As the Worm Turns-A Rare Cause of Intestinal Obstruction.

BACKGROUND: Anisakiasis, a zoonotic disease caused by the nematode Anisakis, poses a significant concern for public health, particularly in regions with high consumption of raw or undercooked fish. CASE PRESENTATION: We present a case report of a 41-year-old woman who developed severe abdominal symptoms, ultimately diagnosed with intestinal obstruction due to Anisakis infestation, requiring surgery. Despite the absence of prominent eosinophilia or specific radiological findings, the diagnosis was confirmed through histological examination, highlighting the importance of considering anisakiasis in patients with a history of raw seafood consumption. CONCLUSION: The case underscores the diagnostic challenges associated with anisakiasis, emphasizing the need for increased awareness among healthcare professionals and the public regarding the risks of consuming raw or undercooked seafood. Effective management requires a multidisciplinary approach, including clinical assessment, imaging studies, and histological evaluation, to ensure timely diagnosis and appropriate treatment.

Evaluation of real-time qPCR-based methods to detect the DNA of the three protozoan parasites Cryptosporidium parvum, Giardia duodenalis and Toxoplasma gondii in the tissue and hemolymph of blue mussels (M. edulis).

The protozoan parasites Cryptosporidium spp., Giardia duodenalis and Toxoplasma gondii can be transmitted to humans through shellfish consumption. No standardized methods are available for their detection in these foods, and the performance of the applied methods are rarely described in occurrence studies. Through spiking experiments, we characterized different performance criteria (e.g. sensitivity, estimated limit of detection (eLD95METH), parasite DNA recovery rates (DNA-RR)) of real-time qPCR based-methods for the detection of the three protozoa in mussel's tissues and hemolymph. Digestion of mussels tissues by trypsin instead of pepsin and the use of large buffer volumes was the most efficient for processing 50g-sample. Trypsin digestion followed by lipids removal and DNA extraction by thermal shocks and a BOOM-based technique performed poorly (e.g. eLD95METH from 30 to >3000 parasites/g). But trypsin digestion and direct DNA extraction by bead-beating and FastPrep homogenizer achieved higher performance (e.g. eLD95METH: 4-400 parasites/g, DNA-RR: 19-80%). Direct DNA recovery from concentrated hemolymph, by thermal shocks and cell lysis products removal was not efficient to sensitively detect the protozoa (e.g. eLD95METH: 10-1000 parasites/ml, DNA-RR ≤ 24%). The bead-beating DNA extraction based method is a rapid and simple approach to sensitively detect the three protozoa in mussels using tissues, that can be standardized to different food matrices. However, quantification in mussels remains an issue.

Anisakiasis in Palatine Tonsil.

ABSTRACT: Anisakiasis is a parasitic infection caused by ingesting raw or undercooked fish and seafood infected with Anisakis larvae. Anisakis genus is mostly found in the mucosal or submucosal layer of the stomach and intestine. However, the reports of anisakiasis in tonsils are highly uncommon. A 54-year-old woman with clinical features of sore throat and foreign-body sensation for 10 days after eating raw and undercooked fish. A wriggling worm was noted beneath the mucosa of the right palatine tonsil upon endoscopic examination. The worm was immediately removed completely and histological examination revealed anisakiasis. Reports of anisakia-sis in the tonsils are scarce, but it should be considered at the initial physical examination of patients who visit the hospital for sore throat after eating raw fish. We report a case of anisakiasis in the palatine tonsils, which to date has been rarely reported in the literature.

[Human diseases caused by Anisakis simplex]. / Maladies causées par Anisakis simplex chez l'humain.

Anisakis simplex is a parasitic worm. It infects marine mammals that feed on fish and cephalopods, its intermediary hosts. Human disease is caused by accidental ingestion of Anisakis larvae. Upon consumption of contaminated fish, cuttlefish or squid, human may develop two distinct clinical pictures: Anisakiasis is provoked by living larvae penetrating the digestive mucosa. Allergy is caused by IgE-mediate hypersensitivity to living or dead larvae in a previously sensitized individual. Anisakiasis may manifests with violent epi gastric pain, acute abdomen or eosinophilic gastroenteritis. The larvae may be visualized by endoscopy or histology. The main Anisakis allergens are not denaturated by heat or cold and resist to digestion. Allergy diagnosis relies on careful history and detection of specific IgE.

Anisakis simplex est un ver parasite (helminthe) du groupe des nématodes. Il infeste les mammifères marins se nourrissant de poissons et de céphalopodes, ses hôtes intermédiaires. Chez l'homme, l'ingestion de poissons, de calamars ou de seiches contaminés est responsable de 2 tableaux cliniques. L'anisakiase est provoquée par la pénétration de la muqueuse digestive par des larves vivantes. L'allergie est une réaction IgE (immunoglobuline E) médiée aux parasites morts ou vivants chez une personne préalablement sensibilisée. L'anisakiase occasionne des épigastralgies, un abdomen aigu ou de manière plus sournoise une gastroentérite à éosinophiles. Les larves sont visualisables par endoscopie ou à l'histologie. Les principaux allergènes d'Anisakis résistent à la cuisson et à la digestion. Le diagnostic d'allergie se base sur l'anamnèse et la détection d'IgE spécifiques.

Prevalence and identification of Anisakis nematodes in fish consumed in Marrakesh, Morocco.

Morocco is considered as an important producer of fish with more than one million tons of small pelagic fish caught per year, along more than 3400 km of coastline. Otherwise, few studies have investigated the zoonotic parasites of fish. The purpose of this study is to determine the prevalence of Anisakis nematodes larvae in two fish species, namely sardines Sardina pilchardus and mackerel Scomber scombrus. These two species are widely consumed in Marrakesh due to their availability and their affordable prices. A total of 948 fish, including 546 sardines and 402 mackerel, were purchased from the wholesale market of Marrakesh, from January 2016 to December 2018. Sampling was performed on the days of fish arrival from the fishing areas (Dakhla, Essaouira, Safi and Sidi Ifni). The samples were examined visually for the presence of Anisakis larvae. We obtained a prevalence of 8.4% in mackerel with different rates depending on their origins (Safi: 13.23%; Essaouira: 11.66%; Sidi Ifni: 2.5%; Dakhla: 0%) and the seasons. However, no larvae were detected in the sardines after meticulous visual inspection. The detected larvae were morphologically and genetically identified. We identified the larvae by the PCR-RFLP technique using the primers LSU5-F (TAGGTCGACCCGCTGAAYTTAAGCA) and IR16-R (ATTCACACCCATTGACTCGCG) from the 28S rDNA region. The analysis showed that all larvae belong to Anisakis simplex sensu-stricto (s.s.). According to our results mackerel presents a higher risk of contamination than sardine, while statistical studies show that there is no impact of season and fishing origin on the prevalence.

A case report and statewide surveillance of "weak meat" condition of Alaska weathervane scallops, Patinopecten caurinus, linked to a recently identified pathogenic parasite, Merocystis kathae (Apicomplexa: Aggregatidae).

Weathervane scallop, Patinopecten caurinus, the largest scallop species in the world, is distributed from northern California, U.S.A., to the Bering Sea, and is only commercially harvested in Alaska. The fishery is considered well managed by the State of Alaska (U.S.A) Department of Fish and Game (ADF&G) and federal government, with many precautionary measures in place to avoid overharvest. There have been episodic declines in some management areas due to unknown causes. Fishermen also encounter scallops with abnormal adductor muscles, a condition colloquially termed "weak meat", characterized by the retention of muscle when shucked, an obvious darkened discoloration, and/or an abnormal texture making the product unacceptable for marketing. A similar syndrome in Atlantic sea scallops, Placopecten magellanicus, described as "gray meat", occurs in the eastern U.S. and Canada, and proposed causes include senescence, loss of bioenergetics due to chronic infestations, or a synergism of these factors. Recently a severe apicomplexan infection was found to cause a gray meat condition in Iceland scallops, Chlamys islandica, and the collapse of that stock. This parasite was subsequently detected in Atlantic sea scallops with the gray meat condition off the U.S. East Coast. Studies that followed identified the parasite as Merocystis kathae, previously described from the common whelk, Buccinum undatum, more than 100 years ago. In 2015 Bering Sea fishermen reported weak meat in their catch, so samples were submitted to ADF&G for diagnosis. Adductor muscles from all affected scallops had many large foci of an apicomplexan associated with necrosis, fibrosis, and muscular atrophy. Given the reduced quality, marketability, and possibly fitness of affected scallops, we performed a survey to estimate prevalence, intensity, and geographic distribution of this apicomplexan in Alaskan weathervane scallops. We sampled 180 scallops, from individual beds within each of the three major geographically broad scallop areas in Alaska. Overall prevalence was about 82%, ranging from 69 to 100% by district. Overall mean infection intensity, based on the number of parasite foci/section, was about 9 (range of 5-29, by location), with scallops from the Bering Sea and Southwest Kodiak being most severely infected. Molecular analyses confirmed that the Alaskan parasite is M. kathae, i.e., the same apicomplexan that caused the collapse of Icelandic scallops and a suspected cause for gray meat and mass mortality of Atlantic sea scallops in northeast North America.

The presence of Apicomplexan parasites in king scallops (Pecten maximus) in Scottish waters.

The king scallop (Pecten maximus) is a commercially important species found around the United Kingdom coast. The association of an Apicomplexan-like parasite with mass mortality of Icelandic scallop (Chlamys islandica) in Iceland and the presence of identical parasites in king scallop (Pecten maximus) and queen scallop (Aequipecten opercularis) in Scotland raised serious concerns regarding the health of Scottish king scallops. Marine Scotland Science (MSS) conducted a survey in 2016 to assess the prevalence and the intensity of parasite infection in king scallops. King scallops were collected and sampled during the annual scallop dredge surveys in the Shetland Isles and the east and west coast of Scotland. The king scallop adductor muscle was macroscopically examined and tissue imprints taken to grade the intensity of infection. The parasite was present in the majority of the king scallops sampled in all surveyed areas: Shetland Isles 87.1%, east coast 76.0% and west coast of Scotland 64.1%. However, the parasitic infestations were light in intensity with the majority of the king scallops graded as 1 (≤20 zoites per microscopic field). No macroscopic changes in the adductor muscle were observed and histopathology examination revealed minor localized fiber degeneration of adjacent fibers to parasite clusters. The results suggested the parasite to be widespread around the Scottish coast and it appears to be able to live within the king scallop at low intensity of infection without causing significant downgrade of the adductor muscle (in terms of colour or texture) or mortality. The partial genome sequence of the parasite in king scallops from Scottish waters was identical to the one reported by Kristmundsson and Freeman (2018) in the Icelandic scallop in Icelandic waters.

Unexpected morphological and molecular diversity of trematode (Haploporidae: Forticulcitinae) parasites of mullets from the ocean Pacific coasts in Middle America.

Two new genera and four new species from subfamily Forticulcitinae are described from the intestines of white mullet (Mugil curema) and flathead grey mullet (Mugil cephalus) collected in 27 localities across a wide geographical range on Pacific Ocean slopes comprising three countries in Middle America: Mexico, Guatemala and Costa Rica. The new genera Ekuarhuni n. gen. and Overstreetoides n. gen. had to be erected to accommodate two new species, Ekuarhuni papillatum n. sp. and Overstreetoides pacificus n. sp., with unique morphological traits that differentiate them from the two genera described previously. In addition, two new species, Forticulcita minuta n. sp. and Forticulcita isabelae n. sp., were described, which were characterized as exhibiting a small body size (< 1100 µm long). These new species were classified as the diminutive morphotype, together with three other congeneric species of Forticulcita. Forticulcita minuta n. sp. is distinguished by being the smallest species within the genus (< 305 µm). Meanwhile, Forticulcita isabelae n. sp. is distinguished by its body size and testis length. In specimens of the four new species, sequencing was performed with two molecular markers, the large subunit (LSU) and the internal transcribed spacer 2 (ITS2) of nuclear rDNA, and the results were compared with other sequences available in GenBank. Phylogenetic analyses performed with the combined dataset of the two nuclear molecular markers (LSU + ITS2) placed all the analysed species within the clade of Forticulcitinae with strong bootstrap support (100%) and a high Bayesian posterior probability (1.0). The four new species showed differences in abundance in their definitive hosts and were widely distributed along the Pacific Ocean coasts of Mexico, Guatemala and Costa Rica, in Middle America.

Zschokkella epinepheli n. sp. (Myxosporea: Myxidiidae) infecting the gallbladder of the white grouper Epinephelus aeneus (Serranidae) from Tunisian waters.

A new coelozoic myxosporean species, Zschokkella epinepheli n. sp., collected from the gallbladder of the white grouper Epinephelus aeneus (Perciformes: Serranidae) from the bay of Bizerte, Tunisia, is described based on morphological and molecular characteristics. Myxospores and plasmodia were observed floating free in the bile. Mature plasmodia were polysporic and subspherical in shape, measuring 85.0-94.0 µm long and 70.0-82.0 µm wide. Mature myxospores were ovoid in valvular view, measuring 10.0 ± 1.7 (8.0-11.0) µm in length and 7.0 ± 0.3 (6.6-7.5) µm in width. Polar capsules were pyriform and equal in size, measuring 3.0 ± 0.2 (2.8-3.6) µm in length and 2.3 ± 0.3 (1.8-2.7) µm in width. Myxospore valves had 12-14 longitudinal striations. Based on the small subunit rDNA, the new species Z. epinepheli n. sp. differs from all other Zschokkella species for which there is a DNA sequence deposited in GenBank. Phylogenetic analysis revealed that Z. epinepheli n. sp. clustered in the marine subclade of Zschokkella species within the biliary tract IV clade. This is the first report of a Zschokkella species from the gallbladder of an epinephelin fishes.

First report of Kudoa thunni and Kudoa musculoliquefaciens affecting the quality of commercially harvested yellowfin tuna and broadbill swordfish in Eastern Australia.

Recent anecdotal reports from seafood processors in eastern Australia have described an increased occurrence of post-mortem myoliquefaction ('jellymeat') in broadbill swordfish Xiphias gladius, and macroscopic cysts throughout the musculature of yellowfin tuna Thunnus albacares. A genus of parasitic cnidarians, Kudoa (Myxosporea, Multivalvulida), species of which are known to occur in economically important wild-caught fish species globally, can cause similar quality-deterioration issues. However, Kudoa sp. epizootiology within commercially harvested, high-value fish caught within Australia is poorly understood, despite the parasite's economic importance. To determine the causative agent responsible for the observed quality deterioration in swordfish and yellowfin tuna, muscle-tissue samples from seafood processors in Mooloolaba, Australia, collected from October 2019-February 2020, were examined for parasitic infection. Kudoid myxospores were identified from both hosts and were subquadrate in shape, with four equal-sized polar capsules. The SSU rDNA sequences from both fish shared > 99% identity to Kudoa species. Kudoa musculoliquefaciens was isolated from 87.1% of swordfish sampled, suggesting that it is a widespread parasite in swordfish from the southwest Pacific Ocean. This study provides the first molecular and morphological characterisation of Kudoa thunni in yellowfin tuna and K. musculoliquefaciens in swordfish harvested from the waters of eastern Australia, expanding the geographical distribution of K. thunni and K. musculoliquefaciens to include the Coral and Tasman Seas. We demonstrate that not all infected swordfish progress to jellymeat, show the usefulness of molecular tools for reliably identifying infection by Kudoa spp., and add to the overall knowledge of kudoid epizootiology in wild-caught fish.

Integrative species delimitation and community structure of nematodes in three species of Australian flathead fishes (Scorpaeniformes: Platycephalidae).

This study aimed to determine the integrative characterisation of nematodes from three species of edible flathead fishes (Scorpaeniformes: Platycephalidae) in New South Wales, Australia, and describe nematode communities within three species of flatheads. Tiger (Platycephalus richardsoni (Castelnau); n = 20) and sand flatheads (Platycephalus bassensis (Cuvier); n = 20), sourced from the Nelson Bay area, and dusky flathead (Platycephalus fuscus (Cuvier); n = 20) from the Manning River, Taree, were examined for the presence of nematodes. The nematodes were initially classified morphologically as 12 different morphotypes belonging to the families Anisakidae (Anisakis types I, II, and III, Contracaecum type II, Terranova types I and II), Raphidascarididae (Hysterothylacium types IV, VI, VIII, and H. zhoushanense larva), and Gnathostomatidae (Echinocephalus sp. larva), Capillariidae (Capillaria sp.), followed by genetic identification through sequencing of the internal transcribed spacer (ITS-1, 5.8S, ITS-2) regions. Phylogenetic analyses revealed the evolutionary relationship between the identified larval specimens in the present study with available GenBank larval and adult nematodes. Sand flathead was 90% infected with nematodes followed by tiger flathead at 85% and dusky flathead at 15%. Nematodes infecting estuarine dusky and oceanic sand and tiger flatheads contrasted markedly. The analysis of similarities (ANOSIM) showed significant differences (p < 0.001) in the composition of taxa within nematode communities between the three species of flatheads (global R = 0.208) with the highest difference being between sand and dusky flatheads (R = 0.308, p < 0.001). The findings of the present study provide a foundation for future investigations of the community composition, life cycles, and distribution of nematode populations in edible fish in Australia and explore and clarify their significance to public health.

Scanning electron microscopic observation of the in vitro cultured protozoan, Perkinsus olseni, isolated from the Manila clam, Ruditapes philippinarum.

BACKGROUND: Perkinsosis is a major disease affecting the commercially important marine mollusk Ruditapes philippinarum (Manila clam) in Asian waters. In this study, we investigated the morphological characteristics of Perkinsus olseni, the causative agent of perkinsosis, cultured under laboratory conditions at different stages of its life cycle using a scanning electron microscope (SEM). RESULTS: The prezoosporangia formed after induction with Ray's fluid thioglycollate medium (RFTM) developed into zoosporangia. During this process, a discharge tube formed a porous sponge-like structure that detached before the zoospores were released; thus, this organelle operated as a bung. Liberated zoospores gradually transformed into immature trophozoites, during which detachment of the anterior flagella occurred, but the loss of the posterior flagella was not clearly observed in the present study. Mature trophozoites underwent schizogony by cleaving the cell forming some merozoites in schizonts, which were released by the rupturing of the cellular membrane of the schizont within a few days. CONCLUSIONS: Our morphological and ultrastructural studies contribute new information on the life cycle and propagation of P. olseni.

Locally acquired infection with Dibothriocephalus nihonkaiense (=Diphyllobothrium nihonkaiense) in France: the importance of molecular diagnosis.

Diphyllobothriasis is a parasitic fish-borne disease caused by tapeworms of the genus Dibothriocephalus (=Diphyllobothrium). The majority of reported cases are attributed to D. latum, based on morphological identification of eggs or proglottids. However, numerous reports in recent years suggested that other Dibothriocephalus species could be involved in human infections, mainly after consumption of salmonid fish. Among these, D. nihonkaiense has been predominantly reported from Eastern Asia and probably underestimated in the rest of the world. We report here a clinical case of D. nihonkaiense in a French patient (without history of travel abroad) after consumption of salmon. Suspected on morphological characteristics, the final identification of D. nihonkaiense was performed using molecular methods by sequencing nad1, cox1, and 5.8S rRNA (containing ITS1 and 2) genes sequences. The patient was successfully treated by a single dose of praziquantel. Reports of diphyllobothriasis due to D. nihonkaiense are rare outside Asia, but worldwide demand of seafood could lead to the globalization of cases and reflect the need to monitor the distribution of Dibothriocephalus species. Thus, clinical parasitologists should be aware of this risk and able to raise the possibility of infections by non-endemic Dibothriocephalus species in order to use the proper molecular tools.

World-wide prevalence of Anisakis larvae in fish and its relationship to human allergic anisakiasis: a systematic review.

The infective stage of Anisakidae nematodes responsible for allergic reactions in humans is found in a variety of edible fish and cephalopods. The identification of geographical regions that are high risk for infected seafood may help prevent allergic reactions in humans. Despite an abundance of published literature which has identified anisakid larvae in an array of edible seafood as well as scattered reports of human allergic anisakiasis, the relationship between the two has not been fully explored. Therefore, a systematic spatio-temporal study was conducted to determine the prevalence of Anisakis spp. in fish from January 2000 to August 2020 firstly to explore the relationship between fish infection and cases of allergic anisakiasis and secondly to use fish infection data to map potential allergic anisakiasis 'hot spots'. A systematic literature search for original English text articles was conducted through search engines, Web of Science, Scopus, PubMed, Science Direct and Google Scholar. Out of 3228 articles which describe anisakid infection in fish, 264 were used for data extraction. Of 904 articles describing allergic anisakiasis, 37 were used for data extraction. A qualitative summary of the extracted data was performed using equal interval method (ArcMap software) in order to compare the global distribution of Anisakis-infected fish. Of the 152-identified fish hosts, five families were most commonly infected with Anisakis spp. These included Lophiidae (86.9%), Trichiuridae (77.05%), Zeidae (70.9%), Merlucciidae (67.8%) and Gadidae (56.8%). The hot spot areas for allergic anisakiasis were North and northeast of Atlantic Ocean, southwest of USA, west of Mexico, south of Chile, east of Argentina, Norway, UK and west of Iceland (confidence 99%). The highest rate of allergic anisakiasis was in Portugal and Norway with the prevalence rate of 18.45-22.50%. Allergologists should consider allergic anisakiasis as a public health issue particularly in high-risk countries where high prevalences in fish have been demonstrated.

Kudoa yasai n. sp. (Multivalvulida: Kudoidae) from the skeletal muscle of Macrodon ancylodon (Sciaenidae) on the northern Atlantic coast, Brazil.

A new parasite species, Kudoa yasai n. sp. (Multivalvulida), is described from the king weakfish (Macrodon ancylodon), which is an important commercial fishery resource on the Brazilian Amazon coast. A total of 190 M. ancylodon specimens were obtained from the central fish market of the town of Bragança, and pseudocysts were found in the skeletal muscle fiber samples of all (100%) of the specimens, although no inflammatory reaction was observed in any of the cases. The myxospores are quadrate in shape with four polar capsules of equal size, 6.9 ± 0.94 µm long, 8.2 ± 0.39 µm wide, and 5.5 ± 0.60 µm thick. The polar capsules are 1.8 ± 0.26 µm in length and 1.4 ± 0.18 µm in width. The morphological and morphometric parameters, together with the phylogenetic analysis of a partial sequence of the 18S (SSU rDNA) gene, all indicate conclusively that Kudoa yasai n. sp. is a new species, distinct from all other Kudoa species. The study also verified the loss of quality in the meat of the host fish (M. ancylodon) sold in the Bragança market, which reinforces the need for the more systematic control of the quality of the product and the prevention of possible health problems for the consumer.

Effects of Goussia infecting the blue whiting and phylogenetic placement of Goussia infecting marine fish off Northern Portugal.

Coccidian parasites of fish have received considerably less attention than their terrestrial counterparts, and within piscine hosts, most studies have focused on freshwater fish. The present study aimed to describe oocyst morphology, phylogenetic affinities, and the impacts of coccidian parasites infecting the internal organs of a commercially valuable marine fish, the blue whiting (Micromesistius poutassou), captured off the Portuguese coast. As part of the phylogenetic analysis, sequences from coccidians infecting the pout (Trisopterus luscus) and the Atlantic chub mackerel (Scomber colias) were included, and the oocyst morphology of the coccidians infecting the former was also reported. Results showed that the prevalence of coccidiosis in the blue whiting was very high (> 82%), occurring in all analyzed organs, despite being more abundant in the liver. A significant negative correlation was found between the abundance of the parasites in the liver and host condition index (p < 0.05), which indicates a negative effect on the fitness of this host. Phylogenetic analyses of the parasites found in all three species examined identified three different species of Goussia, closely related to Goussia clupearum. Adding to previous research, we propose the existence of a fourth group of Goussia, the clupearum type, able to infect multiple organs and phylogenetic related with G. clupearum.

Ceratomyxa mennani n. sp. (Myxosporea: Bivalvulida) parasitizing the gallbladder of the dusky grouper Epinephelus marginatus (Serranidae) from Tunisian waters.

Ceratomyxa mennani n. sp. is a new coelozoic Ceratomyxa species found in the gallbladder of Epinephelus marginatus from the Gulf of Tunis, Tunisia. Mature plasmodia were disporic, ovoid in shape measuring 9-12 µm in width and 11-14 µm in length. Mature myxospores were slightly crescent-shaped with almost straight posterior margin, measuring 5.8 ± 0.2 (5.4-6.1) µm in length and 12.7 ± 0.3 (11.9-13.0) µm in thickness. The two valves were unequal with rounded ends. Polar capsules were spherical, equal in size with 2.1 ± 0.2 (1.9-2.6) µm in diameter. The binucleated sporoplasm filled the entire cavity of the myxospore. Molecular analysis of SSU rDNA sequences indicated that C. mennani n. sp. was distinct from all other Ceratomyxa sequences in GenBank. Phylogenetic analysis revealed that C. mennani n. sp. clustered with Ceratomyxa species infecting Epinephelinae fishes. Seasonal prevalence of infection over one year was significantly higher in winter and the lowest in autumn. This is the third report of Ceratomyxa species infecting the gallbladder of Epinephelus marginatus from Tunisia and the first study to include molecular data.

Risky business: influence of eye flukes on use of risky microhabitats and conspicuousness of a fish host.

A prerequisite for a parasitic manipulation to be considered adaptive is that it confers a fitness benefit to the parasite, such as increased transmission to another host. These manipulations can involve alterations to a wide range of host phenotypic traits, including microhabitat choice. Eye flukes of the trematode family Diplostomidae use fish as intermediate hosts and must be transmitted by predation to a piscivorous bird. In New Zealand, the diplostomid Tylodelphys darbyi infects the eyes of a widespread endemic freshwater fish, the common bully Gobiomorphus cotidianus. Within the eye, T. darbyi metacercariae achieve large sizes and move freely about the aqueous and vitreous humors of the eye. We hypothesized that higher intensities of T. darbyi would (i) cause bullies to show increased activity and spend more time moving about in open space (i.e., more conspicuous, risky microhabitat) and (ii) reduce their ability to compete for shelter with fish harboring lower infection levels. Our experiments showed that heavily infected fish were more active and spent more time in the open, although the effect was age-dependent, with immature fish displaying decreases in activity and time spent in the open with increasing intensities of infection. We also demonstrated that heavily infected female bullies have a lower probability of using shelter, but males show the opposite pattern. It is possible that using more risky microhabitats increases the likelihood of the fish being eaten by the parasite's predatory avian definitive hosts. However, our findings indicate that age- and sex-dependent effects call for a more nuanced interpretation.

Human infection with Pseudoterranova cattani by ingestion of "ceviche" in Buenos Aires, Argentina.

Anisakidosis is an infection caused by larval nematodes that belong to several genera within the family Anisakidae. Anisakidosis has about 20000 cases reported to date, the vast majority (90%) in Japan. Usually, human anisakiosis is more common than human pseudoterranovosis in Japan and Europe, although in North America Pseudoterranova spp. is the more frequent. Cases of human pseudoterranovosis have been reported from Chile and Peru. We here report one of the few cases of human infection by Pseudoterranova cattani by consumption of "ceviche" in Buenos Aires, Argentina.

Skin nodules associated with parasitism with Henneguya sp. (Cnidaria: Myxosporea) in the neotropical fish Cyphocharax modestus.

A new myxozoan species, Henneguya sp., is described based on material from skin of Cyphocharax modestus. Mature myxospores are were elongate and ellipsoidal, measuring 21.4 ±â€¯1.2 (19.4-23.2) µm in total length, 5.1 ±â€¯0.3 (4.5-5.8) µm in width, 11.9 ±â€¯0.5 (10.9-12.7) µm in body length and 9.6 ±â€¯0.7 (8.4-10.5) µm in length of the caudal process. The polar capsules were elongated and had unequal sizes, with length of 5.1 ±â€¯0.4 (4.5-6.0) µm and 5.6 ±â€¯0.4 (4.9-6.3) µm for smaller and larger respectively and width of 1.8 ±â€¯0.2 (1.4-2.0) µm. The larger polar capsule had 8 turns in polar filament while the smaller polar capsule had 5 turns in polar filament. The macroscopic analysis revealed the presence of large nodules, which were located before and after the dorsal fin of the hosts. The histopathological analysis showed the development of nodules filled with plasmodia, surrounded by loose connective tissue, developed in the dermis of the skin. Many cysts containing countless spores, as well as free spores, were located in the dermis and hypodermis of the hosts, causing the disorganization of the connective tissue that is responsible for the support. This is the first record of a Henneguya species in C. modestus.