Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 468
Filter
Add more filters

Publication year range
1.
J Sep Sci ; 47(11): e2400090, 2024 Jun.
Article in English | MEDLINE | ID: mdl-38819782

ABSTRACT

Ephedra herb (EH), an important medicine prescribed in herbal formulas by Traditional Chinese Medicine practitioners, has been widely used in the treatment of viral pneumonia in China. However, the molecular basis of EH in viral pneumonia remains unclear. In this study, a ternary correlation multi-symptom network strategy was established based on in vivo chemical profile identification and metabolomics to explore the molecular basis of EH against viral pneumonia. Results showed that 143 compounds of EH and 70 prototype components were identified in vivo. EH could reduce alveolar-capillary barrier disruption in rats with viral pneumonia and significantly downregulate the expression of inflammatory factors and bronchoalveolar lavage fluid. Plasma metabolomics revealed that EH may be involved in the regulation of arachidonic acid, tryptophan, tyrosine, nicotinate, and nicotinamide metabolism. The multi-symptom network showed that 12 compounds have an integral function in the treatment of viral pneumonia by intervening in many pathways related to viruses, immunity and inflammation, and lung injury. Further verification demonstrated that sinapic acid and frambinone can regulate the expression of related genes. It has been shown to be a promising representative of the pharmacological constituents of ephedra.


Subject(s)
Drugs, Chinese Herbal , Ephedra , Metabolomics , Rats, Sprague-Dawley , Animals , Rats , Drugs, Chinese Herbal/pharmacology , Drugs, Chinese Herbal/chemistry , Ephedra/chemistry , Male , Pneumonia, Viral/drug therapy , Pneumonia, Viral/metabolism , Pneumonia, Viral/virology
2.
Planta Med ; 90(5): 336-352, 2024 May.
Article in English | MEDLINE | ID: mdl-38423032

ABSTRACT

Ephedra species are among the most popular herbs used in traditional medicine for a long time. The ancient Chinese medical book "Treatise on Febrile Diseases" refers to the classic traditional Chinese medicine prescription Ge Gen decoction, which consists of seven herbs, including an Ephedra species. Ephedra species are utilized all over the world to treat symptoms of the common cold and coughs, and to combat major human diseases, such as asthma, cancers, diabetes, cardiovascular and digestive disorders, and microbial infections. This study aimed at identifying specific Ephedra species used traditionally in Morocco for therapeutic purposes. The plant parts, their preparation process, and the treated pathologies were identified and analyzed. The results revealed five ethnobotanically important species of Ephedra: Ephedra alata Decne, Ephedra altissima Desf., Ephedra distachya L., Ephedra fragilis Desf., and Ephedra nebrodensis Tineo. These species are used traditionally in Morocco for treating people with diabetes, cancer, rheumatism, cold and asthma, hypertension, influenza virus infection, and respiratory ailments. In addition, they are occasionally used as calefacient agents, to regulate weight, or for capillary care. Few studies have underlined the antibacterial and antioxidant activities of some of these Moroccan Ephedra species, but little information is available regarding the natural products at the origin of the bioactivities. Further phytochemical investigations and clinical data are encouraged to better support the use of these plants.


Subject(s)
Asthma , Diabetes Mellitus , Ephedra , Humans , Ethnobotany , Medicine, Traditional
3.
Chem Pharm Bull (Tokyo) ; 72(4): 385-388, 2024.
Article in English | MEDLINE | ID: mdl-38631893

ABSTRACT

Ephedra plants, the main components of which are ephedrine alkaloids, are used as traditional medicines in Eastern Asian countries. In this study, we isolated non-ephedrine constituents from various Ephedra plant species cultivated in Japan. HPLC analysis suggested that kynurenic acid and its derivatives accumulated in a wide range of Ephedra plant species. Furthermore, a large amount of (2R,3S)-O-benzoyl isocitrate has been isolated from E. intermedia. This study suggests that Ephedra plants have diverse non-ephedrine constituents.


Subject(s)
Alkaloids , Ephedra , Ephedrine , Japan , Chromatography, High Pressure Liquid
4.
Chem Biodivers ; 21(5): e202400033, 2024 May.
Article in English | MEDLINE | ID: mdl-38488267

ABSTRACT

In this research, the extract of Ephedra intermedia Schrenk & C.A.Mey. was encapsulated using the mini-emulsion polymerization method based on methyl methacrylate polymers with a nanometer size. The encapsulated extract was characterized using different analytical techniques. Furthermore, the loading efficiency and release of the plant extract were examined. FT-IR spectroscopy confirmed the formation of an expectational product. The TEM and SEM imaging showed a spherical morphology for the prepared encapsulated extract. The average size of poly-methyl-methacrylate nanoparticles containing Ephedra extract was found to be approximately 47 nm. The extract loading efficiency and encapsulation efficiency test demonstrated a dose-depending behavior on E. intermedia extract for both analyses, which is highly advantageous for traversing biological barriers. The release assay shows a controlled release for the extract at phosphate buffer solution (PBS). A 38 % release was calculated after 36 hours. The results obtained from the present study reveal that encapsulating the plant extract is a suitable alternative to control and increase their medicinal properties.


Subject(s)
Emulsions , Ephedra , Plant Extracts , Polymerization , Plant Extracts/chemistry , Plant Extracts/isolation & purification , Emulsions/chemistry , Humans , Ephedra/chemistry , Particle Size , Methanol/chemistry , Nanoparticles/chemistry , Drug Liberation
5.
Molecules ; 29(2)2024 Jan 16.
Article in English | MEDLINE | ID: mdl-38257345

ABSTRACT

Six new compounds, (7R,8S,8'R)-balanophorone (1), (7'S,8'R,8R)-yunnanensin A (2), (3S)-thunberginol C (3), (8R,8'R)-maninsigin B (4), (7S,8R)-4,7,8-dihydroxy-9,9-dimethyl-chroman (5), and 4-hydroxy-1-(4-hydroxy-3-methoxyphenyl)butan-1-one (6), along with eight known compounds (7-14), were isolated from the herbaceous stems of Ephedra intermedia Schrenket C. A. Meyer. Their structures were elucidated based on their spectroscopic (MS, NMR, IR, and UV) data, and their absolute configurations were determined by comparing their calculated and experimental electronic circular dichroic (ECD) spectra. Moreover, compounds 1 and 3-6 were evaluated for their ability to protect human pulmonary epithelial cells (BEAS-2B) from injury induced by lipopolysaccharide (LPS) in vitro. The results showed that compound 6 exhibited a significant protective effect against LPS-induced injury in BEAS-2B, and compound 5 exhibited a slightly protective effect at the concentration of 10 µM.


Subject(s)
Ephedra , Lipopolysaccharides , Humans , Chromans , Epithelial Cells
6.
Environ Monit Assess ; 196(7): 647, 2024 Jun 22.
Article in English | MEDLINE | ID: mdl-38907768

ABSTRACT

In this study, the current distribution probability of Ephedra gerardiana (Somalata), a medicinally potent species of the Himalayas, was assessed, and its spatial distribution change was forecasted until the year 2100 under three Shared Socioeconomic Pathways. Here, we used the maximum entropy model (MaxEnt) on 274 spatially filtered occurrence data points accessed from GBIF and other publications, and 19 bioclimatic variables were used as predictors against the probability assessment. The area under the curve, Continuous Boyce Index, True Skill Statistics, and kappa values were used to evaluate and validate the model. It was observed that the SSP5-8.5, a fossil fuel-fed scenario, saw a maximum habitat decline for E. gerardiana driving its niche towards higher altitudes. Nepal Himalayas witnessed a maximum decline in suitable habitat for the species, whereas it gained area in Bhutan. In India, regions of Himachal Pradesh, Uttarakhand, Jammu and Kashmir, and Sikkim saw a maximum negative response to climate change by the year 2100. Mean annual temperature, isothermality, diurnal temperature range, and precipitation seasonality are the most influential variables isolated by the model that contribute in defining the species' habitat. The results provide evidence of the effects of climate change on the distribution of endemic species in the study area under different scenarios of emissions and anthropogenic coupling. Certainly, the area of consideration encompasses several protected areas, which will become more vulnerable to increased variability of climate, and regulating their boundaries might become a necessary step to conserve the regions' biodiversity in the future.


Subject(s)
Climate Change , Ecosystem , Nepal , India , Bhutan , Ephedra , Environmental Monitoring , Probability , Socioeconomic Factors , Models, Theoretical
7.
Biochem Biophys Res Commun ; 671: 200-204, 2023 09 03.
Article in English | MEDLINE | ID: mdl-37302295

ABSTRACT

Human norovirus (HuNoV) is a major cause of acute gastroenteritis and foodborne diseases worldwide with public health concern, yet no antiviral therapies have been developed. In this study, we aimed to screen crude drugs, which are components of Japanese traditional medicine, ''Kampo'' to see their effects on HuNoV infection using a reproducible HuNoV cultivation system, stem-cell derived human intestinal organoids/enteroids (HIOs). Among the 22 crude drugs tested, Ephedra herba significantly inhibited HuNoV infection in HIOs. A time-of-drug addition experiment suggested that this crude drug more preferentially targets post-entry step than entry step for the inhibition. To our knowledge, this is the first anti-HuNoV inhibitor screen targeting crude drugs, and Ephedra herba was identified as a novel inhibitor candidate that merits further study.


Subject(s)
Caliciviridae Infections , Ephedra , Gastroenteritis , Humans , Intestines , Gastroenteritis/drug therapy , Caliciviridae Infections/drug therapy , Organoids
8.
J Sep Sci ; 46(9): e2200895, 2023 May.
Article in English | MEDLINE | ID: mdl-36823773

ABSTRACT

Ephedra herba is a conventional Chinese medicine to treat cold, fever, asthma, edema, and lung diseases in the clinic. At present, most pharmacokinetic studies focus on the pharmacokinetic process of alkaloids in normal animals. However, the non-alkaloid components are also active. In addition, the pharmacokinetic studies under pathological state make more sense for clarifying the material basis of efficacy. In this study, a sensitive and rapid ultra-high-performance-tandem mass spectrometry method was developed and applied to determine nine bioactive components (ephedrine, pseudoephedrine, methylephedrine, (+)-catechin, epicatechin, vitexin, vicenin-2, cinnamic acid, and ferulic acid) in normal, common cold and nephrotic syndrome rats after the oral administration of Ephedra herba. Compared to the normal group, except for ferulic acid, the exposure levels of the other eight components were significantly increased and the plasma clearance clearly declined in common cold rats. Similarly, the exposure levels of seven components other than cinnamic acid and ferulic acid were also significantly augmented and the plasma clearance decreased significantly in nephrotic syndrome rats. In brief, the pathological conditions of the common cold and nephrotic syndrome could lead to alterations in the pharmacokinetics profiles of the nine components, which provide a reference for further exploration of the pharmacodynamics basis of Ephedra herba.


Subject(s)
Alkaloids , Common Cold , Drugs, Chinese Herbal , Ephedra sinica , Ephedra , Nephrotic Syndrome , Rats , Animals , Ephedra/chemistry , Drugs, Chinese Herbal/analysis , Ephedrine/analysis , Plant Preparations
9.
Int J Mol Sci ; 24(14)2023 Jul 10.
Article in English | MEDLINE | ID: mdl-37511036

ABSTRACT

A previous 1H-NMR method allowed the quantification of ephedrine alkaloids; however, there were some disadvantages. The cyclized derivatives resulted from the impurities of diethyl ether were identified and benzene was selected as the better extraction solvent. The locations of ephedrine alkaloids were confirmed with 2D NMR. Therefore, a specific 1H-NMR method has been modified for the quantification of ephedrine alkaloids. Accordingly, twenty Ephedrae Herba samples could be classified into three classes: (I) E. sinica-like species; (II) E. intermedia-like species; (III) others (lower alkaloid contents). The results indicated that ephedrine and pseudoephedrine are the major alkaloids in Ephedra plants, but the concentrations vary greatly determined by the plant species and the collection locations.


Subject(s)
Alkaloids , Ephedra , Ephedrine , Proton Magnetic Resonance Spectroscopy , Pseudoephedrine , Ephedrine/analysis , Pseudoephedrine/analysis , Ephedra/chemistry , Alkaloids/analysis , Proton Magnetic Resonance Spectroscopy/methods
10.
Molecules ; 29(1)2023 Dec 29.
Article in English | MEDLINE | ID: mdl-38202783

ABSTRACT

Ephedra is one of the oldest known medicinal plants and the largest genera of the Ephedraceae family. In vivo antitumor evaluation of Ephedra foeminea revealed that ethyl acetate (EtOAc) was the most bioactive fraction. Bio-guided fractionation of EtOAc fraction afforded nine compounds isolated for the first time from the plant species. Macrocyclic spermine alkaloids (1,9), proanthocyanidins (2,4,5), quinoline alkaloids (7,8), phenolic (3), and nucleoside (6) were identified and elucidated by spectroscopic analyses including 1D and 2D NMR, ESI-MS-MS spectrometry. The tested compounds exhibited moderate anticancer activity, except for the kynurenic acid derivative (6-mKYNA) which showed significant cytotoxicity and remarkable inhibition of CA-19.9 and CA-125 tumor biomarkers. In-silico study was conducted to determine the anti-proliferative mechanism of 6-mKYNA by using the CK2 enzyme active site. Moreover, the ADME computational study suggested that 6-mKYNA is an effective candidate with a promising pharmacokinetic profile and therapeutic potential against various types of cancer.


Subject(s)
Acetates , Alkaloids , Ephedra , Biological Assay , Biomarkers, Tumor , Alkaloids/pharmacology
11.
Molecules ; 28(2)2023 Jan 09.
Article in English | MEDLINE | ID: mdl-36677722

ABSTRACT

Ephedrae Herba (Ephedra), known as "MaHuang" in China, is the dried straw stem that is associated with the lung and urinary bladder meridians. At present, more than 60 species of Ephedra plants have been identified, which contain more than 100 compounds, including alkaloids, flavonoids, tannins, sugars, and organic phenolic acids. This herb has long been used to treat asthma, liver disease, skin disease, and other diseases, and has shown unique efficacy in the treatment of COVID-19 infection. Because alkaloids are the main components causing toxicity, the safety of Ephedra must be considered. However, the nonalkaloid components of Ephedra can be effectively used to replace ephedrine extracts to treat some diseases, and reasonable use can ensure the safety of Ephedra. We reviewed the phytochemistry, pharmacology, clinical application, and alkaloid toxicity of Ephedra, and describe prospects for its future development to facilitate the development of Ephedra.


Subject(s)
Alkaloids , Antineoplastic Agents , COVID-19 , Drugs, Chinese Herbal , Ephedra , Humans , Drugs, Chinese Herbal/chemistry , Alkaloids/pharmacology , Ephedra/chemistry , Ephedrine/pharmacology
12.
J Integr Plant Biol ; 65(12): 2619-2630, 2023 Dec.
Article in English | MEDLINE | ID: mdl-37837251

ABSTRACT

Reconstructing a robust species phylogeny and disentangling the evolutionary and biogeographic history of the gymnosperm genus Ephedra, which has a large genome and rich polyploids, remain a big challenge. Here we reconstructed a transcriptome-based phylogeny of 19 diploid Ephedra species, and explored evolutionary reticulations in this genus represented by 50 diploid and polyploid species, using four low-copy nuclear and nine plastid genes. The diploid species phylogeny indicates that the Mediterranean species diverged first, and the remaining species split into three clades, including the American species (Clade A), E. rhytidosperma, and all other Asian species (Clade B). The single-gene trees placed E. rhytidosperma sister to Clade A, Clade B, or Clades A + B in similar proportions, suggesting that radiation and gene flow likely occurred in the early evolution of Ephedra. In addition, reticulate evolution occurred not only among the deep nodes, but also in the recently evolved South American species, which further caused difficulty in phylogenetic reconstruction. Moreover, we found that allopolyploid speciation was pervasive in Ephedra. Our study also suggests that Ephedra very likely originated in the Tethys coast during the late Cretaceous, and the South American Ephedra species have a single origin by dispersal from Mexico or North America.


Subject(s)
Ephedra , Phylogeny , Ephedra/genetics , Diploidy , Plastids
13.
Nutr Cancer ; 74(9): 3403-3412, 2022.
Article in English | MEDLINE | ID: mdl-35545961

ABSTRACT

Cancer is a class of diseases characterized by uncontrolled cell growth. One of the main aims of developing new therapies is to use natural resources to induce apoptosis. LC-ms/ms analysis of a methanolic extract of Ephedra alata (E.A.) allowed the identification of 20 secondary metabolites, including flavonoids, phenolic acids, and proanthocyanidins. Antiproliferative effect was assessed by crystal violet assay. Antimigration effect was tested by wound healing assay and apoptosis induction was determined by annexin binding assays, Hoechst staining, ROS production, and activation of apoptotic proteins. The results indicated that exposure of breast cancer cells to E.A. extract significantly reduced cell viability in a dose and time-dependent manner and inhibited the migration of 4T1 cells at a low dose. Moreover, treatment of cells with E.A. extract induced apoptosis, as it was detected by Annexin V/7 AAD, Hoechst staining, ROS production, and the activation of caspases.Abbreviation:BSAbovine serum albuminDMSOdimethyl sulfoxideEDTAethylenediaminetetraacetic acidLC-ms/msliquid chromatography-mass spectrometryNACN-acetyl-l-cysteinePARPpoly(ADP-ribose) polymerasePMSFphenylmethylsulfonyl fluorideRIPAradioimmunoprecipitation assay bufferROSreactive oxygen speciesRPMIRoswell park memorial instituteSDS-PAGEsodium dodecyl sulfate-polyacrylamide gel electrophoresis.


Subject(s)
Breast Neoplasms , Ephedra , Apoptosis , Breast Neoplasms/drug therapy , Cell Line, Tumor , Cell Proliferation , Chromatography, Liquid , Ephedra/chemistry , Ephedra/metabolism , Female , Humans , Plant Extracts/chemistry , Plant Extracts/pharmacology , Reactive Oxygen Species/metabolism , Tandem Mass Spectrometry
14.
Chem Pharm Bull (Tokyo) ; 70(12): 848-858, 2022.
Article in English | MEDLINE | ID: mdl-36450582

ABSTRACT

In this study, we investigated the correlation between the cultivation conditions and chemical composition of Ephedra sinica and E. sp. (denoted EP-13, which has been grown at the National Institutes of Biomedical Innovation, Health, and Nutrition for many years). The total contents of ephedrine and pseudoephedrine are specified in the Japanese Pharmacopoeia; therefore, we investigated the changes in their content under different cultivation conditions, including varying soil conditions and fertilization or the lack of fertilization. Poor growth due to low soil nutrition and lack of sunlight caused decrease of the alkaloid content. As expected, the plants accumulated proline, although the proline content varied considerably with cultivation location. The proline concentration correlated with the content of methanoproline. Moreover, a new compound, namely N,N-dimethyl-p-hydroxyphenylethylamine-O-[ß-D-glucopyranosyl-(1→3)-α-L-rhamnopyranoside], was isolated from E. sinica but was absent in EP-13. This study on the correlation between cultivation methods and the alkaloid content in Ephedra is expected to assist in the future production of quality Ephedra herb.


Subject(s)
Ephedra , Chromatography, Liquid , Mass Spectrometry , Multivariate Analysis , Proline , Soil
15.
Molecules ; 27(7)2022 Apr 06.
Article in English | MEDLINE | ID: mdl-35408741

ABSTRACT

Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.


Subject(s)
Alkaloids , Ephedra , Methamphetamine , Alkaloids/metabolism , Ephedra/genetics , Ephedra/metabolism , Ephedrine/metabolism , Humans , Nucleotides , Plant Extracts
16.
Zhongguo Zhong Yao Za Zhi ; 47(13): 3409-3424, 2022 Jul.
Article in Zh | MEDLINE | ID: mdl-35850791

ABSTRACT

The Chinese medicinal herb Mahuang is herbaceous stem of Ephedra sinica, E. intermedia, or E. equisetina(Family, Ephedraceae). In China, Mahuang has been used, all the way over a millennium, as a key component herb of many herbal medicines for management of epidemics of acute respiratory illness and is also used in officially recommended herbal medicines for COVID-19. Mahuang is the first-line medicinal herb for cold and wheezing and also an effective diuretic herb for edema. However, Mahuang can also exert significant adverse effects. The key to safety and effectiveness is rational and precise use of the herb. In this review article, we comprehensively summarize chemical composition of Mahuang and associated differences in pharmacognosy, pharmacodynamics and pharmacokinetics of Mahuang compounds, along with the adverse effects of Mahuang compounds and products. Based on full understanding of how Mahuang is used in Chinese traditional medicine, systematic research on Mahuang in line with contemporary standards of pharmaceutical sciences will facilitate promoting Chinese herbal medicines to become more efficient in management of epidemic illnesses, such as COVID-19. To this end, we recommend research on Mahuang of two aspects, i.e., pharmacological investigation for its multicompound-involved therapeutic effects and toxicological investigation for clinical manifestation of the adverse effects, chemicals responsible for the adverse effects, and conditions for safe use of the herb and the herb-containing medicines.


Subject(s)
COVID-19 Drug Treatment , Drugs, Chinese Herbal , Ephedra sinica , Ephedra , Drugs, Chinese Herbal/chemistry , Drugs, Chinese Herbal/pharmacology , Ephedra sinica/chemistry , Ephedrine/chemistry , Humans , Plants
17.
Zhongguo Zhong Yao Za Zhi ; 47(18): 4996-5007, 2022 Sep.
Article in Zh | MEDLINE | ID: mdl-36164910

ABSTRACT

This study aims to investigate mechanism of "Ephedrae Herba-Descurainiae Semen Lepidii Semen" combination(MT) in the treatment of bronchial asthma based on network pharmacology and in vivo experiment, which is expected to lay a theoretical basis for clinical application of the combination. First, the potential targets of MT in the treatment of bronchial asthma were predicted based on network pharmacology, and the "Chinese medicine-active component-target-pathway-disease" network was constructed, followed by Gene Oncology(GO) term enrichment and Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway enrichment of the potential targets. Molecular docking was used to determine the binding activity of key candidate active components to hub genes. Ovalbumin(OVA, intraperitoneal injection for sensitization and nebulization for excitation) was used to induce bronchial asthma in rats. Rats were classified into control group(CON), model group(M), dexamethasone group(DEX, 0.075 mg·kg~(-1)), and MT(1∶1.5) group. Hematoxylin and eosin(HE), Masson, and periodic acid-Schiff(PAS) staining were performed to observe the effect of MT on pathological changes of lungs and trachea and goblet cell proliferation in asthma rats. The levels of transforming growth factor(TGF)-ß1, interleukin(IL)6, and IL10 in rat serum were detected by enzyme-linked immunosorbent assay(ELISA), and the mRNA and protein levels of mitogen-activated protein kinase 8(MAPK8), cyclin D1(CCND1), IL6, epidermal growth factor receptor(EGFR), phosphatidylinositol 3-kinase(PI3 K), and protein kinase B(Akt) by qRT-PCR and Western blot. Network pharmacology predicted that MAPK8, CCND1, IL6, and EGFR were the potential targets of MT in the treatment of asthma, which may be related to PI3 K/Akt signaling pathway. Quercetin and ß-sitosterol in MT acted on a lot of targets related to asthma, and molecular docking results showed that quercetin and ß-sitosterol had strong binding activity to MAPK, PI3 K, and Akt. In vivo experiment showed that MT could effectively alleviate the symptoms of OVA-induced asthma rats, improve the pathological changes of lung tissue, reduce the production of goblet cells, inhibit the inflammatory response of asthma rats, suppress the expression of MAPK8, CCND1, IL6, and EGFR, and regulate the PI3 K/Akt signaling pathway. Therefore, MT may relieve the symptoms and inhibit inflammation of asthma rats by regulating the PI3 K/Akt signaling pathway, and quercetin and ß-sitosterol are the candidate active components.


Subject(s)
Asthma , Drugs, Chinese Herbal/therapeutic use , Animals , Asthma/drug therapy , Cyclin D1 , Dexamethasone/adverse effects , Drug Combinations , Eosine Yellowish-(YS)/adverse effects , Ephedra , ErbB Receptors , Hematoxylin/therapeutic use , Interleukin-10 , Interleukin-6 , Mitogen-Activated Protein Kinase 8/therapeutic use , Molecular Docking Simulation , Network Pharmacology , Ovalbumin/adverse effects , Periodic Acid/adverse effects , Phosphatidylinositol 3-Kinases , Proto-Oncogene Proteins c-akt/metabolism , Quercetin , RNA, Messenger , Rats
18.
Evol Dev ; 23(3): 256-266, 2021 05.
Article in English | MEDLINE | ID: mdl-33503333

ABSTRACT

Established model systems in the flowering plants have greatly advanced our understanding of plant developmental biology, facilitating in turn its investigation across diverse land plants. The reliance on a limited number of model organisms, however, constitutes a barrier for future progress in evolutionary developmental biology (evo-devo). In particular, a more thorough understanding of seed plant character evolution and of its genetic and developmental basis has been hampered in part by a lack of gymnosperm model systems, since most are trees with decades-long generation times. Guided by the premise that future model organisms should be selected based on their character diversity, rather than simply phylogenetic "position," we highlight biological questions of potential interest that can be addressed via comparative studies in Ephedra (Gnetales). In addition to having relatively small genomes and shorter generation times in comparison to most other gymnosperms, Ephedra are amenable to investigations on the evolution of the key reproductive seed plant innovations of pollination and seed dispersal, as well as on polyploidy, and adaptation to extreme environments.


Subject(s)
Cycadopsida , Ephedra , Animals , Biological Evolution , Cycadopsida/genetics , Ephedra/genetics , Phylogeny , Pollination , Reproduction
19.
Pharm Res ; 38(4): 569-581, 2021 Apr.
Article in English | MEDLINE | ID: mdl-33754256

ABSTRACT

PURPOSE: Ephedra herb (Mao) exerts potent anti-allergic effects. This study aimed to examine the underlying mechanisms of Mao on allergic inflammation using in vitro cultured mast cells (MCs) and an in vivo model of MC-dependent anaphylaxis. METHODS: Bone marrow-derived MCs (BMMCs) were presensitized with anti-2,4-dinitrophenol (DNP) immunoglobulin E (IgE) and challenged with antigens (Ag; DNP-human serum albumin). Degranulation responses and cell surface high-affinity receptor for IgE (FcεRI) expression were assessed with/without Mao treatment. Passive systemic anaphylaxis (PSA)-treated mice were administered Mao and the pathophysiological responses were evaluated. RESULTS: Mao inhibited Ag-induced BMMC degranulation, but not polyclonal activation with phorbol 12-myristate 13-acetate (PMA) and ionomycin, indicating that Mao inhibits IgE-dependent activation of BMMCs. Mao-treated BMMCs exhibited significant reductions in expression of surface IgE and its receptor FcεRI. Analysis of subcellular localization revealed that Mao induces FcεRI internalization in BMMCs without degranulation. In the PSA mouse model, Mao administration prevented antigen-induced hypothermia. Mao administration significantly reduced cell surface expression of IgE-bound FcεRI on peritoneal MCs. CONCLUSIONS: Mao induced FcεRI internalization in MCs, thereby inhibiting Ag-induced IgE-dependent degranulation. The inhibitory effects of Mao on MC degranulation may offer a novel therapeutic approach for allergic diseases.


Subject(s)
Anaphylaxis/drug therapy , Anti-Allergic Agents/pharmacology , Ephedra/chemistry , Mast Cells/drug effects , Plant Extracts/pharmacology , Anaphylaxis/immunology , Animals , Anti-Allergic Agents/therapeutic use , Cell Degranulation/drug effects , Cell Degranulation/immunology , Cells, Cultured , Disease Models, Animal , Female , Humans , Immunoglobulin E/metabolism , Ionomycin/immunology , Mast Cells/immunology , Medicine, Kampo/methods , Mice , Plant Extracts/therapeutic use , Plant Stems/chemistry , Primary Cell Culture , Signal Transduction/drug effects , Signal Transduction/immunology , Tetradecanoylphorbol Acetate/immunology
20.
Molecules ; 26(6)2021 Mar 13.
Article in English | MEDLINE | ID: mdl-33805790

ABSTRACT

A highly specific and sensitive proton nuclear magnetic resonance (1H-NMR) method has been developed for the quantification of ephedrine alkaloid derivatives in Ephedra herbal commercial prescriptions. At the region of δ 4.0 to 5.0 ppm in the 1H NMR spectrum, the characteristic signals are separated well from each other, and six analogues in total, methylephedrine (ME), ephedrine (EP), norephedrine (NE), norpseudoephedrine (NP), pseudoephedrine (PE), and methylpseudoephedrine (MP) could be identified. The quantities of these compounds are calculated by the relative ratio of the integral values of the target peak for each compound to the known concentrations of the internal standard anthracene. The present method allows for a rapid and simple quantification of ephedrine alkaloid derivatives in Ephedra-related commercial prescriptions without any preliminary purification steps and standard compounds, and accordingly it can be a powerful tool to verify different Ephedra species. In comparison to conventional chromatographic methods, the advantages of this method include the fact that no standard compounds are required, the quantification can be directly performed on the crude extracts, a better selectivity for various ephedrine alkaloid derivatives, and the fact that a very significant time-gain may be achieved.


Subject(s)
Alkaloids/analysis , Ephedra/chemistry , Ephedrine/analogs & derivatives , Ephedrine/analysis , Ephedra/classification , Feasibility Studies , Humans , Limit of Detection , Magnetic Resonance Spectroscopy/methods , Magnetic Resonance Spectroscopy/statistics & numerical data , Medicine, Chinese Traditional , Phenylpropanolamine/analysis , Plant Preparations/chemistry , Pseudoephedrine/analysis , Species Specificity
SELECTION OF CITATIONS
SEARCH DETAIL