[Comparative analysis of mono- and bipolar pyramidal tract mapping in patients with supratentorial tumors adjacent to motor areas: comparison of data at 64 stimulation points]. / Sravnitel'nyi analiz potochechnogo mono- i bipolyarnogo kartirovaniya piramidnogo trakta u patsientov s supratentorial'nymi opukholyami, prilezhashchimi k motornym zonam golovnogo mozga: sravnenie dannykh v 64 tochkakh stimulyatsii.

OBJECTIVE: To compare monopolar and bipolar mapping in point-by-point fashion by using of threshold amperage, frequency of positive motor responses and the number of muscles involved in response. MATERIAL AND METHODS: A prospective non-randomized study included 14 patients with supratentorial tumors who underwent surgery in 2018-2019. All neoplasms were localized within 2 cm from the motor cortex and pyramidal tract. Age of patients ranged from 25 to 74 years. There were 9 women and 5 men. Eight patients had malignant glioma (grade III - 4, grade IV - 4), 6 patients - meningioma. Motor functions were assessed in all patients before and after surgery (1, 7 days and 3 months later) by using of a 5-point scale. In addition to routine neurophysiological monitoring, comparative mono- and bipolar mapping of the pyramidal tract within the bed of excised tumor was carried out at the end of surgery. The points of motor responses were marked. Comparative analysis of mono- and bipolar stimulation at identical points included threshold amperage, frequency of positive motor responses and the number of muscles involved in response (leg, forearm, hand, facial muscles). Brain MRI was performed in early postoperative period for assessment of resection quality. RESULTS: There were 64 points of motor responses in 14 patients. The number of these points ranged from 2 to 8 per a patient (mean 5 points). Motor responses were recorded in 57 points during monopolar and bipolar stimulation, in other 7 points - only during monopolar stimulation. Amperage of monopolar stimulation was 3-15 mA, bipolar stimulation - 2.5-25 mA. Threshold amperage (7.37 mA for monopolar stimulation and 8.88 mA for bipolar stimulation; p=0.12), frequency of positive motor responses and the number of muscles involved in response (p=0.1 and p=0.73) were similar. Seven (50%) patients had neurological deterioration in early postoperative period (4 patients with glial tumors and 3 patients with meningiomas). At the same time, only 2 patients (14.3%) had persistent neurological deficit (both patients with infiltrative meningioma). According to postoperative MRI in T1+C mode, resection volume was 100% in 1 patient with contrast-enhanced glioma and 94% in another one. According to FLAIR MRI data, resection volume exceeded 70% in 2 patients with non-enhancing glioma and less than 70% in 2 patients. Meningioma resection volume was estimated according to postoperative T1+C MRI data and made up over 90% in 4 patients. CONCLUSION: Monopolar stimulation is a reliable method of pyramidal tract identification in supratentorial brain tumor surgery.

Overproduction of the EcoRII endonuclease and methylase by Escherichia coli strains carrying recombinant plasmids constructed in vitro.

Recombinant DNA molecules were constructed from the plasmid pIL203 and the EcoRI-fragment of N3 plasmid containing EcoRII endonuclease and methylase genes and also a gene for resistance to sulfanilamide. The pIL203 plasmid, used as a vector, consisted of the Bam HI-EcoRI-fragment of the plasmid pBR322 conferring resistance to ampicillin and the Bam HI-EcoRI-fragment of lambda phage containing promoters, a thermosensitive mutation in the cI gene and a suppressible amber mutation in the cro gene. Ampicillin-sulfanilamide-resistant clones were selected and tested for their restriction and modification phenotype. The recombinant plasmid DNA, isolated from ApRSuR-resistant clones, which restricted and modified phage lambda imm21 with EcoRII specificity, had the EcoRI-fragment with EcoRII genes in a single orientation. The recombinant plasmid pSK323 was transferred into E. coli strains with su-, su1, su2 or su3 phenotypes. The synthesis of products of EcoRII genes by these strains grown at 37 degrees C is increased by 10--50-fold.

The nucleotide sequence of bacteriophage T5 glutamine transfer RNA.

Uniformly 32P-labeled phage-specific tRNAGln has been isolated from bacteriophage T5-infected Escherichia coli cells and its nucleotide sequence has been determined using thin-layer chromatography on cellulose to fractionate the oligonucleotides. The sequence is: pUGGGGAUUAGCUUAGCUUGGCCUAAAGCUUCGGCCUUUGAAG psi CGAGAUCAUUGGT psi CAAAUCCAAUAUCCCCUGCCAOH. The main feature of this tRNA is the absence of Watson-Crick pairing between the 5'-terminal base and the fifth base from its 3'-end. The structure of tRNA was confirmed by DNA sequencing of its gene.

Cloning of genes for bacteriophage T5 stable RNAs.

One EcoRI-generated fragment (440 basepairs) and two EcoRI/HindIII fragments (220 and 960 basepairs) from the deletion region of T5 phage have been inserted into the phage lambda XIII and the plasmid pBR322 as vectors. Recombinant DNA molecules were studied by hybridization with in vivo 32P-labeled T5 4-5 S RNAs on nitrocellulose filters. Two-dimensional polyacrylamide gel electrophoretic fractionation and fingerprint analysis of the RNAs eluted from the filters were carried out to identify RNAs coded by cloned fragments. For the accurate localization of the genes for these RNAs, RNA-DNA hybrids were treated with T1 and pancreatic RNAases, and the eluted RNA fragments stable against RNAase action were electrophoresed. It was shown that the EcoRI 440 fragment contains the gene for tRNA 10 (tRNAAsp), the EcoRI/HindIII 220 fragment contains the gene for RNA III (107 bases) and parts of the genes for RNA I (107 bases) and tRNA 12 (tRNAHis), and the EcoRI/HindIII 960 fragment contains only a part of the gene for tRNA 9 (tRNAGln). The arrangement of these genes on the physical map of T5 phage was as follows: -tRNAGln-tRNAHis-RNA III-RNA I-...-tRNAAsp.

Lambda phagemids and their transducing properties.

Two recombinant lambda DNAs, lambda gt::pMB9 and lambda NM::pBR322, containing, respectively, the pMB9 and pBR322 replicon were constructed and characterized. Both constructs (phagemid DNAs) transfect Escherichia coli cells, producing mature infectious phage progenies. Alternatively, drug-resistant colonies of transductants can be selected upon infection with these phages (phagemid particles) that maintain phagemid DNA in the cell in the form of covalently closed circular plasmids. The efficiency of transduction for nonlysogenic E. coli strains with lambda gt::pMB9 phage producing lambda repressor cIts ranges from 10(-7) to 10(-2) transductant colonies per input phage, depending on the temperature and strain used, while lambda NM::pBR322 phage carrying imm21 transduces with a frequency of up to 1. This means that each lambda NM::pBR322 phagemid particle is capable of establishing itself in the cell as a nonlethal plasmid, permitting formation of a resistant bacterial colony. The maximal level of transduction with lambda gt::pMB9 was obtained when E. coli cells lysogenic for lambda were used. Thus, we believe that the efficiency of transduction is determined by the turn-on of the phage repressor in the transductant. In addition, we have found that all lambda gt::pMB9-containing transductants under certain conditions harbor precisely excised pMB9; excision of pBR322 from lambda NM::pBR322 has not been observed.

The primary structure of the operons coding for Shigella dysenteriae toxin and temperate phage H30 shiga-like toxin.

Nucleotide(nt) sequences were determined for the toxin (SHT) operon present in the chromosome of Shigella dysenteriae 1 and for the shiga-like toxin (SLT) operon found in the lambdoid phage H30 genome. The coding sequences of the sht and slt genes differ in 4 nt with 1 nt change responsible for an amino acid replacement. The deduced amino acid sequence in the A chain of the toxins is highly homologous to that of the A chain of ricin, a plant toxin. SHT-coding mRNAs were detected by mapping the 5' termini and using blot-hybridisation; one of them was more abundant and coded only for the B subunit of SHT while the other (bi-cistronic mRNA) encoded both subunits. An IS element related to the IS3 element of Escherichia coli was found in the chromosome of S. dysenteriae near the sht operon.

Identification of bacterial clones encoding bovine caseins by direct immunological screening of the cDNA library.

A sensitive immunoassay was used to identify recombinant plasmids carrying cDNA fragments of bovine caseins in the cDNA library from bovine mammary gland mRNA. Colonies grown on nitrocellulose filters were lysed in situ and proteins from the lysates were blotted onto CNBr-activated cellulose filter paper. Antigens covalently bound to CNBr-activated paper or bound to nitrocellulose filters were detected by reaction with antiserum to caseins, followed by 125I-labelled Staphylococcus aureus protein A and autoradiography. Six clones were found positive among 5400 of the cDNA library: 3-A1, 3-B2, 3-B5, 3-H7, 2-A5 and 2-C9. The molecular weights of chimeric pre-beta-lactamase: casein proteins synthesized in Escherichia coli were estimated by immunoblotting. Colony hybridization and nucleotide sequence analysis showed that clone 3-B5 contained a cDNA fragment of bovine chi-casein, clone 3-H7 contained a cDNA fragment of beta-casein, while clones 2-A5 and 2-C9 carried cDNA fragments of alpha s1-casein.

Primary structure of an EcoRI fragment of lambda imm434 DNA containing regions cI-cro of phage 434 and cII-o of phage lambda.

Digestion of phage lambda imm434 DNA with restriction endonuclease EcoRI yields 7 fragments. The shortest among them (1287 bp) contains the right part of the phage 434 immunity region and the phage DNA portion proximal to it. The complete primary structure of this fragment has been determined using the chemical method of DNA sequencing. Hypothetical amino-acid sequences of proteins coded by the cro gene of phage 434 and the cII gene of phage lambda, as well as NH2-terminal amino-acid sequences of the cI protein of phage 434 and the O protein of phage lambda, have been deduced solely on the basis of the DNA sequence. The fragment studied contains also the pR and probably prm promoters and the oR operator of phage 434. The sequence coding for them differs from the respective DNA sequence of phage lambda.

Cloning and DNA sequence of the 5'-exonuclease gene of bacteriophage T5.

The nucleotide sequence of the BalI-PstI fragment of T5 DNA, 1347 bp in length, coding for 5'-exonuclease (D15 gene), has been determined. A coding region of the gene contains 873 bp and is preceded by a typical Shine-Dalgarno sequence. The D15 gene belongs to a cluster, consisting of at least 3 genes, in which a termination codon of a preceding gene overlaps an initiation codon of the following one. The sequence contains an open reading frame for 291 amino acid residues. The molecular mass of the 5'-exonuclease calculated from the predicted amino acid sequence is 33 400 Da.

The nucleotide sequence of bacteriophage T5 leucine tRNA.

Uniformly 32P-labeled bacteriophage T5 leucine tRNA has been isolated by two-dimensional gel electrophoresis from phage-infected E. coli cells. Its nucleotide sequence has been determined by conventional techniques using TLC on cellulose for oligonucleotide fractionation: pGGGGCUAUGCUGGAACDGmGDAGACAAUACGGCCUUAGm6AU psi CCGUAGCUUAAAUGCGUGGGAGT psi CGAGUCUCCCUAGCCCCACCAoh. This tRNA has anticodon sequence UAG, which can presumably recognize all the four leucine-specific codons (CUN). The main feature of T5 tRNALeu is the absence of the A10-C25 and C31-psi 39 pairing in the D and anticodon stems, respectively.

Cloning and DNA sequence of the genes for two bacteriophage T5 tRNAsSer.

Bacteriophage T5 Bg/II/Hind III DNA fragment (803 basepairs), containing the genes for 2 tRNAs and 2 RNAs with unknown functions, was cloned in the plasmid pBR322. The analysis of DNA sequence indicates that tRNA genes code isoacceptor tRNAsSer (tRNA1Ser and tRNA2Ser) with anticodons UGA and GGA, respectively. The main unusual structural feature of these tRNAs is the presence of extra non-basepaired nucleotides in the joinings of stem 'b' with stems 'a' and 'c'.

NMR studies of DNA recognition sequences and their interaction with proteins. The phage lambda OR1 operator, a symmetric lac operator and their specific complexes with cro protein and lac repressor "headpiece".

The phage lambda operator OR1 and a 18 base pair symmetric lac operator have been studied by high resolution NMR. The imino proton resonances and the resonances of the unexchangeable protons (except the 5' and 5" sugar proton resonances) have been assigned by one- and two-dimensional NOE techniques. The imino proton resonances of OR1 and the symmetric lac operator have been used to monitor changes induced in the operator structure by the formation of a specific complex with the phage lambda cro protein and with the lac repressor N-terminal DNA binding domain ("headpiece"). Two regions within the OR1 sequence could be identified, where changes in the imino proton resonance positions occur: The central part around base pairs CG 9 and 10 and the region around base pairs AT 5 and CG 5. The TA base pair 6 is the only position in the symmetric lac operator, where the complex formation with headpiece induces a change.