RESUMO
Shigella flexneri 4a caused sustained outbreaks in a large long-stay psychiatric centre, Taiwan, 2001-2006. Trimethoprim-sulphamethoxazole (SXT) prophylaxis was administered in 2004. We recovered 108 S. flexneri 4a isolates from 83 symptomatic (including one caregiver) and 12 asymptomatic subjects (11 contacts, one caregiver). The isolates were classified into eight antibiogram types and 15 genotypes (six clusters) by using antimicrobial susceptibility testing and pulsed-field gel electrophoresis of NotI-digested DNA, respectively. These characteristics altered significantly after SXT prophylaxis (P < 0·05), with concomitant emergence of SXT-resistant isolates in two antibiogram types. P01 (n = 71), the predominant epidemic genotype, caused infection in two caregivers and five patients under their care; two P01 isolates were recovered from the same patient 6 months apart. These results indicate the importance of sustained person-to-person transmission of S. flexneri 4a by long-term convalescent, asymptomatic or caregiver carriers, and support the emergence of SXT-resistant strains following selective pressure by SXT prophylaxis.
Assuntos
Antibacterianos/farmacologia , Antibioticoprofilaxia , Farmacorresistência Bacteriana/genética , Disenteria Bacilar/epidemiologia , Shigella flexneri/classificação , Combinação Trimetoprima e Sulfametoxazol/farmacologia , DNA Bacteriano/genética , Surtos de Doenças , Disenteria Bacilar/microbiologia , Disenteria Bacilar/prevenção & controle , Disenteria Bacilar/transmissão , Eletroforese em Gel de Campo Pulsado , Genótipo , Humanos , Assistência de Longa Duração , Testes de Sensibilidade Microbiana , Epidemiologia Molecular , Shigella flexneri/genética , Shigella flexneri/isolamento & purificação , Taiwan/epidemiologiaRESUMO
Klebsiella pneumoniae-caused liver abscess (KLA) is an emerging infectious disease. However, factors other than K1-specific loci that contribute to the pathogenesis of this disease have not been identified. pLVPK is a 219,385-bp plasmid of K. pneumoniae CG43, an invasive K2 strain associated with KLA. We aimed in this study to evaluate the involvement of pLVPK in K. pneumoniae virulence and its clinical significance in abscess formation. A pLVPK-cured CG43 was isolated and its virulence was examined in a mouse model. The prevalence of pLVPK-derived loci terW, iutA, rmpA, silS, and repA was investigated in 207 clinical isolates by screening with specific primers. Loss of pLVPK abolished the ability of K. pneumoniae to disseminate into extraintestinal sites and, consequently, attenuated abscess formation in mice. Primary K. pneumoniae abscess isolates (n = 94) were more likely to be terW (+)-iutA (+)-rmpA (+)-silS (+) than those related to non-abscess infections (n = 113) (62% vs. 27%; p < 0.0001). Logistic regression analysis indicated that the presence of the terW-rmpA-iutA-silS loci was a significant risk factor (odds ratio, 4.12; 95% confidence interval, 2.02-8.4; p < 0.0001) for abscess formation. pLVPK is a determinant for K. pneumoniae virulence and infection with strains carrying the pLVPK-derived terW-rmpA-iutA-silS loci may predispose patients to abscess formation.
Assuntos
Proteínas de Bactérias/genética , Infecções por Klebsiella/microbiologia , Klebsiella pneumoniae/genética , Klebsiella pneumoniae/patogenicidade , Abscesso Hepático/microbiologia , Plasmídeos/análise , Fatores de Virulência/genética , Animais , Modelos Animais de Doenças , Feminino , Humanos , Klebsiella pneumoniae/isolamento & purificação , Masculino , Camundongos , Pessoa de Meia-Idade , Deleção de SequênciaRESUMO
Salmonella Schwarzengrund is one of the infective Salmonella serotypes for humans and food animals, such as poultry and swine. Because consumption of foods containing salmonellae due to cross contamination or inadequate cooking may lead to human salmonellosis, in this report, the prevalence of Salmonella Schwarzengrund contamination in chicken meat samples purchased from different traditional marketplaces in Taiwan between 2000 and 2006 was investigated. In addition, 228 Salmonella Schwarzengrund strains isolated from these chicken meat samples and 30 human isolates obtained between 2004 and 2006 were compared for their antimicrobial susceptibility. Results showed that the prevalence of Salmonella Schwarzengrund contamination in raw chicken meat samples was 30.5%. Of all of the Salmonella isolates from chicken meat, Salmonella Schwarzengrund accounted for 39.3%. On the other hand, of the total Salmonella strains isolates from humans between 2004 and 2006, Salmonella Schwarzengrund accounted for 2.8%. All these chicken meat isolates and human isolates were multidrug-resistant and demonstrated high resistance to ampicillin, gentamicin, kanamycin, streptomycin, tetracycline, nalidixic acid, trimethoprim-sulfamethoxazole, and chloramphenicol. For gentamicin and kanamycin, however, the resistance gradually declined. The antibiogram study may indicate the abuse of some antibiotics for both humans and chickens. Also, transmission of Salmonella Schwarzengrund strains between humans and food of animal origin is possible.
Assuntos
Antibacterianos/farmacologia , Farmacorresistência Bacteriana , Carne/microbiologia , Infecções por Salmonella/microbiologia , Salmonella/efeitos dos fármacos , Animais , Galinhas , Humanos , TaiwanRESUMO
AIMS: Some Geobacillus species have highly similar 16S rRNA gene sequences, making 16S rDNA sequence analysis-based identification problematic. To overcome this limitation, recA and rpoB sequence analysis was evaluated as an alternative for distinguishing Geobacillus species. METHODS AND RESULTS: The phylogram of 16S rRNA gene sequences inferred from the neighbour-joining method showed that nine clusters of Geobacillus species were characterized with bootstrap values >90%. The recA and rpoB sequences of 10 reference strains in clusters V, VIb and VIc were amplified and sequenced using consensus primers. Alignment of recA sequences in clusters V, VIb and VIc revealed three types of recA genes, consistent with the putative amino acid sequences and in vivo recA splicing analysis. The phylogram constructed from rpoB sequences showed more divergence than that constructed from 16S rRNA gene sequences. CONCLUSIONS: recA and rpoB sequence analysis differentiated closely-related Geobacillus species and provided direct evidence for reclassifying some species dubiously categorized as Geobacilli. Additionally, this study revealed three types of recA genes in the different Geobacillus species. SIGNIFICANCE AND IMPACT OF THE STUDY: This study highlights the advantage of recA and rpoB sequence analysis to supplement 16S rRNA gene sequence analysis for efficient and convenient determination of Geobacillus species.
Assuntos
Proteínas de Bactérias/genética , Genes Bacterianos , Geobacillus/classificação , Reação em Cadeia da Polimerase/métodos , Primers do DNA/genética , DNA Bacteriano/análise , RNA Polimerases Dirigidas por DNA/genética , Geobacillus/genética , Geobacillus/isolamento & purificação , Dados de Sequência Molecular , Filogenia , RNA Ribossômico 16S/genética , Recombinases Rec A/genética , Análise de Sequência de DNARESUMO
AIMS: In this study, three facile repetitive-sequence PCR (rep-PCR) techniques have been compared with the pulsed-field gel electrophoresis (PFGE) method for differentiating the genetic relatedness of clinical Stenotrophomonas maltophilia isolates. METHODS AND RESULTS: The dendrograms of 20 S. maltophilia isolates were constructed based on the data obtained from PFGE and three PCR-based methods, i.e. enterobacterial repetitive intergenic consensus-PCR (ERIC-PCR), BOX-PCR and repetitive extragenic palindromic-PCR (REP-PCR). When compared with PFGE, ERIC-PCR displayed a much lower discriminatory power, whereas BOX-PCR and REP-PCR had a comparable discriminatory power for close genetic-related isolates. CONCLUSION: BOX-PCR and REP-PCR can be convenient and effective methods for evaluating the close genetic relatedness of clinical S. maltophilia isolates. SIGNIFICANCE AND IMPACT OF THE STUDY: A rapid method for determining S. maltophilia's close genetic relatedness provides a convenient tool for understanding the epidemiology of S. maltophilia.
Assuntos
Técnicas de Tipagem Bacteriana , Impressões Digitais de DNA , DNA Bacteriano/genética , Eletroforese em Gel de Campo Pulsado , Reação em Cadeia da Polimerase , Stenotrophomonas maltophilia/classificação , Stenotrophomonas maltophilia/genética , Análise por Conglomerados , Genótipo , Infecções por Bactérias Gram-Negativas/microbiologia , Humanos , Sequências Repetitivas de Ácido Nucleico , Stenotrophomonas maltophilia/isolamento & purificaçãoRESUMO
Salmonella spp. is a foodborne pathogen that causes zoonotic disease worldwide. The aim of this study was to investigate the prevalence of antimicrobial resistance of Salmonella isolated from turkey farms in Taiwan. During the past 2 yr, 243 strains of Salmonella were isolated from 2,040 samples (11.9%) from turkey farms, including 32.5% (52/160) from the intestines of 12-day-old turkey poults, 14.2% (119/840) from feces collected from the turkey growing periods, and 6.9% (72/1,040) from finishing periods. S. Albany (35.0%, 85/243), S. Schwarzengrund (23.0%, 56/243), and S. Hadar (19.3%, 47/243) were the most common serovars on turkey farms. For these strains, a high frequency of resistance was observed against florfenicol (97.5%), oxytetracycline (89.3%), doxycycline (78.6%), colistin (77.8%), ampicillin (75.7%), amoxicillin (75.3%), trimethoprim-sulfamethoxazole (73.7%), chloramphenicol (69.1%), and nalidixic acid (67.9%). floR (63.8%), tet (A) (60.5%), blaPSE (57.6%), blaTEM (42.0%), blaCTX-M (34.2%), cmlA (34.2%), and tet (D) (29.2%) were the most common resistance genes found in this study. The int1 gene was identified in 72.4% (176/243) of Salmonella isolates in which the conserved region 3' of class 1 integrons also was amplified, whereas none had the int2 gene. This study demonstrates that imported and fattening turkeys could be a reservoir for Salmonella isolates resistant to multiple antimicrobials. These results also reinforce the need to develop strategies and implement specific control procedures to reduce the development of antimicrobial resistance.
Assuntos
Farmacorresistência Bacteriana Múltipla , Doenças das Aves Domésticas/epidemiologia , Salmonelose Animal/epidemiologia , Salmonella/efeitos dos fármacos , Salmonella/fisiologia , Animais , Antibacterianos/farmacologia , Doenças das Aves Domésticas/microbiologia , Prevalência , Salmonelose Animal/microbiologia , Sorogrupo , Taiwan/epidemiologia , PerusRESUMO
Ciprofloxacin-resistant shigellosis outbreaks among men who have sex with men (MSM) have not been reported in Asia. During 3 March to 6 May 2015, the Notifiable Disease Surveillance System detected nine non-imported Shigella sonnei infections among human immunodeficiency virus (HIV) -infected Taiwanese MSM. We conducted a molecular epidemiological investigation using a 1 : 5 matched case-control study and laboratory characterizations for the isolates. Of the nine patients, four reported engagement in oral-anal sex before illness onset. Shigellosis was associated with a syphilis report within 12 months (adjusted odds ratio (aOR) 8.6; 95% CI 1.05-70.3) and no HIV outpatient follow-up within 12 months (aOR 22.3; 95% CI 2.5-201). Shigella sonnei isolates from the nine patients were all ciprofloxacin-resistant and the resistance was associated with S83L and D87G mutations in gyrA and S80I mutation in parC. The nine outbreak isolates were discriminated into two closely related pulsed-field gel electrophoresis (PFGE) genotypes and seven 8-locus multilocus variable-number tandem repeat analysis (MLVA8) types that suggest multiple sources of infections for the outbreak and possible under-recognition of infection among Taiwanese MSM. The outbreak isolates were characterized to be variants of the intercontinentally transmitted SS18.1 clone, which falls into the globally prevalent phylogenetic sub-lineage IIIb. Inter-database pattern similarity searching indicated that the two PFGE genotypes had emerged in the USA and Japan. The epidemiological characteristics of this outbreak suggest roles of risky sexual behaviours or networks in S. sonnei transmission. We urge enhanced surveillance and risk-reduction interventions regionally against the interplay of HIV and shigellosis among MSM.
Assuntos
Antibacterianos/farmacologia , Ciprofloxacina/farmacologia , Surtos de Doenças , Farmacorresistência Bacteriana , Disenteria Bacilar/epidemiologia , Infecções por HIV/complicações , Shigella sonnei/efeitos dos fármacos , Adulto , Estudos de Casos e Controles , DNA Girase/genética , DNA Topoisomerase IV/genética , Transmissão de Doença Infecciosa , Disenteria Bacilar/microbiologia , Disenteria Bacilar/transmissão , Eletroforese em Gel de Campo Pulsado , Genótipo , Homossexualidade Masculina , Humanos , Masculino , Pessoa de Meia-Idade , Repetições Minissatélites , Epidemiologia Molecular , Tipagem Molecular , Mutação de Sentido Incorreto , Taiwan/epidemiologia , Adulto JovemRESUMO
We have isolated and sequenced a phase clone from a common carp (Cyprinus carpio) genomic library that carries a gene encoding growth hormone (GH). This gene consists of five exons and four introns spanning a region of about 3 kilobase pairs. Its exons correspond with one of two reported cDNAs of carp GH except for nine differences in the nucleotide sequence, while the encoded amino-acid sequences are identical. The sequence upstream from the transcription start point contains two tandem repeats of AACTCTCATG (from -85 to -62) and the typical TATA box. All the introns start with a consensus GT dinucleotide and end with AG. The arrangement of exons and introns is very similar to that seen in mammalian GH, but quite different from the GH genes of rainbow trout and Atlantic salmon.
Assuntos
Carpas/genética , Cyprinidae/genética , Hormônio do Crescimento/genética , Sequência de Aminoácidos , Animais , Sequência de Bases , DNA/análise , Éxons , Biblioteca Genômica , Humanos , Íntrons , Dados de Sequência Molecular , Sequências Reguladoras de Ácido Nucleico , Sequências Repetitivas de Ácido Nucleico , Mapeamento por RestriçãoRESUMO
A carp genomic DNA clone containing the carp prolactin (Prl) gene was isolated with carp Prl cDNA as a probe. The organization of the carp Prl gene was determined by restriction nuclease mapping and nucleotide sequencing. The Prl gene comprises approx. 2.8 kilobasepairs (kb) of DNA including the 5'-flanking region, five exons, four introns and the 3'-flanking region. Analysis of the 5'-flanking region reveals (1) the sequence TATATAAT at positions -38 to -31 upstream from the cap site which was found to be a guanine residue, and (2) the palindrome, CTCATTGCATATACAAATGAG at positions -79 to -59. The carp Prl gene matches with the reported cDNA except for one difference in coding region and five in the 3'-flanking region, while the encoded amino acid sequences are identical. The arrangement of exons and introns is very similar to that seen in carp GH as well as mammalian Prl, which, however, have much longer introns.
Assuntos
Genes , Prolactina/genética , Sequência de Aminoácidos , Animais , Sequência de Bases , Carpas , Clonagem Molecular/métodos , Humanos , Dados de Sequência Molecular , Mapeamento por Restrição , Homologia de Sequência do Ácido Nucleico , TATA BoxRESUMO
Deletions in either of the genes in the strA-strB gene pair of Erwinia amylovora plasmid pEa34 resulted in a dramatic decrease in streptomycin resistance (SmR), but SmR was restored to high levels by complementation. When strA and strB were cloned separately on a lacIq/Ptac-based expression vector in Escherichia coli, only the protein encoded by strA was produced. When a strong Shine-Dalgarno sequence was introduced and the start codon was located outside the double-stranded region of the stable stem-loop, the protein encoded by strB was produced. Biochemical analysis of the respective phosphorylated products demonstrated that strA and strB encoded aminoglycoside-3"-phosphotransferase (APH(3")-Ib) and aminoglycoside-6-phosphotransferase (APH(6)-Id), respectively. These data suggest that the high-level SmR in bacteria containing strA and strB is due to the combined action of the two enzymes.
Assuntos
Erwinia/genética , Genes Bacterianos/genética , Fosfotransferases (Aceptor do Grupo Álcool)/genética , Estreptomicina/farmacologia , Sequência de Bases , Clonagem Molecular , Análise Mutacional de DNA , Resistência Microbiana a Medicamentos , Erwinia/efeitos dos fármacos , Escherichia coli/genética , Regulação Bacteriana da Expressão Gênica , Dados de Sequência Molecular , RNA Mensageiro/genética , Sequências Reguladoras de Ácido Nucleico/genéticaRESUMO
Staphylococcus aureus is a major food-borne pathogen in many countries. Enterotoxins produced by S. aureus strains include staphylococcal enterotoxins (SEs) A, B, C, D, E and G, H, I, etc. For SEC, in addition to the three major SEC subtypes, i.e., SEC1, C2 and C3, other molecular variants may exist. Although the detection methods and the distribution of SEA, B, C, D, E types of S. aureus in staphylococcal infections or food-borne outbreaks have been well documented, the differentiation method and the distribution of SEC subtypes in staphylococcal infections are rarely reported. In this study, four polymerase chain reaction (PCR) primers used in pairs (ENTC1/ENTCR, ENTC2/ENTCR and ENTC3/ENTCR) for the specific detection of SEC1, C2 and C3 genes of S. aureus strains were developed. When 39 SEC S. aureus strains isolated from fecal samples of randomly selected diarrheal patients associated with food-borne outbreaks in central Taiwan in 6 years (1995-2000) were analyzed, it was found that the major SEC subtypes for these S. aureus strains were SEC2 and C3.
Assuntos
Enterotoxinas/genética , Staphylococcus aureus/genética , Primers do DNA , Enterotoxinas/química , Fezes/microbiologia , Humanos , Reação em Cadeia da Polimerase/métodos , Sensibilidade e Especificidade , Intoxicação Alimentar Estafilocócica , Staphylococcus aureus/classificação , Staphylococcus aureus/isolamento & purificaçãoRESUMO
In 1994, 102 outbreaks of food-borne disease involving 4,726 cases were reported to the Taiwan Department of Health. This is the highest number of outbreaks and cases in recent years in Taiwan. Of these outbreaks, 72.5% (74/102) were caused by bacterial pathogens, with Vibrio parahaemolyticus responsible for 56.7% (42/74), Staphylococcus aureus 20.3% (15/74), Bacillus cereus 14.9% (11/74) and Salmonella spp other than S. typhi and S. paratyphi 8.1% (6/74). V. parahaemolyticus has been a leading cause of problems in Taiwan for many years. Contamination of seafood with this organism has been reported frequently, particularly in the warmer months. In 1994, small outbreaks (fewer than 5 cases) and large outbreaks (more than 50 cases) represented 31.4% (32/102) and 12.7% (13/102), respectively, of the total. The median outbreak size was 10 cases. A high proportion (54%, 7/13) of the large outbreaks was associated with commercial lunch-boxes supplied to elementary and junior high schools. Health education to improve food sanitation and supervision of food sanitation practices need to be strengthened.
Assuntos
Surtos de Doenças , Doenças Transmitidas por Alimentos/epidemiologia , Doenças Transmitidas por Alimentos/microbiologia , Bacillus cereus , Manipulação de Alimentos , Humanos , Salmonella , Staphylococcus aureus , Taiwan/epidemiologia , Vibrio parahaemolyticusRESUMO
This study evaluated the dissolution behavior of basic oxygen furnace slag (BOF slag) and the performance of H2O2 with BOF slag denoted as H2O2/BOF slag process to degrade polyethylene glycol (PEG) in the aqueous solution. The concentration of total organic carbon (TOC) was chosen as a mineralization index of the degradation of PEG by the H2O2/BOF slag process. A first-order kinetic model with respect to TOC was adopted to represent the mineralization of PEG by H2O2/BOF slag process. The experimental results in this study suggested that dosages with 3.98 x 10(-4) mole min(-1) l(-1) H2O2 and 15 g l(-1) BOF slag loading in the solution at pH 2 provided the optimal operation conditions for the mineralization of PEG yielding a 75.5% treatment efficiency at 100 min reaction time. The H2O2/Fe2+ ratio was then determined to be 13.5:1.
Assuntos
Peróxido de Hidrogênio/química , Resíduos Industriais , Oxidantes/química , Polietilenoglicóis/química , Gerenciamento de Resíduos/métodos , Carbono/análise , Catálise , Concentração de Íons de Hidrogênio , Ferro , Soluções , AçoRESUMO
Salmonella genomic island 1 (variant SGI1-J3) has been previously identified in multi-drug resistant (MDR) Salmonella enterica serovar Virchow isolated from humans in 1994. In this study, antimicrobial resistance, genotypes and genetic relationship were investigated in 96 S. Virchow isolates collected from humans in 2004-2006. XbaI-PFGE analysis separated 96 isolates into two main related clusters, I and II, which consisted of four major pulsotypes differing in prevalence by year. The majority of isolates were MDR to chloramphenicol, sulfonamide, trimethoprim and tetracyclines associated with antimicrobial resistance genes dfrA1, floR2, sulI and tet(G) of variant SGI1-J3. Among nine variants, we determined two novel variants, SGI1-J4 and -J5, which have undergone different homologous recombinational events resulting in partial deletions of the MDR region. The first one contained an empty integron structure and the second presented a deletion extending from the IS6100 element to the adjacent SGI1 backbone. SGI1-J3 is largely encountered in clonally related MDR S. Virchow isolates collected from humans, which spread vertically. The genomic island SGI1 appears to be largely responsible for the diversity of MDR phenotypes among S. Virchow isolates in Taiwan.
Assuntos
Farmacorresistência Bacteriana Múltipla/genética , Ilhas Genômicas , Família Multigênica , Salmonella enterica/classificação , Salmonella enterica/genética , DNA Bacteriano/química , DNA Bacteriano/genética , Genes MDR , Genótipo , Humanos , Testes de Sensibilidade Microbiana , Infecções por Salmonella/microbiologia , Salmonella enterica/efeitos dos fármacos , Salmonella enterica/isolamento & purificação , Deleção de Sequência , TaiwanRESUMO
Twenty-one Candida albicans isolates from three HIV-infected patients were collected over a period of 3 years and characterized for fluconazole susceptibility, infectivity and genetic relatedness. Fluconazole resistance was found in five isolates, four exhibited dose-dependent susceptibility and the remainder were fully susceptible to this agent. Pulsed-field gel electrophoresis of SfiI restriction digests of the genomic DNA from the isolates revealed that isolates from the same swab specimen were identical despite differences in susceptibility to fluconazole and isolates recovered over time from the three patients retained clonally related DNA fingerprints within each patient. This small-scale study confirms the persistence of oral colonization of C. albicans strains in HIV-infected patients. Clinical data also suggests that the primary infecting strain may become a persistent colonist in the oral cavity once the immune function of the patient has been restored.
Assuntos
Candida albicans/genética , Candida albicans/patogenicidade , Candidíase Bucal/epidemiologia , Infecções por HIV/complicações , Adulto , Antifúngicos/farmacologia , Antifúngicos/uso terapêutico , Candidíase Bucal/tratamento farmacológico , Candidíase Bucal/genética , Impressões Digitais de DNA , Farmacorresistência Bacteriana , Feminino , Fluconazol/farmacologia , Fluconazol/uso terapêutico , Infecções por HIV/microbiologia , Humanos , Hospedeiro Imunocomprometido , Masculino , Pessoa de Meia-Idade , Epidemiologia MolecularRESUMO
AIMS: Plasmid profile, phage typing, and pulsed-field gel electrophoresis (PFGE) patterns of 124 Salmonella Enteritidis strains isolated in 1998-2002 in Taiwan were analysed and the results were compared with those of the 63 strains obtained in 1991-1997, so that molecular subtypes and epidemic strains for Salmonella Enteritidis over a 13-year period (1991-2002) could be elucidated. METHODS AND RESULTS: A total of 124 strains of Salmonella Enteritidis isolated from human in Taiwan between 1998 and 2002 were analysed by PFGE, plasmid analysis and phage typing. The results obtained were compared with those of the 63 strains obtained in 1991-1997, so that the clonal relationships for a total of 187 strains obtained over 13 years could be elucidated. For PFGE, restriction enzymes XbaI, SpeI and NotI were used for chromosomal DNA digestion. Results showed 28 PFGE pattern combinations for the 187 Salmonella strains. Of them, pattern X3S3N3 was the major subtype as 130 strains isolated from different locations during 1991-2002 showed this PFGE pattern. For all these 187 strains, the genetic similarity was higher than 80%. Plasmid analysis showed 17 distinct types, which consist of one to four plasmids and the predominant phage type of those strains was PT4 (71.6%) and PT6a (13.4%). The three methods identified different degrees of polymorphism in the following order: plasmid profile (18 types, D = 0.659) > PFGE (28 types, D = 0.512) > phage typing (13 types, D = 0.438). As PFGE patterns, phage type and plasmid profile were combined for subtyping, the 187 strains could be grouped into 46 subtypes and the discriminatory index was raised to 0.795. For these 46 subtypes, the predominant one was X3S3N3/P1/PT4, which contained 77 (41%) isolates. CONCLUSIONS: Most of the Salmonella Enteritidis strains from sporadic cases were with pattern X3S3N3. They were the prevalent and may be the epidemic strains found in Taiwan during 1991-2002. The present study suggested that the several variants were derived from a single clonal line and the genome for strains of Salmonella Enteritidis are highly conserved over a 13-year period (1991-2002). SIGNIFICANCE AND IMPACT OF THE STUDY: The results obtained here are useful for epidemiolgical study of salmonellosis caused by Salmonella Enteritidis in Taiwan. Comparing the data of the present study with those obtained for strains from other countries, the major subtypes for Salmonella Enteritidis infection in the world can be elucidated.
Assuntos
Infecções por Salmonella/microbiologia , Salmonella enteritidis/isolamento & purificação , Tipagem de Bacteriófagos , Surtos de Doenças , Eletroforese em Gel de Campo Pulsado , Genes Bacterianos , Humanos , Plasmídeos , Polimorfismo Genético , Infecções por Salmonella/epidemiologia , Infecções por Salmonella/virologia , Salmonella enteritidis/genética , Salmonella enteritidis/virologia , Taiwan/epidemiologiaRESUMO
AIMS: We analysed the genetic divergence in the pandemic new O3:K6 and phylogenetically related (new O3:K6-like) strains and compare these two groups in terms of virulence and other biological traits. METHODS AND RESULTS: A total of 160 new O3:K6, new O3:K6-like and other strains of Vibrio parahaemolyticus isolated in Taiwan and other countries were collected and their clonal relationships analysed using SfiI-pulsed-field gel electrophoresis. All of the new O3:K6 and new O3:K6-like strains were grouped in cluster I with five new patterns identified. A O6:K18 strain was identified as a new member of the new O3:K6-like strains in addition to O4:K68, O1:KUT and O1:K25 strains. All of the lipopolysaccharide preparations of the selected strains exhibited closely spaced quadruplet banding patterns with similar mobility. The two groups of strains exhibited 100% sequence identity in the internal sequences of the toxR and laf genes, and also displayed similar virulence properties as determined with a suckling mouse model. CONCLUSIONS: The new O3:K6 and new O3:K6-like strains were highly similar in virulence and in several other phenotypical and genotypical traits. SIGNIFICANCE AND IMPACT OF THE STUDY: This work demonstrated the spread and divergence of the pandemic and related clone of V. parahaemolyticus with similar virulence.
Assuntos
Microbiologia de Alimentos , Doenças Transmitidas por Alimentos/microbiologia , Genes Bacterianos , Vibrioses/microbiologia , Vibrio parahaemolyticus/genética , Vibrio parahaemolyticus/isolamento & purificação , Animais , Surtos de Doenças , Eletroforese em Gel de Campo Pulsado , Humanos , Dose Letal Mediana , Lipopolissacarídeos/farmacologia , Camundongos , Filogenia , Coelhos , Taiwan , VirulênciaRESUMO
On 6 May 2000, a staphylococcal food poisoning outbreak occurred at a high school, affecting 10 of the 356 students who attended the breakfast. Twenty-seven Staphylococcus aureus isolates, producing enterotoxin A (SEA), SEB-, or non-SEA-E, were recovered from 7 patients, 2 food handlers and left-overs. To investigate the outbreak, we genotyped the isolates by using pulsed-field gel electrophoresis (PFGE) and three PCR-based techniques: inter-IS256 PCR typing, protein A gene (spa) typing, and coagulase gene restriction profile (CRP) analysis. Our results show that PFGE was the most discriminatory technique, whereas the three PCR-based techniques were insufficient in the discriminatory power to distinguish the S. aureus isolates from the outbreak. Based on the enterotoxin-producing types and the results of genotyping, three distinct types of strains (A1111, B2221 and N3221) were designated. Both the A1111 and B2221 strains were found in the specimens from the patients and a hand lesion of a food handler, suggesting that the source of contamination for the outbreak was most likely originated from a food handler.
Assuntos
Surtos de Doenças , Contaminação de Alimentos , Manipulação de Alimentos , Intoxicação Alimentar Estafilocócica/epidemiologia , Staphylococcus aureus/genética , Staphylococcus aureus/patogenicidade , Adolescente , DNA Bacteriano/análise , Eletroforese em Gel de Campo Pulsado , Enterotoxinas/genética , Fezes/microbiologia , Feminino , Genótipo , Humanos , Masculino , Reação em Cadeia da Polimerase , Instituições Acadêmicas , Intoxicação Alimentar Estafilocócica/transmissãoRESUMO
A class II Tn3-type transposable element, designated Tn5393 and located on plasmid pEa34 from streptomycin-resistant strain CA11 of Erwinia amylovora, was identified by its ability to move from pEa34 to different sites in plasmids pGEM3Zf(+) and pUCD800. Nucleotide sequence analysis reveals that Tn5393 consists of 6,705 bp with 81-bp terminal inverted repeats and generates 5-bp duplications of the target DNA following insertion. Tn5393 contains open reading frames that encode a putative transposase (tnpA) and resolvase (tnpR) of 961 and 181 amino acids, respectively. The two open reading frames are separated by a putative recombination site (res) consisting of 194 bp. Two streptomycin resistance genes, strA and strB, were identified on the basis of their DNA sequence homology to streptomycin resistance genes in plasmid RSF1010. StrA is separated from tnpR by a 1.2-kb insertion element designated IS1133. The tnpA-res-tnpR region of Tn5393 was detected in Pseudomonas syringae pv. papulans Psp36 and in many other gram-negative bacteria harboring strA and strB. Except for some strains of Erwinia herbicola, these other gram-negative bacteria lacked insertion sequence IS1133. The prevalence of strA and strB could be accounted for by transposition of Tn5393 to conjugative plasmids that are then disseminated widely among gram-negative bacteria.