Clinician preferences in the treatment of acutely symptomatic hernia: the 'MASH' survey.

INTRODUCTION: There is limited high-quality evidence to guide the management of acute hernia presentation. The aim of this study was to survey surgeons to assess current trends in assessment, treatment strategy and operative decisions in the management of acutely symptomatic hernia. METHODS: A survey was developed with reference to current guidelines, and reported according to Checklist for Reporting Results of Internet E-Surveys guidelines. Ethical approval was obtained from the University of Sheffield (UREC:034047). The survey explored practice in groin, umbilical/paraumbilical and incisional hernia presenting acutely. It captured respondent demographics, and preferences for investigations, treatment strategies and repair techniques for each hernia type, using a five-point Likert scale. RESULTS: Some 145 responses were received, of which 39 declared a specialist hernia practice. Essential investigations included urea and electrolytes (58.6%) and inflammatory markers (55.6%). Computed tomography scan of the abdomen was essential for assessment of incisional hernia (90.9%), but not for other hernia types. Bowel compromise drives early surgery, and increasing American Society of Anesthesiology score pushes towards non-operative management. Type of repair was driven by hernia contents, with increasing contamination associated with increased rates of suture repair. Where mesh was proposed in contaminated settings, biological types were preferred. There was variation in the potential use of laparoscopy for groin hernia. CONCLUSIONS: This survey provides a snapshot of current trends in the management of acutely symptomatic hernia. It demonstrates variation across aspects of assessment and repair technique. Additional data are required to inform practice in these areas.

First Report of Tomato yellow leaf curl Thailand virus Associated with Pepper Leaf Curl Disease in Taiwan.

Whitefly-transmitted begomoviruses (family Geminiviridae, genus Begomovirus) cause severe epidemic and high yield losses on pepper (Capsicum annuum) crops in many areas of the world. In Taiwan, pepper plants showing leaf curling, blistering, distortion, mild vein yellowing, and stunting were observed in fields in Tainan County in 2007, but with disease incidence less than 10%. However, disease incidence of more than 70% was observed in some fields in Pingtung, Kaohsiung, Chiayi, and Yunlin counties in 2009. Two symptomatic samples in 2007 and three for each county in 2009 were collected for begomovirus detection. Viral DNA was extracted and tested for the presence of begomoviral DNA-A, DNA-B, and associated satellite DNA by PCR using primer pairs PAL1v1978/PAR1c715 (4), DNABLC1/DNABLV2 (2), and Beta01/Beta02 (1), respectively. The expected 1.5-kb PCR product for DNA-A and 2.6-kb for DNA-B were obtained from all samples. However, DNA-beta was not detectable in any of the samples. One positive sample from each, Pingtung (LG6-2), Kaoshiung (LJ3-5), Tainan (P2-4), Chiayi (SG4-3), and Yunlin (HW2-2), were selected for further molecular characterization of DNA-A and DNA-B. On the basis of the sequences of the 1.5-kb DNA-A and 2.6-kb DNA-B PCR product, specific PCR primers were designed to obtain the complete DNA-A and DNA-B sequences for pepper-infecting begomovirus isolate LG6-2 (GenBank Accession Nos. GU208515 and GU208519), LJ3-5 (GenBank Nos. GU208516 and GU208520), P2-4 (GenBank Nos. EU249457 and EU249458), SG4-3 (GenBank Nos. GU208517 and GU208521), and HW2-2 (GenBank Nos. GU208518 and GU208522). The five isolates each contained the begomoviral conserved nonanucleotide sequence-TAATATTAC in DNA-As and DNA-Bs, six open reading frames (ORFs AV1, AV2, AC1, AC2, AC3, and AC4) in DNA-As, and two open reading frames (ORFs BV1 and BC1) in DNA-Bs. Sequence comparison by MegAlign software (DNASTAR, Inc. Madison, WI) showed that the five pepper-infecting begomovirus isolates had 99% nucleotide sequence identity in DNA-As and DNA-Bs and so they are considered isolates of the same species. BLASTn analysis with begomovirus sequences available in the GenBank database at the National Center for Biotechnology Information (Bethesda, MD) indicated that the DNA-As and DNA-Bs of the five isolates had the highest nucleotide sequence identity of 99% each with the respective DNA-A and DNA-B of Tomato yellow leaf curl Thailand virus (TYLCTHV; GenBank Nos. EF577266 and EF577267), a recently emerging bipartite begomovirus infecting tomato in Taiwan (3). On the basis of the DNA-A sequence comparison and the International Committee on Taxonomy of Viruses demarcation of species at 89% sequence identity, these virus isolates belong to the species TYLCTHV. The isolate P2-4 was found transmissible to C. annuum 'Early Calwonder' by whitefly (Bemisia tabaci biotype B) and induced the same leaf curling, blistering, and mild vein yellowing symptoms as those observed in pepper fields. To our knowledge, this is the first report of a begomovirus infecting pepper in Taiwan. The presence of TYLCTHV in the major pepper-production areas should be taken into consideration for pepper disease management and in developing begomovirus resistant pepper cultivars for Taiwan. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) F.-J. Jan et al. Plant Dis. 91:1363, 2007 (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Complete nucleotide sequences of okra isolates of Cotton leaf curl Gezira virus and their associated DNA-beta from Niger.

Okra (Abelmoschus esculentus) is a major crop in Niger. In the fall of 2007, okra leaf curl disease was observed in Niger and the begomovirus and DNA-beta satellite were found associated with the disease. The complete nucleotide sequences of DNA-A (FJ469626 and FJ469627) and associated DNA-beta satellites (FJ469628 and FJ469629) were determined from two samples. This is the first report of molecular characterization of okra-infecting begomovirus and their associated DNA-beta from Niger. The begomovirus and DNA-beta have been identified as Cotton leaf curl Gezira virus and Cotton leaf curl Gezira betasatellite, respectively, which are reported to also infect okra in Egypt, Mali and Sudan.

Identification of a New Begomovirus Associated with Yellow Leaf Curl Diseases of Tomato and Pepper in Sulawesi, Indonesia.

Whitefly-transmitted geminiviruses (family Geminiviridae, genus Begomovirus) cause severe disease epidemics of tomato and pepper in Indonesia. Four tomato-infecting begomoviruses have been reported from Java Island; Ageratum yellow vein virus (AYVV), Tomato leaf curl Java virus (ToLCJV), Tomato yellow leaf curl Indonesia virus (TYLCIDV), and Pepper yellow leaf curl Indonesia virus (PepYLCIDV) (4). The latter was also found to infect peppers. In 2006, symptoms typical of those caused by begomoviruses, leaf curling, blistering, yellowing, and stunting, were observed in tomato and pepper fields in North Sulawesi with incidence as high as 100%. Three symptomatic tomato leaf samples from each of two fields in the Langowan area and one from each of two fields in the Tompaso area, as well as one pepper sample from each of two fields in the Langowan area and two from a field in the Tompaso area were collected. Using the primer pair PAL1v1978/PAR1c715 (3), a begomovirus DNA-A was detected by PCR in all the tomato samples, in the two pepper samples from Langowan, and in one of the Tompaso pepper samples. A begomovirus DNA-B component or virus-associated satellite DNA were not found in any of the samples by PCR using the DNA-B general primer pairs DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2) and the satellite detection primer pair Beta01/Beta02 (1). The PCR-amplified 1.5-kb fragment from one positive sample each from the four tomato and three pepper fields were sequenced and found to have high nucleotide (nt) sequence identity (>95.0%). An abutting primer pair (IndV: 5'CCCGGATCCTCTAATTCATCCCT3'; IndC: 5'GACGGATCCCACATGTTTGCCA3') was designed to amplify the full-length genomes of the four tomato (GenBank Accession Nos. FJ237614, FJ237615, FJ237616, and FJ237617) and three pepper (GenBank Accession Nos. FJ237618, FJ237619, and FJ237620) begomoviruses. The sequences of all seven begomovirus isolates were 2,750 or 2,751 bp long and contained the conserved nonanucleotide sequence-(TAATATTAC), two open reading frames (ORFs) in the virion-sense and four ORFs in the complementary sense. Sequence comparisons using MegAlign software (DNASTAR, Madison, WI) showed the four tomato and three pepper isolates to have high nt identity (>95.1%). BLASTn analysis and comparison of the sequences with others available in the GenBank database ( www.ncbi.nlm.nih.gov ) show that the isolates of this study have the highest nt sequence identity (66.5%) with PepYLCIDV (Accession No. DQ083765) and less than 66.5% nt identity with other begomoviruses including those reported from Indonesia. On the basis of the currently accepted begomovirus species demarcation threshold of 89% nt identity, the tomato and pepper begomovirus isolates from North Sulawesi constitute a distinct species in the genus Begomovirus for which the name Tomato leaf curl Sulawesi virus (ToLCSuV) is proposed. Phylogenetic analysis shows the ToLCSuV isolates form a cluster distinct from other Indonesian begomoviruses as well as begomoviruses from the neighboring Philippines. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) W. S. Tsai et al. Plant Dis. 90:831, 2006.

First Report and Molecular Characterization of DNA A of Three Distinct Begomoviruses Associated with Tomato Leaf Curl Disease in Ghana.

Tomato leaf curl disease is reported to be widespread in Ghana and to cause severe yield losses (4). So far, the causal agent has not been identified. Thirty-three tomato (Solanum lycopersicum L.) samples with symptoms such as curling, yellowing, small leaves, and stunting were collected from the Ashanti Region, the main tomato-production area in Ghana, including three samples from Akumandan in the autumn of 2007 and 30 samples from Kumasi in the spring of 2008. The observed leaf curl disease incidence in the farmer's field in Kumasi was approximately 75%. Viral DNAs were extracted from the 33 samples and tested for the presence of begomoviral DNA-A, DNA-B, and associated satellite DNA by PCR with previously described primers (1,3). The expected 1.4-kb DNA-A begomovirus fragment was obtained from one of the samples from Akumadan and from 25 samples from Kumasi. DNA-B and DNA-beta were not detected by PCR. The 1.4-kb PCR products from all positive samples were cloned and sequenced. Sequence comparison by MegAlign software (DNASTAR, Inc., Madison, WI) showed three distinct virus groups. One isolate from each group was selected and specific primers were designed to complete the DNA-A sequence. The DNA-As of GH5-3 (group 1), GOTB2-2 (group 2), and GHK2 (group 3) isolates consisted of 2,803 (GenBank Accession No. EU350585), 2,794 (GenBank Accession No. EU847739), and 2,792 nt (GenBank Accession No. EU847740) respectively. All contain the geminiviral conserved nonanucleotide sequence TAATATTAC in the intergenic region and the six predicted open reading frames (ORFs V1, V2, C1, C2, C3, and C4). BLASTn analysis was conducted with geminivirus sequences available in the GenBank database at National Center for Biotechnology Information (Bethesda, MD). Further sequence comparisons were performed by Clustal V algorithm of MegAlign software with the representative isolates of begomovirus species reported by Fauquet et al (2) and the sequences that showed high scores in BLASTn search. The DNA-A sequence of isolate GHK2 from Kumasi showed highest sequence identity (96.5%) with Tomato yellow leaf curl Mali virus (TYLCMLV; GenBank Accesssion No. AY502934). The DNA-A sequence of GH5-3 and GOTB2-2 isolates had 87.5% sequence identity with each other. Both had highest sequence identities of 76.7 and 77.6%, respectively, with Tomato leaf curl Antsiranana virus, Madagascar (GenBank Accession No. AM701764). They constitute two distinct begomovirus species based on DNA-A sequence comparisons and the International Committee on Taxonomy of Viruses proposed species demarcation of 89% sequence identity. The names Tomato leaf curl Ghana virus for isolate GH5-3 and Tomato leaf curl Kumasi virus for isolate BOTB2-2 are proposed, respectively. To our knowledge, this is the first report of molecular characterization of begomoviruses associated with tomato leaf curl disease in Ghana and of the presence of three distinct tomato begomoviruses. This presence should be considered for recommending or developing stable begomovirus resistant tomato cultivars for Ghana. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) C. M. Fauquet et al. Arch. Virol. 153:783, 2008. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) D. Horna et al., eds. Online publication. Int. Food Policy Res. Inst. PBS Policy Brief 2, 2007.

Occurrence and Molecular Characterization of Squash leaf curl Phillipines virus in Taiwan.

Whitefly-transmitted, cucurbit-infecting begomoviruses (genus Begomovirus, family Geminiviridae) have been detected on cucurbit crops in Bangladesh, China, Egypt, Israel, Malaysia, Mexico, the Philippines, Thailand, United States, and Vietnam. Pumpkin plants showing leaf curling, blistering, and yellowing symptoms were observed in the AVRDC fields (Tainan, Taiwan) during 2001 and in nearby farmers' fields during 2005. Two samples from symptomatic plants were collected in 2001 and six collected in 2005. Viral DNAs were extracted (2), and the PCR, with previously described primers, was used to detect the presence of begomoviral DNA-A (4), DNA-B (3), and associated satellite DNA (1). Begomoviral DNA-A was detected in one of the 2001 samples and in all 2005 samples. The PCR-amplified 1.5 kb viral DNA-A from one positive sample each from the 2001 and 2005 collections was cloned and sequenced. On the basis of the 1.5-kb DNA-A sequences, specific primers were designed to completely sequence the DNA-A component. The overlap between fragments obtained using primer walking ranged from 43 to 119 bp with 100% nt identities. The complete DNA-A sequences were determined for the two isolates as 2,734 bp (2001) (GenBank Accession No. DQ866135) and 2,733 bp (2005) (GenBank Accession No. EF199774). Sequence comparisons and analyses were performed using the DNAMAN Sequence Analysis Software (Lynnon Corporation, Vaudreuil, Quebec, Canada). The DNA-A of the begomovirus isolates each contained the conserved nanosequence-TAATATTAC and six open reading frames, including two in the virus sense and four in the complementary sense. On the basis of a 99% shared nucleotide sequence identity, they are considered isolates of the same species. BLASTn analysis and a comparison of the sequence with others available in the GenBank database ( http://www.ncbi.nlm.nih.gov ) indicated that the Taiwan virus shared its highest nt identity (more than 95%) with the Squash leaf curl Philippines virus (GenBank Accession No. AB085793). Virus-associated satellite DNA was not found in any of the samples. DNA-B was found in both samples, providing further evidence that the virus was the same as the bipartite Squash leaf curl Philippines virus. To our knowledge, this is the first report of Squash leaf curl Philippines virus in Taiwan. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) R. L. Gilbertson et al. J. Gen. Virol. 72:2843, 1991. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

First Report of Tomato yellow leaf curl Thailand virus in Taiwan.

During the 2006 winter and 2007 spring seasons, tomato lines carrying the Ty2 gene, which confers resistance to the Tomato leaf curl Taiwan virus (GenBank Accession No. U88692), showed severe yellowing, leaf curl, and stunting symptoms in several locations in Tainan County, Taiwan. Whiteflies were found to be associated with symptomatic plants, and disease incidences of almost 100% were observed. The presence of a new resistance breaking begomovirus was suspected. Six symptomatic leaf samples of three different tomato plants from each infected field were collected in Liouying (LY3, 7, and 8) and Sigang (SG9, 13, and 18) townships in Tainan County. Viral DNAs were extracted (2), and PCR with previously described primers was used to detect the presence of begomoviral DNA-A (4), DNA-B (3), and associated satellite DNA (1). Begomoviral DNA-A was detected in all tested samples. The PCR-amplified 1.5-kb viral DNA-A from one positive sample from each location (LY3 and SG18) was cloned and sequenced. On the basis of the 1.5 kb DNA-A sequences, specific primers were designed for cloning and sequencing the complete viral DNA-A, which was 2,744 bp for both the Liouying (GenBank Accession No. EF577266) and Sigang (GenBank Accession No. EF577264) isolates. Sequence analyses were conducted with DNAMAN sequence analysis software (Lynnon Corporation, Vaudreuil, Quebec, Canada). The DNA-A of both isolates contained the conserved nanonucleotides-TAATATTAC and six open reading frames, including two in the virus sense (AV1 and AV2) and four in the complementary sense (AC1 to AC4). On the basis of their 99.5% nucleotide identity, they are considered isolates of the same species. BLASTn analysis and sequence comparison with those available in the GenBank database ( http://www.ncbi.nlm.nih.gov ) indicated that the two isolates had the highest nucleotide identity (more than 98.4%) with the DNA-A of the Tomato yellow leaf curl Thailand virus (TYLCTHV; GenBank Accession No. AY514631). Virus-associated satellite DNA was not found in any of the samples. However, DNA-B was detected in all six samples, providing further evidence that the two isolates were the same as the bipartite TYLCTHV. All samples, except the LY3, were also found to be infected with Tomato leaf curl Taiwan virus (ToLCTWV), as indicated by a positive PCR reaction using the ToLCTWV-specific primer pair KD-PAV1 (5'ATCGTGTTGGGAAGAGGTTT3') and KD-PAC1 (5'GGAGAAAGCTCCCAAAGATT3'). A pure TYLCTHV isolate of LY3 was obtained in Lycopersicum esculentum TK70 by transmission with Bemisia tabaci Biotype B. The isolated TYLCTHV was found to infect L. esculentum H24 (resistant to ToLCTWV) and induce typical yellow leaf curl symptoms. To our knowledge, this is the first report of the presence of TYLCTHV in Taiwan. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) R. L. Gilbertson et al. J. Gen. Virol. 72:2843, 1991. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Molecular Characterization of a Distinct Begomovirus Associated with Tomato Leaf Curl Disease in Arusha of Tanzania.

Mild leaf curling and yellowing symptoms were observed in approximately 5% of 1-month-old tomato plants (Solanum lycopersicum) in a farmer's field in Tengeru, Arusha, Tanzania in January 2006. DNA was extracted from four symptomatic and five asymptomatic plants and tested for the presence of begomovirus by polymerase chain reaction (PCR) using primer pair PAL1v1978/PAR1c715 (4). All asymptomatic samples were negative. Two of four symptomatic samples yielded the expected 1.4-kb DNA-A fragment for begomovirus. DNA-B was not detected in these two samples by PCR using the DNA-B degenerate primer pairs DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2), and PBL1v2040/PCRc1 and PBL1v2040/PCRc154 (4). DNA-beta was also not detectable using DNA-beta specific primers (1). The 1.4-kb PCR product from one sample was cloned and sequenced. On the basis of the sequence of the 1.4-kb DNA product, specific primers were designed to complete the DNA-A sequence. The DNA-A consisted of 2,766 nucleotides (Genbank Accession No. DQ519575) and was found to contain the geminiviral conserved nanosequence-TAATATTAC in the intergenic region and the six predicted open reading frames (V1, V2, C1, C2, C3, and C4). BLAST analysis was conducted with geminivirus sequences available in GenBank, and MegAlign software (DNASTAR, Inc, Madison, WI) was used for further comparisons. Highest sequence identity (84%) was with the partially sequenced Tomato leaf curl Tanzania virus found in Makutupora, Tanzania in 1994 (1,523 nucleotides, Genbank Accession No. U73498) in the 1,919 nt to 679 nt region. Low sequence identity (78%) was noted with Tomato yellow leaf curl Sardinia virus (Genbank Accession No. X61153) that is reportedly prevalent in Arusha, Morogoro, Dodoma, Iringa, Kilimanjaro, and Dar es Salaam of Tanzania (3). Comparison of the nucleotide sequence of this new virus with those of full-length begomoviral DNA-A available in GenBank indicated highest sequence identity (81%) with Tomato leaf curl Mayotte virus (EMBL Accession No. AJ865341). On the basis of the DNA-A sequence comparisons and the International Committee on Taxonomy of Viruses proposed species demarcation of 89% sequence identity, the tomato leaf curl virus from Arusha, Tanzania constitutes a distinct begomovirus and the name Tomato leaf curl Arusha virus is proposed. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) B. D. Kashina et al. Arch. Phytopathol. Plant Prot. 35:255, 2002 (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Molecular Characterization of a Begomovirus Associated with Tomato Leaf Curl Disease in Uganda.

During the summer of 2003, leaf curl symptoms were observed in tomato (Lycopersicon esculentum) plantings in the Iganga District of Uganda. Begomoviral infection was suspected. Twelve symptomatic samples were collected. Begomoviral DNA was extracted and amplified using polymerase chain reaction (PCR) with the begomovirus-specific degenerate primer pair PAL1v1978/PAR1c715 (4). The expected 1.4-kb PCR products were obtained from 11 of 12 samples. The 1.4-kb PCR product of one of the samples was cloned and sequenced. Based on the sequence of the 1.4-kb DNA product, specific primers were designed to complete the DNA-A sequence. The DNA-A consisted of 2,747 nucleotides (GenBank Accession No. DQ127170) and was found to contain seven predicted open reading frames (ORFs V1, V2, C1, C2, C3, C4, and C5). A BLAST analysis was conducted with geminivirus sequences available in the GenBank database at the National Center for Biotechnology Information (Bethesda, MD), and MegAlign (DNASTAR, Inc, Madison, WI) software was used for further comparisons. The DNA-A sequence of the virus associated with leaf curl of tomato from Uganda showed less than 79% sequence identity with cassava mosaic viruses from Uganda (GenBank/EMBL Accession Nos. AF126800, AF126802, AF126804, AF126806, and Z83257), the only begomoviruses from the country so far in the public domain. Highest sequence identity (83%) was with Tomato leaf curl Mayotte virus from Dembeni, Mayotte, Comoros Islands (ToLCYTV-[Dem], EMBL Accession No. AJ865341). Pairwise comparison with ToLCYTV-[Dem] showed 60, 88, 91, 82, 84, 86, and 80% sequence identities in the intergenic region, V2, V1, C1, C2, C3, and C4 ORFs, respectively. Only low sequence identities (ranging from 71 to 82%) were obtained with other tomato bego-moviruses reported from Africa (GenBank/EMBL Accession Nos. AF261885, AJ865337-AJ865340, AY044137-AY044139, AY502934, AY502936, AY594174, AY736854, and U73498). There was no evidence for the presence of DNA-B or DNA-beta using PCR with the DNA-B specific primer pairs DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2) and the DNA-beta primer pair Beta01/Beta02 (1), respectively. Detection of possible recombination was by RDP2 software (3) using DNA-A sequences of begomoviruses from Uganda and tomato begomoviruses from Africa. The DNA-A was found to contain a small recombinant fragment from ToLCYTV-[Dem] in the 411 to 969 nucleotide position with 92% sequence identity. Based on DNA-A sequence comparisons, the tomato leaf curl virus from Uganda most likely constitutes a distinct new begomovirus. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) D. P. Martin et al. Bioinformatics 21:260, 2005. (4) M. R. Rojas et al. Plant Dis.77:340, 1993.

First Report of a Begomovirus Associated with Tomato Yellow Leaf Curl Disease in Ethiopia.

During December 2003, severe leaf yellowing, leaf curling, and stunting symptoms were observed in tomato (Lycopersicon esculentum) plantings in Melkassa (1,550 m above sea level), Ethiopia. Eleven symptomatic samples were collected and tested for the presence of a begomovirus using polymerase chain reaction (PCR) with the begomovirus-specific degenerate primer pair PAL1v1978/PAR1c715 (3). Samples were also tested for Cucumber mosaic virus (CMV), Potato virus Y (PVY), Tobacco etch virus (TEV), Pepper veinal mottle virus (PVMV), and Tomato mosaic virus (ToMV) using enzyme-linked immunosorbent assay (ELISA). All samples were negative for CMV, PVY, TEV, PVMV, and ToMV. However, the expected 1.4-kb PCR product for begomoviruses was obtained from all samples. DNA-B and DNA-beta were not detectable using PCR with the DNA-B specific primer pairs DNABLC1/DNABLV2 and DNABLC2/ DNABLV2 (2) and the DNA-beta primer pair Beta01/Beta02 (1), respectively. The 1.4-kb PCR product of one sample was cloned and sequenced. On the basis of the sequence of the 1.4-kb DNA product, specific primers were designed to complete the DNA-A sequence. The DNA-A consisted of 2,785 nucleotides (GenBank Accession No. DQ358913) and was found to contain the six predicted open reading frames (ORFs V1, V2, C1, C2, C3, and C4). A BLAST analysis was conducted with geminivirus sequences available in the GenBank database at the National Center for Biotechnology Information (Bethesda, MD), and DNAMAN software (Lynnon Corporation, Quebec, Canada) was used for further comparisons. The DNA-A sequence of the virus associated with yellow leaf curl disease of tomato from Ethiopia showed highest sequence identity (92%) with Tomato yellow leaf curl Mali virus (TYLCMLV; GenBank Accession No. AY502934). On the basis of the DNA-A sequence comparison and the ICTV demarcation of species at 89% sequence identity, the Ethiopian virus is a provisional strain of TYLCMLV described from Mali. To our knowledge, this is the first report of a begomovirus associated with tomato yellow leaf curl disease in Ethiopia. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Molecular Characterization of a Distinct Tomato-Infecting Begomovirus Associated with Yellow Leaf Curl Diseased Tomato in Lembang, Java Island of Indonesia.

Three distinct tomato-infecting begomoviruses have been identified from Indonesia (GenBank Accessions Nos. AB100304, AB100305, and DQ083765). Severe yellow leaf curl epidemics have been observed on tomato on Java Island since the late 1990s. Viral DNA was extracted (2) from one such sample collected in Lembang, West Java in 1998. Polymerase chain reaction with previously described primers was used to detect the presence of geminiviral DNA-A (4), DNA-B (3), and associated satellite DNA (1). The predicted 1.4-kb DNA-A fragment was amplified with the general primer pair PAL1v1978/PAR1c715 and then cloned and sequenced. DNA-B and satellite DNA were not detected in the sample. On the basis of the partial DNA-A sequences, specific primers were designed to amplify and sequence the complete DNA-A component (2,762 nucleotides, GenBank Accession No. AF189018). The DNA-A sequence contained the geminivirus-conserved nanosequence TAATATTAC in the loop of the hairpin structure of the intergenic region and six open reading frames including two in the virus sense and four in the complementary sense. Pairwise comparison of the full-length DNA-A sequence with those of other begomoviruses available in the GenBank database was done by the MegAlign software (DNASTAR, Inc, Madison, WI). Highest nucleotide sequence identity (74.1%) was with Tomato leaf curl Mayotte virus-[Kahani] (GenBank Accession No. AJ865340). Comparison of the full-length DNA-A sequence with the three above mentioned tomato-infecting begomoviruses from Indonesia also showed less than 71% nucleotide sequence identities. Because the DNA-A sequence had less than 89% identity with other begomoviruses, it should be classified as a distinct virus according to the International Committee on Taxonomy of Viruses. The name Tomato yellow leaf curl Indonesia virus-[Lembang] (TYLCIDV-[Lem]) is proposed. The presence of at least four distinct tomato-infecting begeminiviruses on Java Island needs to be considered when developing tomato cultivars with stable resistance to tomato (yellow) leaf curl disease. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) R. L. Gilbertson et al. J. Gen. Virol. 72:2843, 1991. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Molecular Characterization of Pepper yellow leaf curl Indonesia virus in Leaf Curl and Yellowing Diseased Tomato and Pepper in Indonesia.

Yellowing and leaf curl symptoms were observed in tomato and pepper fields near Bogor, Java, Indonesia in 2000. Samples were collected from one diseased tomato (Lycopersicum esculentum) and three diseased chili pepper (Capsicum annuum) plants. Viral DNA was extracted (2) and tested for the presence of geminiviral DNA-A, DNA-B, and associated satellite DNA using polymerase chain reaction (PCR) with previously described primers (1,3,4). The begomovirus DNA-A general primer pair PAL1v1978/PAR1c715 amplified the predicted 1.4-kb DNA fragment from the tomato and two of the chili samples. DNA-B and satellite DNA were not detected using PCR with DNA-B general primer pairs (DNABLC1/DNABLV2 and DNABLC2/DNABLV2) and satellite detection primer pair (Beta01/Beta02). The amplicons from the tomato and from one of the chili samples were cloned and sequenced. On the basis of the 1.4-kb DNA sequences, specific primers were designed to complete the DNA-A sequences. Following sequence assembly, the full-length DNA-A nucleotide sequences were determined as 2,744 nt (GenBank Accession No. DQ083765) for the tomato- and 2,743 nt (GenBank Accession No. DQ083764) for the chili-infecting begomoviruses. Sequence comparisons and analyses were conducted using the DNAMAN sequence analysis software (Lynnon Corporation, Quebec, Canada). The DNA-A of both begomoviruses contained six open reading frames, including two in the virus sense and four in the complementary sense, and the geminivirus conserved nanosequence-TAATATTAC in the loop of the hairpin structure of the intergenic region. Because of their high nucleotide sequence identities of 99%, the tomato- and chili-infecting begomovirus are considered the same virus. When compared by using BLAST with available gem-iniviral sequences in the GenBank database, the DNA-A sequences of the tomato and the chili isolates showed highest nucleotide sequence identity (95%) with the partially sequenced Pepper yellow leaf curl Indonesia virus (GenBank Accession No. AB189849) in the 1,842 nt to 660 nt region and in the 1,841 nt to 659 nt region, respectively. Comparisons with full-length DNA-A sequences of begomoviruses available in the GenBank database indicated high sequence identities of 76 and 77% for the tomato and chili isolates, respectively, with an eggplant isolate of Tomato yellow leaf curl Kanchanaburi virus (GenBank Accession No. AF511530) from Thailand. According to our knowledge, this is the first report of full-length DNA-A sequence of the Pepper yellow leaf curl Indonesia virus and its natural occurrence in tomato and pepper in the Bogor area of Indonesia. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) R. L. Gilbertson et al. J. Gen. Virol. 72:2843, 1991. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Medical students' attitudes toward the elderly.

A study was designed to examine the relationship between students' attitudes, their willingness to work with elderly patients, and the impact of a geriatric rotation on a randomly selected subset of the group. A pretest/post-test design was used in which 148 third-year medical students completed a multidimensional questionnaire on two occasions eight weeks apart. Highly significant correlations were found between the expressed intention of the student to work with the elderly and positive feelings about previous professional contact (r = .26, P less than .001), previous personal contact (r = .17, P less than .002), belief that working with the elderly is rewarding (r = .30, P less than .0001), high degree of comfort in working with the elderly (r = .21, P less than .01), and positive stereotypes about the elderly (r = .14, P less than .05). Despite the students' positive rating of the geriatric rotation, multiple regression analysis indicated that the best predictor of an index of intentions to work with elderly patients on the post-test was this same index of intentions on the pretest (multiple r = .58, P less than .001). These findings, as well as the actual attitudes and stereotypes held by the students, have major implications for the planning and development of medical students' experiences in geriatrics.

A New Geminivirus Associated with a Leaf Curl Disease of Tomato in Tanzania.

Leaf samples of tomato exhibiting yellow mottle, severe leaf curl, stunting, and upright stems were collected from Makutupora, Tanzania, in October 1994 by L. L. Black (AVRDC). Leaf tissue squashes on nylon membranes did not hybridize with DNA-A probes from tomato yellow leaf curl geminiviruses (TYLCVs) from Thailand (Thai) or Egypt (EG), an isolate of TYLCV-Isr (Israel). Polymerase chain reaction (PCR) with primer pair PAC1v1978/PAV1c715 (2), which specifically amplifies part of the rep (AC1) open reading frame (ORF), the intergenic region, and the cp (AV1) ORF of whitefly-transmitted geminiviruses, yielded a 1.5-kb fragment from a DNA extract of symptomatic tomato leaves. No virus-specific fragments were amplified from symptomless tomato leaves. The nucleotide sequence (GenBank accession no. U73478) of the PCR fragment (recombinant plasmid pAF1) was compared with the sequences of seven distinct subgroup III geminiviruses that infect tomato (1)-TYLCV-Isr, TYLCV-Sar (Sardinia), TYLCV-Thai, tomato leaf curl virus (TLCV)-;Aus (Australia), IndTLCV (India), TLCV-Ind (Bangalore I), and TLCV-Tai (Taiwan)-as well as three other subgroup III geminiviruses from the Old World: Indian cassava mosaic virus, African cassava mosaic virus, and mung bean yellow mosaic virus. Nucleotide sequence identities for the pairwise comparisons of the rep ORF (692 nucleotides) and the intergenic region (169 nucleotides) of this Tanzanian geminivirus with those of the 10 Old World geminiviruses showed low nucleotide identities, which were <79% for the rep ORF and <67% for the intergenic region. Since isolates of the same geminivirus usually have nucleotide sequence identities >90% (1), this Tanzanian geminivirus is considered to be different from all previously characterized Old World geminiviruses and is given the name TLCV-Tan. Further, tissue squash blots of samples previously collected from other areas in Tanzania gave strong positive reactions with the TYLCV-EG probe, so yet another geminivirus closely related to TYLCV-Isr may be present. References: (1) M. Padidam et al. J. Gen. Virol. 76:249, 1995. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993.

First Report of the Occurrence of Tomato chlorosis virus and Tomato infectious chlorosis virus in Taiwan.

Pronounced yellowing symptoms on the lower leaves of tomato plants, similar to those caused by nitrogen deficiency, were observed in the spring of 1998 in The Asian Vegetable Research and Development Center and in farmers' fields in southern Taiwan. However, the brittleness of the discolored leaves, occasional upward leaf rolling, and abundance of whiteflies on these plants suggested the involvement of Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV) that belong to the group of whitefly-transmitted, phloem-limited criniviruses (family Closteroviridae). Leaves of symptomatic and healthy plants were collected, and total nucleic acids were extracted from 0.2 g of leaf tissue (1). The total nucleic acids were precipitated by ethanol and dissolved in 160 µl of sterile water. Eight microliters of total nucleic acids were observed on positively charged nylon membranes (Roche Diagnostic GmbH, Roch Applied Science, Germany). Two digoxigenin-labeled riboprobes, transcribed from pTIC8-44 (complementary to the 3'-end region of TICV RNA 1) and pToC 78 (corresponding to the coat protein region of ToCV RNA 2), were used in hybridization tests to detect TICV and ToCV, respectively (2). Six of seventeen symptomatic tomato plant samples were positive with the ToCV probe, whereas none of the 13 samples reacted with the TICV probe. Similar symptoms as described above for tomato were observed on zinnia plants in the same locations. Five of eight zinnia samples gave a positive reaction with the ToCV probe. One of the ToCV positive samples also gave a positive reaction with the TICV probe. Electron microscopic examination from leaf-dip preparations of ToCV-positive leaf tissues, stained in 1% uranyl acetate, showed the presence of flexuous filamentous particles approximately 800 to 850 nm long. To our knowledge, this is the first evidence of the presence of ToCV and TICV in zinnia and ToCV in tomato in Taiwan. References: (1) A. Hadidi et al. J. Virol. Methods 30:261, 1990. (2) G. C. Wisler et al. Phytopathology 88:402, 1998.

Molecular Characterization of a New Begomovirus Associated with Tomato Yellow Leaf Curl and Eggplant Yellow Mosaic Diseases in Thailand.

Leaf curl and yellowing symptoms on tomato, and yellow mosaic symptoms on eggplant, are frequently observed in Kanchanaburi Province, Thailand. DNA was extracted from leaves of 13 symptomatic tomato and six symptomatic eggplant samples by the method of Gilbertson et al (1). Viral DNA was amplified by polymerase chain reaction (PCR) using the begomovirus-specific degenerate primer pair PAL1v1978/PAR1c715 (3), which amplified a 1.4-kb fragment of DNA-A. All samples, except one eggplant sample, yielded the expected product. The 1.4-kb PCR products of one tomato and one eggplant sample were cloned and sequenced. Both begomoviruses from tomato and eggplant contained a DNA-B component, amplified using two degenerate primer pairs, DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2). Based on sequences of the DNA products amplified by the degenerate primer pairs, specific primers were designed to complete the DNA-A and DNA-B sequences. Computer-assisted sequence comparisons were performed with geminivirus sequences available in the laboratory at the Asian Vegetable Research and Development Center, Taiwan and in the GenBank sequence database. Both tomato (GenBank Accession Nos. AF511529 and AF511528) and eggplant (GenBank Accession Nos. AF511530 and AF511527) virus isolates contain the conserved geminivirus sequence-TAATATTAC on the DNA-A and B. Based on the high sequence identities of 99% DNA-A and 98% DNA-B, these two virus isolates are considered to be the same species. Although the genome organization of these two isolates was the same as Tomato yellow leaf curl virus Thailand (TYLCTHV; GenBank Accession Nos. X63015 and X63016), including six open reading frames (ORFs) on the DNA-A (AV1, AV2, AC1, AC2, AC3, and AC4) and two ORFs on the DNA-B (BV1 and BC1), sequence comparisons showed highest DNA-A sequence identity (73%) with Ageratum yellow vein virus from Singapore (GenBank Accession No. X74516) and highest DNA-B identity (77%) with the TYLCTHV (X63016). To our knowledge, these tomato- and eggplant-infecting viruses from Thailand constitute a distinctly novel bipartite Begomovirus species. References: (1) R. L. Gilbertson et al. J. Gen. Virol. 72:2843, 1991. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Molecular Characterization of Tomato and Chili Leaf Curl Begomoviruses from Pakistan.

Leaf curl or yellowing symptoms, typical of those caused by begomovirus infection, are commonly observed in chili (Capsicum annuum) and tomato (Lycopersicon esculentum) plantings in Pakistan. One chili sample with leaf curl symptoms was collected in 1998 in Multan (Punjab Province), and two tomato samples with leaf curl and yellowing symptoms were collected from Islamabad and Dargai (North West Frontier Province) in 2000 and 2001, respectively. Virus DNA was first amplified by polymerase chain reaction using the degenerate primer pair PAL1v1978/PAR1c715 (3). The expected 1.4-kb PCR products were obtained from the three samples. Based on the sequences of the 1.4-kb DNA products, specific primers were designed to complete each of the DNA-A sequences. Two primer pairs, DNABLC1/DNABLV2 and DNABLC2/DNABLV2, were used for the detection of DNA-B (2). The genome of the tomato leaf curl isolate from Islamabad contained a DNA-A of 2,739 nucleotides (GenBank Accession No. AF448059), a DNA-B of 2,728 nucleotides (GenBank Accession No. AY150304), and had 94% nucleotide identity in the common region. The genome of the tomato leaf curl isolate from Dargai contained a DNA-A of 2,740 nucleotides (GenBank Accession No. AF448058), a DNA-B of 2,686 nucleotides (GenBank Accession No. AY150305), and had 96% nucleotide identity in the common region. Each of the tomato isolates contained eight predicted open-reading frames (ORFs) (AV1, AV2, AV3, AC1, AC2, AC3, AC4, and AC5) in the DNA-A and two predicted ORFs (BV1 and BC1) in the DNA-B. The DNA-A nucleotide sequence identity of the Islamabad isolate and Dargai tomato isolate is 96% and that of DNA-B is 88%. Sequence comparisons with begomovirus sequences available in the GenBank sequence database showed that these two tomato virus isolates had the highest sequence identity with Tomato leaf curl New Delhi virus-Severe (GenBank Accession No. U15015) from northern India (more than 95% for DNA-A and less than 90% for DNA-B). The DNA-A of the virus associated with chili leaf curl from Pakistan (GenBank Accession No. AF336806) consists of 2,754 nucleotides, containing six predicted ORFs (AV1, AV2, AC1, AC2, AC3, and AC4). The chili virus was unrelated to the two tomato begomovirus isolates from Pakistan, with which it shares less than 75% nucleotide identity. Sequence comparisons show highest sequence identity (87%) with Tomato leaf curl Bangladesh virus (GenBank Accession No. AF188481). DNA-beta of 1.3 kb was detected in the chili begomovirus isolate using Beta01/Beta02 primers (1). There was no evidence for the presence of a DNA-B in the chili begomovirus isolate when tested by the two DNA-B specific primer pairs. Based on DNA sequence comparisons, the chili leaf curl virus from Pakistan, to our knowledge, constitutes a distinct, new monopartite begomovirus. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Molecular Characterization of a New Tomato Begomovirus from India.

The Asian Vegetable Research and Development Center's (AVRDC) tomato breeding lines derived from Lycopersicon hirsutum f. glabratum B 6013 × L. esculentum H-24 and carrying the Ty-2 resistance gene located on chromosome 11 are tolerant to tomato leaf curl disease in Karnataka State, southern India (3), where several isolates of Tomato leaf curl Virus-Bangalore (GenBank Accession Nos. L11746, Z48182, and AF165098) and Tomato leaf curl virus-Karnataka (GenBank Accession No. U38239) are reported to infect tomatoes. The only area in south and southeast Asia where these AVRDC tomato breeding lines were found susceptible to begomovirus infection is Thailand, where several bipartite Tomato yellow leaf curl virus isolates (GenBank Accession Nos. X63015, X63016; AF141922, AF141897; and AF511529, AF511528) are reported to be prevalent. However, in field trials conducted in the fall of 1999 in Bodeli, Gujarat State, western India, the AVRDC breeding lines showed typical symptoms of begomovirus infection, such as leaf curling and vein clearing. The presence of a different tomato begomovirus was suspected. Viral DNA from a symptomatic plant from Bodeli was amplified by polymerase chain reaction (PCR) using the begomovirus-specific degenerate primer pair PAL1v1978/PAR1c715 (4) and the expected 1.4-kb PCR product was obtained. Based on the sequence of the 1.4-kb DNA product, specific primers were designed to complete the DNA-A sequence. The DNA-A of the virus associated with tomato leaf curl from Bodeli consists of 2,759 nucleotides (GenBank Accession No. AF413671) and contains six open reading frames (ORFs V1, V2, C1, C2, C3, and C4). The DNA-A sequence of the Bodeli isolate had highest sequence identities of 98 and 98.3%, respectively, with viruses causing tomato leaf curl from Varanasi, Uttar Pradesh State, northern India (GenBank Accession No. AF449999) collected in the fall of 1999 and Panchkhal, Nepal (GenBank Accession No. AY234383) collected in early 2000. There was no evidence for the presence of DNA-B in the Bodeli, Panchkhal, or Varanasi virus isolates using DNA-B specific primer pairs DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2). However, a 1.3-kb DNA-beta was detected in the Panchkhal and Varanasi isolates using the primer pair Beta01/Beta02 (1). Sequence comparisons with begomovirus sequences available in the GenBank database showed that these three virus isolates and GenBank Accession No. AY190290 collected in 2001 from Varanasi shared more than 97% sequence identity with each other and should be considered closely related strains of the same virus. These four virus isolates belong to a new distinct tomato geminivirus species because their sequences share less than 88% sequence identities with the next most closely related virus, Tomato leaf curl virus-Karnataka (GenBank Accession No. U38239). This new tomato leaf curl virus is prevalent in western India, northern India, and Nepal. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) V. Muniyappa et al. HortScience 37:603, 2002. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Molecular Characterization of Begomoviruses Associated with Leafcurl Diseases of Tomato in Bangladesh, Laos, Malaysia, Myanmar, and Vietnam.

Production of tomato (Lycopersicon esculentum) in Bangladesh, Malaysia, Myanmar, Vietnam, and Laos has been severely affected by yellow leaf curl disease. Tomato leaf samples were collected from symptomatic tomato plants from farmers' fields in the five countries from 1997 to 1999. DNA was extracted from all samples, four from Vietnam, two each from Malaysia, Laos, and Myanmar, and seven from Bangladesh. Virus DNA was amplified by polymerase chain reaction (PCR) using the begomovirus-specific degenerate primer pair PAL1v 1978/PAR1c 715(1), which amplifies the top part of DNA A. All samples gave the expected 1.4-kb PCR product. The PCR product of one sample per country was cloned and sequenced. Based on the sequences of the 1.4-kb DNA products amplified by the first primer pair, specific primers were designed to complete each of the DNA A sequences. Computer-assisted sequence comparisons were performed with begomovirus sequences available in the laboratory at the Asian Vegetable Research and Development Center, Shanhua, Tainan, and in the GenBank sequence database. The five DNA species resembled DNA A of begomoviruses. For the detection of DNA B two degenerate primer pairs were used, DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (DNABLC1: 5'-GTVAATGGRGTDCACTTCTG-3', DNABLC2: 5'-RGTDCACTT CTGYARGATGC-3', DNABLV2: 5'-GAGTAGTAGTGBAKGTTGCA-3'), which were specifically designed to amplify DNA B of Asian tomato geminiviruses. Only the virus associated with yellow leaf curl of tomato in Bangladesh was found to contain a DNA B component, which was detected with the DNABLC1/DNABLV2 primer pair. The DNA A sequence derived from the virus associated with tomato yellow leaf curl from Myanmar (GenBank Accession No. AF206674) showed highest sequence identity (94%) with tomato yellow leaf curl virus from Thailand (GenBank Accession No. X63015), suggesting that it is a closely related strain of this virus. The other four viruses were distinct begomoviruses, because their sequences shared less than 90% identity with known begomoviruses of tomato or other crops. The sequence derived from the virus associated with tomato yellow leaf curl from Vietnam (GenBank Accession No. AF264063) showed highest sequence identity (82%) with the virus associated with chili leaf curl from Malaysia (GenBank Accession No. AF414287), whereas the virus associated with yellow leaf curl symptoms in tomato in Bangladesh (GenBank Accession No. AF188481) had the highest sequence identity (88%) with a tobacco geminivirus from Yunnan, China (GenBank Accession No. AF240675). The sequence derived from the virus associated with tomato yellow leaf curl from Laos (GenBank Accession No. AF195782) had the highest sequence identity (88%) with the tomato begomovirus from Malaysia (GenBank Accession No. AF327436). This report provides further evidence of the great genetic diversity of tomato-infecting begomoviruses in Asia. Reference: M. R. Rojas et al. Plant Dis. 77:340, 1993.