting consistently detects the equivalent of 0.1 colony-forming units /ml of yeasts and filamentous fungi, differentiates filamentous fungi from yeasts, and discriminates among relevant species of yeasts. High-resolution melting sensitivity and specificity were 100% for culture-positive samples, detecting and characterizing fungi in 7 of 10 culture-negative suspected fungal keratitis. CONCLUSIONS: High-resolution melting is a new, sensitive, specific, and inexpensive test that detects fungi and differentiates filamentous fungi from yeasts directly from clinical specimens in less than 2.30 hours after DNA extraction.