RESUMEN
Recent studies have revealed that tumor immunotherapy resistance is influenced by ADAR-mediated RNA editing, but its targets remain unelucidated. Our current study identified the poliovirus receptor (PVR) oncogene, which encodes an immune checkpoint in colorectal cancer (CRC), as a potential target for RNA editing. We performed transcriptome sequencing analysis and experimental validation in two Chinese CRC cohorts. PVR and ADAR expressions significantly increased in CRC tumors and showed positive correlations in both cohorts, coupled with upregulated PVR RNA editing in CRC tumors. Manipulation of ADAR expression by over-expression or knockdown substantially changed PVR expression and RNA editing in HTC116 CRC cells. Luciferase reporter and actinomycin D assays further revealed that RNA editing in PVR 3'-UTR could upregulate PVR RNA expression, probably by increasing the RNA stability. By increasing PVR expression, ADAR-mediate RNA editing might contribute to tumor- and immune-related gene functions and pathways in CRC. Moreover, a signature combining PVR RNA editing and expression showed promising predictive performance in CRC diagnosis in both Chinese CRC cohorts. Our findings thus highlight the importance of ADAR-mediated RNA editing in PVR up-regulation in CRC tumors and provide new insight into the application of PVR RNA editing as a novel diagnostic biomarker for CRC.
Asunto(s)
Neoplasias Colorrectales , Proteínas de Unión al ARN , Receptores Virales , Humanos , Adenosina Desaminasa/genética , Adenosina Desaminasa/metabolismo , Neoplasias Colorrectales/genética , Perfilación de la Expresión Génica , Edición de ARN/genética , Proteínas de Unión al ARN/genética , Proteínas de Unión al ARN/metabolismo , Proteínas de Punto de Control Inmunitario/genética , Proteínas de Punto de Control Inmunitario/metabolismoRESUMEN
The F11 receptor (F11R) gene encoding junctional adhesion molecule A has been associated with gastric cancer (GC) and colorectal cancer (CRC), in which its role and regulation remain to be further elucidated. Recently F11R was also identified as a potential target of adenosine-to-inosine (A-to-I) mediated by the adenosine deaminases acting on RNA (ADARs). Herein, using RNA-Seq and experimental validation, our current study revealed an F11R RNA trinucleotide over-edited by ADAR, with its regulation of gene expression and clinical significance in four GC and three CRC cohorts. Our results found an over-edited AAA trinucleotide in an AluSg located in the F11R 3'-untranslated region (3'-UTR), which showed editing levels correlated with elevated ADAR expression across all GC and CRC cohorts in our study. Overexpression and knockdown of ADAR in GC and CRC cells, followed by RNA-Seq and Sanger sequencing, confirmed the ADAR-mediated F11R 3'-UTR trinucleotide editing, which potentially disrupted an RBM45 binding site identified by crosslinking immunoprecipitation sequencing (CLIP-seq) and regulated F11R expression in luciferase reporter assays. Moreover, the F11R trinucleotide editing showed promising predictive performance for diagnosing GC and CRC across GC and CRC cohorts. Our findings thus highlight both the potential biological and clinical significance of an ADAR-edited F11R trinucleotide in GC and CRC, providing new insights into its application as a novel diagnostic biomarker for both cancers.
Asunto(s)
Adenosina Desaminasa , Neoplasias Colorrectales , Regulación Neoplásica de la Expresión Génica , Edición de ARN , Proteínas de Unión al ARN , Neoplasias Gástricas , Humanos , Adenosina Desaminasa/genética , Adenosina Desaminasa/metabolismo , Neoplasias Colorrectales/genética , Neoplasias Colorrectales/diagnóstico , Neoplasias Colorrectales/metabolismo , Neoplasias Gástricas/genética , Neoplasias Gástricas/diagnóstico , Neoplasias Gástricas/metabolismo , Proteínas de Unión al ARN/metabolismo , Proteínas de Unión al ARN/genética , Estudios de Cohortes , Regiones no Traducidas 3'/genética , Línea Celular Tumoral , Biomarcadores de Tumor/genética , Biomarcadores de Tumor/metabolismo , Masculino , FemeninoRESUMEN
We consider the preparation of matrix product states (MPS) on quantum devices via quantum circuits of local gates. We first prove that faithfully preparing translation-invariant normal MPS of N sites requires a circuit depth T=Ω(logN). We then introduce an algorithm based on the renormalization-group transformation to prepare normal MPS with an error ε in depth T=O[log(N/ε)], which is optimal. We also show that measurement and feedback leads to an exponential speedup of the algorithm to T=O[loglog(N/ε)]. Measurements also allow one to prepare arbitrary translation-invariant MPS, including long-range non-normal ones, in the same depth. Finally, the algorithm naturally extends to inhomogeneous MPS.
RESUMEN
Hematite nanoparticles commonly undergoes isomorphic substitution of Al3+ in nature, while how the Al-substitution-induced morphological change, defective structure and newly generated Al-OH sites affect the adsorption behavior of hematite for contaminants remains poorly understood. Herein, the interfacial reactions between Al-substituted hematite and Pb2+ was investigated via CD-MUSIC modeling and DFT calculations. As the Al content increased from 0% to 9.4%, Al-substitution promoted the proportion of (001) facets and caused Fe vacancies on hematite, which increased the total active site density of hematite from 5.60 to 17.60 sites/nm2. The surface positive charge of hematite significantly increased from 0.096 to 0.418 C/m2 at pH 5.0 due to the increases in site density and proton affinity (logKH) of hematite under Al-substitution. The adsorption amount of hematite for Pb2+ increased from 3.92 to 9.74 mmol/kg at pH 5.0 and 20 µmol/L initial Pb2+ concentration with increasing Al content. More Fe vacancies may lead to a weaker adsorption energy (Ead) of hematite for Pb2+, while the Ead was enhanced at higher Al content. The adsorption affinity (logKPb) of bidentate Pb complexes slightly increased while that of tridentate Pb complexes decreased with increasing Al content due to the presence of ≡ AlOH-0.5 and ≡ Fe2AlO-0.5 sites. Tridentate Pb complexes were dominant species on the surface of pure hematite, while bidentate ones became more dominant with increasing Al content. The obtained model parameters and molecular scale information are of great importance for better describing and predicting the environmental fate of toxic heavy metals in terrestrial and aquatic environments.
Asunto(s)
Aluminio , Compuestos Férricos , Plomo , Modelos Químicos , Plomo/química , Compuestos Férricos/química , Adsorción , Aluminio/química , Aluminio/análisisRESUMEN
BACKGROUND: Obesity is characterized by excessive fat accumulation in the body. Physical activity (PA) is an effective intervention to combat obesity, but the effectiveness of different PA patterns on controlling obesity is unclear. Lipid accumulation product (LAP), derived from waist circumference and triglycerides, is a novel indicator for obesity evaluation. However, the association between PA patterns (i.e., weekend warriors and regularly active) and LAP remains unexplored. This study aims to elucidate the relationship between PA patterns and LAP in US adult population. METHODS: Adult individuals with complete data on LAP, PA patterns, and other covariates from the National Health and Nutrition Examination Survey (NHANES) database (2007-2018) were included in this study. Multivariate linear regression models were utilized to explore the association between PA patterns and LAP. Subgroup analyses, interaction tests, restricted cubic spline (RCS) regression analyses, and threshold and saturation effect analyses were also performed to investigate the stability and nonlinearity of PA-LAP association, respectively. RESULTS: A total of 11,212 participants were included in this study. After adjusting for all potential covariates, being regularly active (RA) (ß=-8.85, P < 0.05) obtained significantly higher LAP reduction as opposed to being weekend warriors (WWs) (ß=-4.70, P = 0.3841). Furthermore, subgroup analyses and interaction tests indicated that the PA-LAP association was more pronounced in individuals with higher education levels (P interaction = 0.0084) and diabetes (P interaction = 0.0062). Additionally, a significant, non-linear, and negative correlation between weekly total PA and LAP in non-inactive individuals was identified by RCS analysis (P for overall < 0.001, P for nonlinearity = 0.009). A threshold of 440 min in weekly total PA was found to arouse favorable LAP reduction. CONCLUSIONS: Being regularly active obtained better LAP reduction as opposed to being WWs. For non-inactive adults, engaging in more than 440 min of PA per week helps to reduce LAP effectively.
Asunto(s)
Ejercicio Físico , Actividades Recreativas , Encuestas Nutricionales , Humanos , Masculino , Femenino , Adulto , Persona de Mediana Edad , Ejercicio Físico/fisiología , Estados Unidos , Producto de la Acumulación de Lípidos , Obesidad/prevención & control , Adulto Joven , Circunferencia de la CinturaRESUMEN
Confronting the continuing risk of an attack, security systems have adopted target-hardening strategies through the allocation of security measures. Most previous work on defensive resource allocation considers the security system as a monolithic architecture. However, systems such as schools are typically characterized by multiple layers, where each layer is interconnected to help prevent single points of failure. In this paper, we study the defensive resource allocation problem in a multilayered system. We develop two new resource allocation models accounting for probabilistic and strategic risks, and provide analytical solutions and illustrative examples. We use real data for school shootings to illustrate the performance of the models, where the optimal investment strategies and sensitivity analysis are presented. We show that the defender would invest more in defending outer layers over inner layers in the face of probabilistic risks. While countering strategic risks, the defender would split resources in each layer to make the attacker feel indifferent between any individual layer. This paper provides new insights on resource allocation in layered systems to better enhance the overall security of the system.
RESUMEN
Limited access to food stores is often linked to higher health risks and lower community resilience. Socially vulnerable populations experience persistent disparities in equitable food store access. However, little research has been done to examine how people's access to food stores is affected by natural disasters. Previous studies mainly focus on examining potential access using the travel distance to the nearest food store, which often falls short of capturing the actual access of people. Therefore, to fill this gap, this paper incorporates human mobility patterns into the measure of actual access, leveraging large-scale mobile phone data. Specifically, we propose a novel enhanced two-step floating catchment area method with travel preferences (E2SFCA-TP) to measure accessibility, which extends the traditional E2SFCA model by integrating actual human mobility behaviors. We then analyze people's actual access to grocery and convenience stores across both space and time under the devastating winter storm Uri in Harris County, Texas. Our results highlight the value of using human mobility patterns to better reflect people's actual access behaviors. The proposed E2SFCA-TP measure is more capable of capturing mobility variations in people's access, compared with the traditional E2SFCA measure. This paper provides insights into food store access across space and time, which could aid decision making in resource allocation to enhance accessibility and mitigate the risk of food insecurity in underserved areas.
RESUMEN
In kagome metal CsV_{3}Sb_{5}, multiple intertwined orders are accompanied by both electronic and structural instabilities. These exotic orders have attracted much recent attention, but their origins remain elusive. The newly discovered CsTi_{3}Bi_{5} is a Ti-based kagome metal to parallel CsV_{3}Sb_{5}. Here, we report angle-resolved photoemission experiments and first-principles calculations on pristine and Cs-doped CsTi_{3}Bi_{5} samples. Our results reveal that the van Hove singularity (vHS) in CsTi_{3}Bi_{5} can be tuned in a large energy range without structural instability, different from that in CsV_{3}Sb_{5}. As such, CsTi_{3}Bi_{5} provides a complementary platform to disentangle and investigate the electronic instability with a tunable vHS in kagome metals.
RESUMEN
Late blight and powdery mildew are two widespread tomato diseases caused by Phytophthora infestans and Oidium neolycopersici, respectively, which reduce the quantity and quality of tomato. MicroRNAs (miRNAs) play critical roles in tomato resistance to various pathogens. Investigating the function of miRNAs is of great significance in controlling tomato diseases. To identify potential miRNAs involved in the interaction of tomato with P. infestans or O. neolycopersici, we analyzed the expression profiles of small RNAs in tomato leaves infected with these two pathogens using RNA-seq technology. A total of 330 and 288 miRNAs exhibited differences in expression levels after exposure to P. infestans and O. neolycopersici, respectively. One hundred and forty-six commonly differentially expressed (DE) miRNAs responsive to P. infestans and O. neolycopersici infestation were detected, including 10 commonly known conserved DE miRNAs and 136 novel miRNAs. Among these known DE miRNAs, sly-miR397 was strongly downregulated in response to P. infestans or O. neolycopersici infection. Silencing of sly-miR397 resulted in enhanced tolerance to the pathogens, whereas overexpression of sly-miR397 showed increased susceptibility. Furthermore, changes in sly-miR397 expression could also affect expression levels of pathogenesis-related genes and reactive oxygen species-scavenging genes, leading to altered necrotic cells and H2O2 levels. In addition, the number of lateral branches significantly changed in transgenic plants. Taken together, our results provide potential miRNA resources for further research of miRNA-disease associations and indicates that sly-miR397 acts as a negative regulator of disease resistance and influences lateral branch development in tomato.
Asunto(s)
MicroARNs , Phytophthora infestans , Solanum lycopersicum , Solanum lycopersicum/genética , Phytophthora infestans/genética , Peróxido de Hidrógeno , Enfermedades de las Plantas/genética , MicroARNs/genética , MicroARNs/metabolismoRESUMEN
The adoption of behavioral nonpharmaceutical interventions (NPIs) among the public is essential for tackling the COVID-19 pandemic, yet presents challenges due to the complexity of human behaviors. A large body of literature has utilized classic game theory to investigate the population's decisions regarding the adoption of interventions, where the static solution concept such as the Nash equilibrium is studied. However, individual adoption behavior is not static, instead it is a dynamic process that involves the strategic interactions with other counterparts over time. The study of quantitatively analyzing the dynamics on precautionary behavior during an outbreak is rather scarce. This article fills the research gap by developing an evolutionary game-theoretic framework to model the dynamics of population behavior on the adoption of NPI. We construct the two-group asymmetric game, where behavioral change for each group is characterized by replicator equations. Sensitivity analyses are performed to examine the long-term stability of equilibrium points with respect to perturbation of model parameters. We found that the limiting behavior of intervention adoption in the population consists of only pure strategies in a game setting, indicating that the evolutionary outcome is that everyone either takes up the preventive measure or not. We also applied the framework to examine the mask-wearing behavior, and validated with actual data. Overall, this article provides insights into population dynamics on the adoption of intervention strategy during the outbreak, which can be beneficial for policy makers to better understand the evolutionary trajectory of population behavior.
Asunto(s)
COVID-19 , Pandemias , Humanos , Pandemias/prevención & control , COVID-19/epidemiología , COVID-19/prevención & control , Dinámica Poblacional , Evolución Biológica , Teoría del JuegoRESUMEN
We introduce plaquette projected entangled-pair states, a class of states in a lattice that can be generated by applying sequential unitaries acting on plaquettes of overlapping regions. They satisfy area-law entanglement, possess long-range correlations, and naturally generalize other relevant classes of tensor network states. We identify a subclass that can be more efficiently prepared in a radial fashion and that contains the family of isometric tensor network states [M. P. Zaletel and F. Pollmann, Phys. Rev. Lett. 124, 037201 (2020)PRLTAO0031-900710.1103/PhysRevLett.124.037201]. We also show how this subclass can be efficiently prepared using an array of photon sources.
RESUMEN
To characterize the ageing fundus degenerations in Macaca fascicularis, we used multimodal imaging including color fundus photograph, spectral domain optical coherence tomography, fundus autofluorescence, fundus fluorescence angiography, and indocyanine green angiography (ICGA) to survey and track fundus changes of 84 Macaca fascicularis, ranging from 5 to 24 years old over 2 years, and followed by hematoxylin-eosin (HE) and immunofluorescence (IF) staining. The Macaca fascicularis in our cohort showed ageing characteristics different from human, including the more common yellow dot maculopathy, the unique appearance of patchy hyperautoflurescence, and the absence of subretinal drusenoid deposit, basal laminar deposit, geographic atrophy or choroidal neovascularization. Same with human, hard drusen, soft drusen, atherosclerosis, tessellated retina, staining of vessels in peripheral choroid on late-phase ICGA, and peripheral hard drusen were detected. HE and IF staining suggested the patchy hyperautoflurescence to be drusenoid deposits. BMI were significantly higher in the Macaca fascicularis with yellow dot maculopathy and hard drusen, compared to the ones without (p < 0.05). Our study reveals fundus degenerations that develop with ageing in the nonhuman primate of Macaca fascicularis. Their differences and similarities compared to human worth notice by future translational research in degenerative fundus diseases, especially age-related macular degeneration.
Asunto(s)
Degeneración Macular , Drusas Retinianas , Envejecimiento , Animales , Angiografía con Fluoresceína/métodos , Humanos , Macaca fascicularis , Imagen Multimodal , Estudios Retrospectivos , Tomografía de Coherencia ÓpticaRESUMEN
KEY MESSAGE: The novel ZmR1CQ01 allele for maize anthocyanin synthesis was identified, and the biological function and regulatory molecular mechanisms of three ZmR1 alleles were unveiled. Anthocyanins in maize are valuable to human health. The R1 gene family is one of the important regulatory genes for the tissue-specific distribution of anthocyanins. R1 gene allelic variations are abundant and its biological function and regulatory molecular mechanisms are not fully understood. By exploiting genetic mapping and transgenic verification, we found that anthocyanin pigmentation in maize leaf midrib was controlled by ZmR1 on chromosome 10. Allelism test of maize zmr1 EMS mutants confirmed that anthocyanin pigmentation in leaf sheath was also controlled by ZmR1. ZmR1CQ01 was a novel ZmR1 allelic variation obtained from purple maize. Its overexpression caused the whole maize plant to turn purple. ZmR1B73 allele confers anthocyanin accumulation in near ground leaf sheath rather than in leaf midribs. The mRNA expression level of ZmR1B73 was low in leaf midribs, resulting in no anthocyanin accumulation. ZmR1B73 overexpression promoted anthocyanin accumulation in leaf midribs. Loss of exon 5 resulted in ZmR1ZN3 allele function destruction and no anthocyanin accumulation in leaf midrib and leaf sheath. DNA affinity purification sequencing revealed 1010 genes targeted by ZmR1CQ01, including the bz2 in anthocyanin synthesis pathway. RNA-seq analysis showed 55 genes targeted by ZmR1CQ01 changed the expression level significantly, and the expression of genes encoding key enzymes in flavonoid and phenylpropanoid biosynthesis pathways were significantly up-regulated. ZmR1 functional molecular marker was developed. These results revealed the effects of transcriptional regulation and sequence variation on ZmR1 function and identified the genes targeted by ZmR1CQ01 at the genome-wide level.
Asunto(s)
Antocianinas , Zea mays , Alelos , ADN , Regulación de la Expresión Génica de las Plantas , Pigmentación/genética , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , ARN Mensajero , Zea mays/genética , Zea mays/metabolismoRESUMEN
Pleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P. pulmonarius, growing in a mushroom farm in Nanning, China. Initially, white blotch (0.7-1.6 cm) appeared on the cap of the young P. pulmonarius, which expanded gradually as the cap grew. However, the fruiting bodies still grew well without rotting. The pathogen causing this phenomenon was isolated from infected cap tissues using a dilution plate technique, sections of tissue (approximately 5×5×5 mm) with white blotch were rinsed three times in sterile deionized water, then, mashed in the sterile 2 ml eppendorf tubes, 1000µl sterile water was added and the suspension was diluted into eight concentrations (10-1~10-8). From each concentration, 120µl suspension was spread on Luria Bertani (LB) medium and incubated for 24 hours at 28°C. Both 10-5 and 10-6 suspensions had single colonies, the dominant single colonies were picked and purified 2-3 times. The purified colonies were round, beige, and opaque, with a raised center and regular, smooth and moist margins. This bacterium is gram negative, short rod-shaped, single polar flagellum, motile, without pods or endospores, and produced fluorescent pigments on King's B medium. Amplified 16S rDNA (1396 bp; OM022022) of four randomly selected colonies using universal primers 27f/1492r, exhibited 100% identity with Pseudomonas (Ps.) mosselii. The partial sequences of the rpoB (1173bp; OM202622), rpoD (734bp; ON469579), gyrB (1383bp; OM202621) and recA (887bp; ON469580) genes of four selected colonies were amplified using primers LAPS5/LAFS27(Tayeb et al. 2005.), PsEG30F/PsEG790R (Mulet et al. 2009), gyrB-R/gyrB-F (Agaras et al. 2018) and recA-F (5'-3' ACGACAACAAGAAGCGCGCCTT)/recA-R (5'-3' CAATGGCCGGGTTCTCTTGCAGGTA) designed in this study, respectively, also exhibited 99%~100% similarities to Ps. mosselii. Phylogenetic analysis showed that isolates cluster with Ps. mosselii. The biochemical tests for isolates were performed via bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent Co., LTD), and the results showed the same biochemical characteristics as Ps. mosselii (Positive for arginine dihydrolase, trisodium citrate, urea, lysine, arginine, ornithine and gelatin. Negative for glucosamine, lactose, galactose, rhamnose, maltose, sucrose, arabinose, mannose, xylose, esculoside, inositol, nitrate reduction and malonate) (Dabboussi et al.2002; Soto-Rodriguez et al. 2013). The isolates were identified as Ps. mosselii based on biochemical tests and phylogenetic analysis. This isolate was incubated in LB Broth at 28â, 160 rpm for 24h and the bacterial cells were collected by centrifugation at 4000 rpm for 10min. The collected bacterial cells were resuspended in sterile deionized water to make a bacterial suspension. For pathogenicity tests, 30µl of bacterial suspension (approximately 1x10^9 CFU/mL) was added to the surface of the cap (3-4cm) of young P. pulmonarius. Sterile deionized water was added as a negative control. All treatments were incubated at 22°C and 80-85% humidity. The experiment was repeated three times with three bags each time. 12 h later, white blotches were visible on all parts of the inoculated mushroom. This disease symptoms were similar to those observed in the original samples. However, no disease phenomena were observed in the negative control group. After the pathogenicity test, we obtained the same pathogen as the initially isolates from infected tissues based on morphological characteristics, 16S rDNA sequences, rpoB, rpoD, gyrB and recA sequences, and biochemical test results. Ps. mosselii was first isolated clinically and described by Dabboussi et al. (2002). It has shown to be pathogenic to Oreochromis niloticus and humans (Soto-Rodriguez et al. 2013; Peña et al. 2019; Leneveu-Jenvrin et al. 2013; Huang et al. 2018.). However, to the best of our knowledge, this is the first report of Ps. mosselii causing white blotch disease in P. pulmonarius worldwide, which negatively affects the commercial value of P. pulmonarius and requires attention of mushroom industry.
RESUMEN
Th17 cells remain one of the most important subsets of T cells in numerous autoimmune and chronic inflammatory diseases. Posttranscriptional regulation (PTR), especially mRNA stability, has recently emerged as an important mechanism that controls the fate of Th17 cells. This review summarizes the current knowledge on RNA-binding proteins (RBPs), microRNAs (miRNAs) and long non-coding RNAs (lncRNAs) that induce mRNA stability changes and their roles in mediating the differentiation, proliferation, function, and migration of Th17 cells. In addition, we summarize the role of RNA modifications and nonsense-mediated mRNA decay (NMD) in Th17 cells. Ongoing research will help to identify practical applications for the regulation of mRNA stability and provide potential targets to prevent and treat Th17-related autoimmune diseases.
Asunto(s)
Enfermedades Autoinmunes/genética , Estabilidad del ARN/genética , ARN Largo no Codificante/fisiología , ARN Mensajero/metabolismo , Proteínas de Unión al ARN/fisiología , Animales , Enfermedades Autoinmunes/inmunología , Enfermedades Autoinmunes/metabolismo , Humanos , ARN Mensajero/genética , Células Th17/inmunología , Células Th17/metabolismoRESUMEN
Dendritic cells (DCs) form a sentinel network to induce protective immunity against pathogens or self-tolerance. mRNA stability is an important part of the post-transcriptional regulation (PTR) that controls the maturation and function of DCs. In this review, we summarize the effects of TTP-mediated regulation of mRNA stability in DCs, focusing on DC maturation and antigen presentation, T cell activation and differentiation, immune tolerance and inflammation. We also discuss the potential DC-based immune treatment for HIV+ patients through regulation of mRNA stability. This review proposes the regulation of mRNA stability as a novel immune therapy for various inflammatory diseases, such as arthritis and dermatitis.
Asunto(s)
Células Dendríticas/metabolismo , Infecciones por VIH/inmunología , ARN Mensajero/química , Tristetraprolina/metabolismo , Inmunidad Adaptativa , Presentación de Antígeno , Infecciones por VIH/genética , Humanos , Tolerancia Inmunológica , Estabilidad del ARNRESUMEN
BACKGROUND: Excess energy intake contributes to metabolic disorders. However, the relationship between excess sugar and fat in their contributions to metabolic abnormalities remains to be further elucidated. Here we conducted a prospective feeding experiment to evaluate effects of dietary fat-to-sugar ratio on diet-induced metabolic abnormalities in adult cynomolgus monkeys. METHODS: Four groups of adult cynomolgus monkeys were fed regular chow plus emulsion with combinations of high sugar (HS) or low sugar (HS) and low fat (LF) or high fat (HF) for 7 months. Plasma levels of total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), triglyceride (TG) and blood glucose were measured for all the four groups of animals during the experiment. RESULTS: Plasma levels of TC and LDL-C gradually increased in all 4 diets groups, with the highest increase found in the LSHF group compared to the other three groups (P = 0.0018 and P = 0.0005 respectively). HF induced increased fasting glucose (P = 0.0077) and HS induced higher TG (P = 0.0227) respectively. Intriguingly, HSHF led to dramatically smaller magnitude of increase in LDL-C and TC levels compared to LSHF, while such difference was absent between the LSLF and LSHF groups. Our findings thus indicate interactive effects of HS and HF on TC and LDL-C. In addition, HF exhibited stronger effects on lipid abnormalities than HS. CONCLUSIONS: In the current study, our prospective feeding experiment in adult cynomolgus monkeys revealed effects of different fat-to-sugar ratios on diet-induced metabolic abnormalities. Furthermore, our findings suggest that not only excess dietary energy but also the balance of dietary fat-to-sugar ratio matters in diet-induced lipid abnormalities.
Asunto(s)
Carbohidratos de la Dieta , Grasas de la Dieta , Azúcares , Animales , Femenino , Masculino , Administración Oral , Glucemia/metabolismo , HDL-Colesterol/sangre , LDL-Colesterol/sangre , Carbohidratos de la Dieta/administración & dosificación , Grasas de la Dieta/administración & dosificación , Macaca fascicularis , Estudios Prospectivos , Azúcares/administración & dosificación , Triglicéridos/sangreRESUMEN
Quantum coherence is the most distinguished feature of quantum mechanics. It lies at the heart of the quantum-information technologies as the fundamental resource and is also related to other quantum resources, including entanglement. It plays a critical role in various fields, even in biology. Nevertheless, the rigorous and systematic resource-theoretic framework of coherence has just been developed recently, and several coherence measures are proposed. Experimentally, the usual method to measure coherence is to perform state tomography and use mathematical expressions. Here, we alternatively develop a method to measure coherence directly using its most essential behavior-the interference fringes. The ancilla states are mixed into the target state with various ratios, and the minimal ratio that makes the interference fringes of the "mixed state" vanish is taken as the quantity of coherence. We also use the witness observable to witness coherence, and the optimal witness constitutes another direct method to measure coherence. For comparison, we perform tomography and calculate l_{1} norm of coherence, which coincides with the results of the other two methods in our situation. Our methods are explicit and robust, providing a nice alternative to the tomographic technique.
RESUMEN
OBJECTIVE: To investigate the prevalence and intra-oral distribution of dentine hypersensitivity (DH) and to evaluate the related risk factors. MATERIAL AND METHODS: A total of 1320 subjects, aged between 20 and 69 years old, were selected from six communities in the urban areas of Xi'an, China. The data were collected by conducting individual interviews using a standard questionnaire; then, the clinical examination was performed for patients who reported about the discomforts they felt in their teeth when subjected to chemical, mechanical and thermal stimuli. Dentine hypersensitivity (DH) was diagnosed by a subject short, sharp pain in response to a blast of cold air from a triple syringe. RESULTS: While replying to the questionnaire, 445 subjects reported about signs of discomfort in the teeth. DH was diagnosed in 336 persons by clinic examination. Thus, the overall prevalence of DH was 33.7% in the questionnaire and 25.5% in the intraoral test. The prevalence of DH was higher in females (33.8%) than in males (22.2%). Furthermore, we found that the prevalence of DH was highest in the age group of 50-59 years (39.3%). The most common initiation factors were acid (37.7%) followed by cold stimuli (35.8%). In general, most subjects with sensitive teeth had a higher educational background. CONCLUSIONS: The prevalence of DH was 25.5% in the population of Xi'an City in China. More emphasis should give to middle-aged and old females while planning oral health intervention campaigns. In addition, premolars and cervical surfaces should be examined for the prevention of DH.
Asunto(s)
Sensibilidad de la Dentina/epidemiología , Higiene Bucal/estadística & datos numéricos , Adulto , Factores de Edad , Anciano , China/epidemiología , Femenino , Humanos , Masculino , Persona de Mediana Edad , Examen Físico/estadística & datos numéricos , Prevalencia , Encuestas y Cuestionarios , Población Urbana/estadística & datos numéricos , Adulto JovenRESUMEN
BACKGROUND: Early childhood caries (ECC) is a serious public health problem in China. Few studies, however, have described the incidence of ECC in China. The purpose of this study was to assess the prevalence and incidence of ECC among preschool children in Wenzhou China. METHODS: Preschool children aged 3-4 years old were surveyed and followed up when they reached 5-6 years of age in the city of Wenzhou in southeast China. The rates of dental caries were determined with prevalence, and incidence density for risk of caries of a person (IDp) and of a tooth surface (IDs). RESULTS: The prevalence and decayed, missing, and filled primary teeth (dmft) score of 3-4, 4-5, and 5-6 years old children were 59.8% and 2.9, 71.8% and 4.2, and 76.4% and 4.6, respectively. The IDp was 29.7 and 14.8 persons/100 person-year during the first and second year. The IDs was 5.9 and 2.7 newly affected surfaces/100 surface-year, respectively. The percentage of molars with caries experience increased obviously; the percentage of maxillary central incisors and mandibular incisors with caries experience increased during the first follow-up, whereas it declined during the second follow-up; the others increased gradually. CONCLUSIONS: The prevalence and incidence of dental caries in Wenzhou preschool children were very high with most of the carious teeth left untreated. The molars were the most affected teeth during the observation period.