NMR characterization of surface interactions in the cytochrome b5-cytochrome c complex.

The complex formed in solution by native and chemically modified cytochrome c with cytochrome b5 has been studied by 1H and 13C nuclear magnetic resonance spectroscopy (NMR). Contrary to predictions of recent theoretical analysis, 1H NMR spectroscopy indicates that there is no major movement of cytochrome c residue Phe82 on binding to cytochrome b5. The greater resolution provided by 13C NMR spectroscopy permits detection of small perturbations in the environments of cytochrome c residues Ile75 and Ile85 on binding with cytochrome b5, a result that is in agreement with earlier model-building experiments. As individual cytochrome c lysyl residues are resolved in the 1H NMR spectrum of N-acetimidylated cytochrome c, the interaction of this modified protein with cytochrome b5 has been studied to evaluate the number of cytochrome c lysyl residues involved in binding to cytochrome b5. The results of this experiment indicate that at least six lysyl residues are involved, two more than predicted by static model building, which indicates that cytochrome c and cytochrome b5 form two or more structurally similar 1:1 complexes in solution.

The RNA component of human telomerase.

Eukaryotic chromosomes are capped with repetitive telomere sequences that protect the ends from damage and rearrangements. Telomere repeats are synthesized by telomerase, a ribonucleic acid (RNA)-protein complex. Here, the cloning of the RNA component of human telomerase, termed hTR, is described. The template region of hTR encompasses 11 nucleotides (5'-CUAACCCUAAC) complementary to the human telomere sequence (TTAGGG)n. Germline tissues and tumor cell lines expressed more hTR than normal somatic cells and tissues, which have no detectable telomerase activity. Human cell lines that expressed hTR mutated in the template region generated the predicted mutant telomerase activity. HeLa cells transfected with an antisense hTR lost telomeric DNA and began to die after 23 to 26 doublings. Thus, human telomerase is a critical enzyme for the long-term proliferation of immortal tumor cells.

CASTing for multicomponent DNA-binding complexes.

Degenerate oligonucleotides and polymerase chain reaction-based reiterative selection techniques have been used to define the consensus binding sites for an increasing number of transcription factors. The use of crude nuclear extracts rather than purified proteins permits multicomponent complexes to form, and allows the technique to generate information about the combinatorial interactions involved in gene regulation.

Microarray analysis of replicative senescence.

BACKGROUND: Limited replicative capacity is a defining characteristic of most normal human cells and culminates in senescence, an arrested state in which cells remain viable but display an altered pattern of gene and protein expression. To survey widely the alterations in gene expression, we have developed a DNA microarray analysis system that contains genes previously reported to be involved in aging, as well as those involved in many of the major biochemical signaling pathways. RESULTS: Senescence-associated gene expression was assessed in three cell types: dermal fibroblasts, retinal pigment epithelial cells, and vascular endothelial cells. Fibroblasts demonstrated a strong inflammatory-type response, but shared limited overlap in senescent gene expression patterns with the other two cell types. The characteristics of the senescence response were highly cell-type specific. A comparison of early- and late-passage cells stimulated with serum showed specific deficits in the early and mid G1 response of senescent cells. Several genes that are constitutively overexpressed in senescent fibroblasts are regulated during the cell cycle in early-passage cells, suggesting that senescent cells are locked in an activated state that mimics the early remodeling phase of wound repair. CONCLUSIONS: Replicative senescence triggers mRNA expression patterns that vary widely and cell lineage strongly influences these patterns. In fibroblasts, the senescent state mimics inflammatory wound repair processes and, as such, senescent cells may contribute to chronic wound pathologies.

A transcriptionally active DNA-binding site for human p53 protein complexes.

Recent studies have demonstrated transcriptional activation domains within the tumor suppressor protein p53, while others have described specific DNA-binding sites for p53, implying that the protein may act as a transcriptional regulatory factor. We have used a reiterative selection procedure (CASTing: cyclic amplification and selection of targets) to identify new specific binding sites for p53, using nuclear extracts from normal human fibroblasts as the source of p53 protein. The preferred consensus is the palindrome GGACATGCCCGGGCATGTCC. In vitro-translated p53 binds to this sequence only when mixed with nuclear extracts, suggesting that p53 may bind DNA after posttranslational modification or as a complex with other protein partners. When placed upstream of a reporter construct, this sequence promotes p53-dependent transcription in transient transfection assays.

Heterogeneity of transcriptional activity of mutant p53 proteins and p53 DNA target sequences.

Transcriptional activity of p53 was monitored by cotransfection of pCMV expression vectors containing wild-type and mutant p53 cDNAs into the p53-null H1299 lung cancer cells along with luciferase reporter plasmids containing different p53 target sequences in the 5' regulatory region: fragment A of the ribosomal gene cluster (RGC); p53 consensus sequence (p53CON); or a tandemly linked RGC+p53CON sequence. Our results show: (1) wild-type p53 stimulates the transcription of reporter genes with p53CON and RGC in their 5' region while most p53 mutants occurring in human cancers have lost this activity; (2) the R273H mutant retains transcriptional activity for the p53CON sequence but not RGC; (3) some mutants are temperature-sensitive for the transcriptional activity with the p53CON but not the RGC sequence; (4) p53 mutants vary in their ability to inhibit wild-type p53 transactivation but there is no difference between p53CON and RGC sequences; (5) lung cancer cells with endogenous mutant p53 proteins (M246I in H23 cells and R248L in H322 cells) retain transcriptional activity for the p53CON but not the RGC sequence. We conclude that p53 DNA target sequences vary in their response to mutant p53 proteins, and that p53 mutants vary in several transactivation related functions.

Novel DNA binding of p53 mutants and their role in transcriptional activation.

The protein product of the normal p53 gene binds to the DNA p53CON element (GGACATGCCCGGGCATGTCC, Funk et al., 1992), thereby activating transcription from adjacent promoters. Two mutants, 248 (Arg-->Trp) and 281 (Asp-->Gly), failed to bind p53CON and to activate transcription. However, in contrast to previous reports that all p53 mutants fail to bind to the other p53 binding elements, two p53 mutants, 143 (Val-->Ala) and 273 (Arg-->His), retained both p53CON binding and transcriptional activation functions. A third mutant 175 (Arg-->His) bound to the p53CON but did not activate transcription. These data suggest that the DNA binding and transcriptional activation functions of p53 mutants in tumor cells are dependent on the specific missense mutations acquired in the p53 gene and the target sequences of p53 in the genome.

The nucleotide sequence of rabbit liver transferrin cDNA.

The cDNA sequence of rabbit liver transferrin has been determined. The largest cDNA was 2279 base pairs (bp) in size and encoded 694 amino acids consisting of a putative 19 amino acid signal peptide and 675 amino acids of plasma transferrin. The deduced amino acid sequence of rabbit liver transferrin shares 78.5% identity with human liver transferrin and 69.1% and 44.8% identity with porcine and Xenopus transferrins, respectively. At the amino acid level, vertebrate transferrins share 26.4% identity and 56.5% similarity. The most conserved regions correspond to the iron ligands and the anion binding region. Optimal alignment of transferrin sequences required the insertion of a number of gaps in the region corresponding to the N-lobe. In addition, the N-lobes of transferrins share less amino acid sequence similarity than the C-lobes.

Preliminary crystallographic analyses of the N-terminal lobe of recombinant human serum transferrin.

The N-terminal lobe of recombinant human serum transferrin (residues 1 to 337) has been crystallized in a form suitable for high-resolution three-dimensional X-ray crystallographic analyses. Crystals are of the orthorhombic space group P2(1)2(1)2(1), with unit cell dimensions of a = 44.9 A, b = 57.0 A and c = 135.9 A, and diffract to beyond 2 A resolution. Further studies show that isomorphous crystals of specifically designed mutants of this protein can also be grown. Structural studies of both recombinant and mutant protein forms will provide a basis for understanding the mechanism by which human serum transferrin functions.

Identification and cloning of a sequence homologue of dopamine beta-hydroxylase.

We have identified and cloned a cDNA encoding a new member of the monooxygenase family of enzymes. This novel enzyme, which we call MOX (monooxygenase X; unknown substrate) is a clear sequence homologue of the enzyme dopamine beta-hydroxylase (DBH). MOX maintains many of the structural features of DBH, as evidenced by the retention of most of the disulfide linkages and all of the peptidyl ligands to the active site copper atoms. Unlike DBH, MOX lacks a signal peptide sequence and therefore is unlikely to be a secreted molecule. The steady-state mRNA levels of MOX are highest in the kidney, lung, and adrenal gland, indicating that the tissue distribution of MOX is broader than that of DBH. Antisera raised to a fusion protein of MOX identifies a single band of the expected mobility by Western blot analysis. MOX mRNA levels are elevated in some fibroblast cell strains at replicative senescence, through this regulation is not apparent in all primary cell strains. The gene for MOX resides on the q arm of chromosome 6 and the corresponding mouse homolog has been identified.

Cellular and molecular advances in elucidating p53 function.

The finding that in many human tumors there is allelic loss and/or mutations in p53, in combination with recognition that these events may play a role in multi-stage carcinogenesis, has focused considerable interest on this gene. To help keep abreast of this rapidly expanding field, recent experiments on the role and potential regulation of p53 are described: these include discussions of p53 as an anti-proliferative agent, the p53 mutations found in human tumors and tumor cell lines, the conformational states of p53, phosphorylation of p53 by p34cdc2, and signals for the nuclear localization of p53. p53 may act as a transcriptional activator and the specific DNA sequences to which p53 protein binds are also discussed as is the importance of abrogation of p53 function in overcoming cellular senescence.

Spontaneous reversal of the developmental aging of normal human cells following transcriptional reprogramming.

AIM: To determine whether transcriptional reprogramming is capable of reversing the developmental aging of normal human somatic cells to an embryonic state. MATERIALS & METHODS: An isogenic system was utilized to facilitate an accurate assessment of the reprogramming of telomere restriction fragment (TRF) length of aged differentiated cells to that of the human embryonic stem (hES) cell line from which they were originally derived. An hES-derived mortal clonal cell strain EN13 was reprogrammed by SOX2, OCT4 and KLF4. The six resulting induced pluripotent stem (iPS) cell lines were surveyed for telomere length, telomerase activity and telomere-related gene expression. In addition, we measured all these parameters in widely-used hES and iPS cell lines and compared the results to those obtained in the six new isogenic iPS cell lines. RESULTS: We observed variable but relatively long TRF lengths in three widely studied hES cell lines (16.09-21.1 kb) but markedly shorter TRF lengths (6.4-12.6 kb) in five similarly widely studied iPS cell lines. Transcriptome analysis comparing these hES and iPS cell lines showed modest variation in a small subset of genes implicated in telomere length regulation. However, iPS cell lines consistently showed reduced levels of telomerase activity compared with hES cell lines. In order to verify these results in an isogenic background, we generated six iPS cell clones from the hES-derived cell line EN13. These iPS cell clones showed initial telomere lengths comparable to the parental EN13 cells, had telomerase activity, expressed embryonic stem cell markers and had a telomere-related transcriptome similar to hES cells. Subsequent culture of five out of six lines generally showed telomere shortening to lengths similar to that observed in the widely distributed iPS lines. However, the clone EH3, with relatively high levels of telomerase activity, progressively increased TRF length over 60 days of serial culture back to that of the parental hES cell line. CONCLUSION: Prematurely aged (shortened) telomeres appears to be a common feature of iPS cells created by current pluripotency protocols. However, the spontaneous appearance of lines that express sufficient telomerase activity to extend telomere length may allow the reversal of developmental aging in human cells for use in regenerative medicine.

Identification of a novel insulin-like growth factor binding protein gene homologue with tumor suppressor like properties.

Here we report the identification of a new insulin-like growth factor binding protein homologue, provisionally designated insulin-like growth factor binding related protein-4 (IGFBP-rP4). IGFBP-rP4 was found to be most closely related to IGFBP-7 with 52% amino acid homology and 43% amino acid identity, and shares a similar domain structure. Semi-quantitative RT-PCR expression analysis demonstrated a pattern of downregulation of this gene in multiple tumor samples including lung and colon cancer, compared to matched adjacent normal tissue. Western blotting revealed a protein of approximately 38kDa expressed in both the cell pellet and secreted into the supernatant of transiently transfected Cos-7 cells. Cos-7 supernatants containing IGFBP-RP4 protein were observed to suppress the growth of HeLa cells in culture compared to vector controls. IGFBP-RP4 directly transiently transfected into HeLa cells also further confirmed the growth suppressive properties of this protein. Together these data suggest that IGFBP-RP4 may be a novel putative tumor suppressor protein.

Cyclic amplification and selection of targets for multicomponent complexes: myogenin interacts with factors recognizing binding sites for basic helix-loop-helix, nuclear factor 1, myocyte-specific enhancer-binding factor 2, and COMP1 factor.

Myogenin is one of four muscle-specific basic helix-loop-helix regulatory factors involved in controlling myogenesis. We here describe various protein complexes that increase the affinity of myogenin for DNA. We mixed an oligonucleotide containing a degenerate center large enough to accommodate multiple binding sites with crude myotube nuclear extracts and used cyclic amplification and selection of targets with an antimyogenin monoclonal antibody to isolate protein-DNA complexes. Since each cycle of selection results in the enrichment for the sequences with the highest affinity, we isolated multicomponent sites in which myogenin binding was increased by its interaction with other DNA binding proteins. Myogenin interacts with members of the nuclear factor 1 family, the muscle-specific factor myocyte-specific enhancer-binding factor 2, and another factor, COMP1 (cooperates with myogenic proteins 1), that binds to the sequence TGATTGAC. Myogenin also exhibits cooperative binding with other proteins that recognize CANNTG motifs, and various constraints on spacing and orientation were observed. The application of this approach to other transcription factors should not only help identify the different functions of myogenin versus other members of the muscle basic helix-loop-helix regulatory family but also help define the general combinatorial mechanisms involved in eukaryotic gene regulation.

Molecular biology of myogenic regulatory factors.

A family of proteins has recently been identified, each member of which has the capacity to initiate muscle differentiation in many non-muscle cell types. These factors, which include MyoD1, myogenin, myf-5 and MRF4, share homologies with each other and belong to a superfamily of Myc-related proteins. Expression of these regulatory proteins results in auto-activation and cross-activation of other members of the family and in the transcriptional activation of the markers of terminal differentiation. Sequence analysis has shown a conserved basic domain in each protein that is required for binding to specific DNA sequences of the E-box type and for myogenic activation. A conserved helix-loop-helix (HLH) domain allows homo- and heterodimerization of these muscle-specific proteins with each other and with ubiquitously expressed proteins such as the E2A gene products (E12/E47). This review describes the discovery and characterization of these muscle regulatory proteins and their actions in the context of proposed models for the determination and differentiation of muscle tissue.

Complete cDNA sequence of human preceruloplasmin.

A cDNA for human ceruloplasmin (EC 1.16.3.1) was identified in a human liver cDNA library by screening with two mixtures of synthetic oligodeoxyribonucleotides that were complementary to two regions of ceruloplasmin mRNA as predicted from the amino acid sequence of plasma ceruloplasmin. The resulting clone (phCP1) contained DNA coding for amino acid residues 202-1046 of the protein, followed by a stop codon, a 3' untranslated region of 123 base pairs, and a poly(A) tail. To isolate cDNAs encoding the 5' end of ceruloplasmin mRNA, a cDNA library was constructed in lambda gt10. The cDNA for this library was synthesized by reverse transcription of human liver poly(A)+ RNA, using random oligonucleotides as primers. When this cDNA library was screened by using a 5' fragment of phCP1 as a hybridization probe, several positive clones were identified. One of these clones (lambda hCP1) contained DNA coding for a probable signal peptide of 19 amino acid residues followed by DNA coding for residues 1-380 of plasma ceruloplasmin. Blot hybridization analysis showed that ceruloplasmin mRNA from human liver and the human hepatoma cell line HepG2 is 3700 nucleotides in size. Liver contained an additional mRNA species that is like ceruloplasmin mRNA and is 4500 nucleotides in size. Comparison of the complete nucleotide sequences of human ceruloplasmin cDNA and human clotting factor VIII cDNA showed regions of sequence homology, suggesting that these two proteins have evolved from a common ancestor.

Efficient production and isolation of recombinant amino-terminal half-molecule of human serum transferrin from baby hamster kidney cells.

Expression of the amino-terminal lobe of human serum transferrin secreted into the culture medium by transformed baby hamster kidney (BHK) cells has been increased from the levels reported originally of 10-15 micrograms/ml to 55-120 micrograms/ml. Use of the serum substitute, Ultraser G, has facilitated isolation of the recombinant protein, resulting in approximately 80% recovery of expressed hTF/2N from the culture medium. In the three experiments described, 300-750 mg of recombinant protein was collected over a period of 25 days from five expanded surface roller bottles each containing 200 ml of medium (seven to nine collections). The use of alginate beads to encapsulate the transformed BHK cells provided no advantage over normal culturing over 25 days. A lag in production resulting in 30% less recombinant protein over this time period was observed. The production and isolation procedures described are easily handled by one person. The system is amenable to incorporation of isotopically substituted amino acids useful in NMR studies.

Reconstitution of human telomerase activity and identification of a minimal functional region of the human telomerase RNA.

Telomerase is a ribonucleoprotein that catalyzes telomere elongation through the addition of TTAGGG repeats in humans. Activation of telomerase is often associated with immortalization of human cells and cancer. To dissect the human telomerase enzyme mechanism, we developed a functional in vitro reconstitution assay. After removal of the essential 445 nucleotide human telomerase RNA (hTR) by micrococcal nuclease digestion of partially purified human telomerase, the addition of in vitro transcribed hTR reconstituted telomerase activity. The activity was dependent upon and specific to hTR. Using this assay, truncations at the 5' and 3' ends of hTR identified a functional region of hTR, similar in size to the full-length telomerase RNAs from ciliates. This region is located between positions 1-203. Furthermore, we found that residues 1-44, 5' to the template region (residues 46-56) are not essential for activity, indicating a minimal functional region is located between residues 44-203. Mutagenesis of full-length hTR between residues 170-179, 180-189 or 190-199 almost completely abolished the ability of the hTR to function in the reconstitution of telomerase activity, suggesting that sequences or structures within this 30 nucleotide region are required for activity, perhaps by binding telomerase protein components.

Expression of cloned human lactoferrin in baby-hamster kidney cells.

Human lactoferrin was expressed from a cloned cDNA introduced into mammalian cells in tissue culture. Total RNA was extracted from human bone marrow, and lactoferrin cDNA was synthesized by primer-specific polymerase chain reaction after oligo(dT)-primed first-strand synthesis. The cDNA was sequenced to confirm its identity with previously published human lactoferrin sequences and cloned into the eukaryotic expression vector pNUT. Recombinant vector DNA containing the human lactoferrin sequence was introduced into baby-hamster kidney (BHK) cells in culture, and stable transfectants were produced by dominant marker selection. Human lactoferrin was expressed from the metallothionein promoter of pNUT by Zn2+ induction. The protein was secreted into the tissue-culture medium and was subsequently purified to homogeneity in a single step. Initial characterization suggests that the protein expressed by BHK cells is identical with native human lactoferrin.

Expression and initial characterization of five site-directed mutants of the N-terminal half-molecule of human transferrin.

Five site-directed mutants of the N-terminal half-molecule of human serum transferrin have been expressed in baby hamster kidney cells and purified to homogeneity. Expression levels and overall yields varied considerably from the wild-type protein, depending on the mutant in question. The mutants are D63S, D63C, G65R, K206Q, and H207E and are based on mutations observed in a variety of transferrins of known sequence. Their molecular masses, determined by electrospray mass spectrometry, agree with theory, except for the D63C mutant, which appears to be cysteinylated. All mutants bind iron but with varying affinities; qualitatively, in increasing order D63S approximately D63C approximately G65R much less than wild type less than or equal to H207E much less than K206Q. In general, reduction of formal negative charge within the binding cleft shifts the visible spectral maximum of the iron complex toward the blue and reduces the affinity for iron, and increasing the formal negative charge shifts the visible maximum toward the red and increases the affinity for iron. The K206Q mutant is exceptional inasmuch as its visible maximum shows a blue shift, but its affinity for iron is the greatest of all of the mutants studied. All mutants reported, in addition to the wild-type protein, exhibit very similar visible molar extinction coefficients for the iron complex and very similar changes in extinction coefficients at 240 nm on binding Fe(III) or Ga(III). These results suggest that in all cases the bound metal ion is coordinated by two tyrosyl side chains.