RESUMO
BACKGROUND: Retinal detachment (RD) is a vision-threatening disorder of significant severity. Individuals with high myopia (HM) face a 2 to 6 times higher risk of developing RD compared to non-myopes. The timely identification of high myopia-related retinal detachment (HMRD) is crucial for effective treatment and prevention of additional vision impairment. Consequently, our objective was to streamline and validate a machine-learning model based on clinical laboratory omics (clinlabomics) for the early detection of RD in HM patients. METHODS: We extracted clinlabomics data from the electronic health records for 24,440 HM and 5607 HMRD between 2015 and 2022. Lasso regression analysis assessed fifty-nine variables, excluding collinear variables (variance inflation factor > 10). Four models based on random forest, gradient boosting machine (GBM), generalized linear model, and Deep Learning Model were trained for HMRD diagnosis and employed for internal validation. An external test of the models was done. Three random data sets were further processed to validate the performance of the diagnostic model. The primary outcomes were the area under the receiver operating characteristic curve (AUC) and the area under the precision-recall curve (AUCPR) to diagnose HMRD. RESULTS: Nine variables were selected by all models. Given the AUC and AUCPR values across the different sets, the GBM model was chosen as the final diagnostic model. The GBM model had an AUC of 0.8550 (95%CI = 0.8322-0.8967) and an AUCPR of 0.5584 (95%CI = 0.5250-0.5879) in the training set. The AUC and AUCPR in the internal validation were 0.8405 (95%CI = 0.8060-0.8966) and 0.5355 (95%CI = 0.4988-0.5732). During the external test evaluation, it reached an AUC of 0.7579 (95%CI = 0.7340-0.7840) and an AUCPR of 0.5587 (95%CI = 0.5345-0.5880). A similar discriminative capacity was observed in the three random data sets. The GBM model was well-calibrated across all the sets. The GBM-RD model was implemented into a web application that provides risk prediction for HM individuals. CONCLUSION: GBM algorithms based on nine features successfully predicted the diagnosis of RD in patients with HM, which will help ophthalmologists to establish a preliminary diagnosis and to improve diagnostic accuracy in the clinic.
Assuntos
Diagnóstico Precoce , Aprendizado de Máquina , Miopia , Curva ROC , Descolamento Retiniano , Humanos , Miopia/diagnóstico , Miopia/complicações , Descolamento Retiniano/diagnóstico , Masculino , Feminino , Pessoa de Meia-Idade , Reprodutibilidade dos Testes , Adulto , Área Sob a CurvaRESUMO
In this study, a six-month pot experiment was conducted to explore the effects of nanoparticles (NPs), including CeO2, TiO2 and SiO2 NPs at 200 and 800â¯mg/kg, on the growth and quality of model medicinal plant Salvia miltiorrhiza. A control group was implemented without the application of NPs. Results showed that NPs had no significant effect on root biomass. Treatment with 200â¯mg/kg of SiO2 NPs significantly increased the total tanshinone content by 44.07â¯%, while 200â¯mg/kg of CeO2 NPs were conducive to a 22.34â¯% increase in salvianolic acid B content. Exposure to CeO2 NPs induced a substantial rise in the MDA content in leaves (176.25â¯% and 329.15â¯% under low and high concentration exposure, respectively), resulting in pronounced oxidative stress. However, TiO2 and SiO2 NPs did not evoke a robust response from the antioxidant system. Besides, high doses of CeO2 NP-amended soil led to reduced nitrogen, phosphorus and potassium contents. Furthermore, the NP amendment disturbed the carbon and nitrogen metabolism in the plant rhizosphere and reshaped the rhizosphere microbial community structure. The application of CeO2 and TiO2 NPs promoted the accumulation of metabolites with antioxidant functions, such as D-altrose, trehalose, arachidonic acid and ergosterol. NPs displayed a notable suppressive effect on pathogenic fungi (Fusarium and Gibberella) in the rhizosphere, while enriching beneficial taxa with disease resistance, heavy metal antagonism and plant growth promotion ability (Lysobacter, Streptomycetaceae, Bacillaceae and Hannaella). Correlation analysis indicated the involvement of rhizosphere microorganisms in plant adaptation to NP amendments. NPs regulate plant growth and quality by altering soil properties, rhizosphere microbial community structure, and influencing plant and rhizosphere microbe metabolism. These findings were beneficial to deepening the understanding of the mechanism by which NPs affect medicinal plants.
Assuntos
Cério , Nanopartículas , Plantas Medicinais , Salvia miltiorrhiza , Dióxido de Silício , Solo , Titânio , Titânio/toxicidade , Salvia miltiorrhiza/efeitos dos fármacos , Salvia miltiorrhiza/crescimento & desenvolvimento , Plantas Medicinais/efeitos dos fármacos , Plantas Medicinais/crescimento & desenvolvimento , Nanopartículas/toxicidade , Solo/química , Cério/toxicidade , Rizosfera , Poluentes do Solo/toxicidade , Estresse Oxidativo/efeitos dos fármacos , Raízes de Plantas/efeitos dos fármacos , Raízes de Plantas/crescimento & desenvolvimento , Microbiologia do Solo , Antioxidantes/metabolismo , Benzofuranos , Abietanos , DepsídeosRESUMO
Deteriorated soil pollution has grown into a worldwide environmental concern over the years. Organochlorine pesticide (OCP) residues, featured with ubiquity, persistence and refractoriness, are one of the main pollution sources, causing soil degradation, fertility decline and nutritional imbalance, and severely impacting soil ecology. Furthermore, residual OCPs in soil may enter the human body along with food chain accumulation and pose a serious health threat. To date, many remediation technologies including physicochemical and biological ways for organochlorine pollution have been developed at home and abroad, but none of them is a panacea suitable for all occasions. Rational selection and scientific decision-making are grounded in in-depth knowledge of various restoration techniques. However, soil pollution treatment often encounters the interference of multiple factors (climate, soil properties, cost, restoration efficiency, etc.) in complex environments, and there is still a lack of systematic summary and comparative analysis of different soil OCP removal methods. Thus, to better guide the remediation of contaminated soil, this review summarized the most commonly used strategies for OCP removal, evaluated their merits and limitations and discussed the application scenarios of different methods. It will facilitate the development of efficient, inexpensive and environmentally friendly soil remediation strategies for sustainable agricultural and ecological development.
Assuntos
Recuperação e Remediação Ambiental , Hidrocarbonetos Clorados , Resíduos de Praguicidas , Praguicidas , Poluentes do Solo , Humanos , Solo/química , Poluentes do Solo/análise , Praguicidas/análise , Resíduos de Praguicidas/análise , Poluição Ambiental/prevenção & controle , Poluição Ambiental/análise , Hidrocarbonetos Clorados/análiseRESUMO
DNA barcoding is widely used in toxic species authentication, but due to serious DNA degradation of forensic materials, the application of full-length barcode sequences in food poisoning diagnosis is greatly limited. Nucleotide signature, a shorter specific molecular marker, derived from traditional DNA barcoding has been proposed as an emerging tool of toxic species detection in deeply processed materials. In this study, to resolve the frequent food poisoning accidents with unknown origin, we envisioned developing a nucleotide signature data set of common poisonous organisms and combining high-throughput sequencing (HTS) to reveal the poisoning cause. Ninety-three individuals and 1093 DNA barcode sequences of twelve common poisonous plants, fish, mushrooms and their related species were collected. Through sequence alignment and screening, the nucleotide signatures were respectively developed and validated as their specific molecular markers. The sequence length varied from 19 bp to 38 bp. These fragments were conserved within the same species or genera, and the specificity between related species has been also demonstrated. To further evaluate the application potential of nucleotide signature in forensic diagnosis, simulated forensic specimens (SFS) containing different poisonous ingredients were sequenced by HTS with PCR-free libraries. As a result, the nucleotide signature was successfully captured from original HTS data without assembly and annotation, accompanied by a high detection sensitivity of 0.1 ng/µl in mixture system. Therefore, this method was suitable for the assay of forensic materials with serious DNA degradation. The present study undoubtedly provides a new perspective and strong support for the detection of toxic ingredients and the diagnosis of food poisoning.
Assuntos
Doenças Transmitidas por Alimentos , Venenos , Animais , Código de Barras de DNA Taxonômico/métodos , DNA/genética , Biomarcadores , Nucleotídeos/genéticaRESUMO
Lonicerae Japonicae Flos (LJF) has been globally applied as an herbal medicine and tea. A number of reports recently revealed fungal and mycotoxin contamination in medicinal herbs. It is essential to analyze the fungal community in LJF to provide an early warning for supervision. In this study, the fungal community in LJF samples was identified through DNA metabarcoding. A total of 18 LJF samples were collected and divided based on the collection areas and processing methods. The results indicated that Ascomycota was the dominant phylum. At the genus level, Rhizopus was the most abundant, followed by Erysiphe and Fusarium. Ten pathogenic fungi were detected among the 41 identified species. Moreover, Rhizopus, Fusarium, and Aspergillus had lower relative abundances in LJF samples under oven drying than under other processing methods. This work is expected to provide comprehensive knowledge of the fungal community in LJF and a theoretical reference for enhanced processing methods in practical manufacturing.
Assuntos
Medicamentos de Ervas Chinesas , Lonicera , Micobioma , Plantas Medicinais , Código de Barras de DNA Taxonômico , Cromatografia Líquida de Alta Pressão , Extratos Vegetais , Lonicera/genéticaRESUMO
Aconitum genus generally contains hypertoxic alkaloids. Poisoning incidents due to the improper ingestion of Aconitum materials frequently occur around the world. DNA barcoding is considered as a powerful tool for species identification, but complete sequences of conventional DNA barcodes are sometimes unattainable from food and highly processed products due to severe DNA degradation. Therefore, a shorter molecular marker will be more profitable for the authentication and poisoning diagnosis of Aconitum materials. In this study, 1246 psbA-trnH sequences and chloroplast genomes representing 183 taxa of Aconitum were collected, and a 23-bp nucleotide signature unique to Aconitum genus (5'-TATATGAGTCATTGAAGTTGCAG-3') was developed. The nucleotide signature was conserved and universal within Aconitum while divergent among other genera. The specific molecular signature was then successfully applied to the detection of processed Aconitum ingredients. To further evaluate the application potential of nucleotide signature in completely unknown mixture samples, boiled food mixtures, containing different ratios of Aconitum materials, were sequenced by high-throughput sequencing technology. The results showed that the nucleotide signature sequence could be directly extracted from raw sequencing data, even at a low DNA concentration of 0.2 ng/µl. Consequently, the 23-bp genus-specific nucleotide signature represents a significant step forward in the use of DNA barcoding to identify processed samples and food mixtures with degraded DNA. This study undoubtedly provides a new perspective and strong support for the identification and detection of Aconitum-containing products, which can be further introduced to the diagnosis of food poisoning.
Assuntos
Aconitum , Alcaloides , Genoma de Cloroplastos , Aconitum/genética , Sequenciamento de Nucleotídeos em Larga Escala , NucleotídeosRESUMO
Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.
Assuntos
Alcaloides , Ephedra , Metanfetamina , Alcaloides/metabolismo , Ephedra/genética , Ephedra/metabolismo , Efedrina/metabolismo , Humanos , Nucleotídeos , Extratos VegetaisRESUMO
To investigate whether metal oxide nanoparticles exhibit toxicity or positive effects on medicinal plants, CuO, ZnO, and γ-Fe2O3 nanoparticles (NPs), at concentrations of 100 and 700 mg kg-1, were introduced into the cultivation of Salvia miltiorrhiza (Bge.). Metal elemental contents, chemical constituents, biomass and the structure of the rhizosphere microbial community was used to estimate this effect. The results indicated CuO NPs increased the Cu content and ZnO NPs increased the Zn content significantly as exposure increased, γ-Fe2O3 NPs had no significant effect on Fe content in S. miltiorrhiza roots, while 100 mg kg-1 ZnO and CuO NPs significantly decreased the Fe content in roots. Additionally, ZnO and γ-Fe2O3 NPs increased the underground biomass, and diameter of S. miltiorrhiza roots. However, these three metal oxide nanoparticles had no significant effect on total tanshinones, while the 700 mg kg-1 γ-Fe2O3 NPs treatment increased salvianolic acid B content by 36.46%. High-throughput sequencing indicated at 700 mg kg-1 ZnO NPs, the relative abundance of Humicola (Zn superoxide dismutase producer), was notably increased by 97.46%, and that of Arenimonas, Thiobacillus and Methylobacillus (taxa related to heavy metal tolerance) was significantly increased by 297.14%, 220.26% and 107.00%. The 700 mg kg-1 CuO NPs exposure caused a significant increase in the relative abundances of Sphingomonas (a copper-resistant and N2-fixing genus) and Flavisolibacter (stripe rust biocontrol bacteria) by 127.32% and 118.33%. To our best knowledge, this is the first study to examine the potential impact of NPs on the growth and rhizosphere microorganisms of S. miltiorrhiza.
Assuntos
Cobre/toxicidade , Nanopartículas Metálicas/toxicidade , Microbiota/efeitos dos fármacos , Salvia miltiorrhiza/microbiologia , Microbiologia do Solo , Óxido de Zinco/toxicidade , Abietanos , Biomassa , Metais Pesados , Nanopartículas , Óxidos , Raízes de Plantas , RizosferaRESUMO
PURPOSE: We aimed to evaluate whether the neutrophil-to-lymphocyte ratio (NLR), platelet-to-lymphocyte ratio (PLR), lymphocyte-to-monocyte ratio (LMR), and systemic immune inflammation index (SII) were associated with primary open-angle glaucoma (POAG). MATERIALS AND METHODS: This retrospective case-control study included 240 patients with POAG and 300 age- and sex-matched control subjects. Complete ophthalmological examination and blood count measurements were performed for all subjects. RESULTS: The values of NLR, PLR, and SII in the POAG group were significantly increased compared with the control group (p < 0.001; p = 0.012; p < 0.001). However, the LMR value was lower in the POAG patients than in the control group (p < 0.001). When we divided the subjects into different age and gender subgroups, the NLR and SII values in the POAG patients were always higher than those in the control group. In the comparison of laboratory parameters in POAG subjects stratified according to severity, we also found that NLR and SII increased with the severity. The receiver operating characteristic (ROC) analysis revealed that the areas under the ROC curve of NLR, PLR, LMR, and SII to predict patients with POAG were found to be 0.627, 0.569, 0.382, and 0.986, respectively. The best cutoff point of NLR was 1.998 with a sensitivity of 59.8% and a specificity of 63.0%, and the SII was 947.365 with a sensitivity of 95.4% and a specificity of 95.7%. Multivariable logistic regression analysis showed that NLR was positively associated with mean deviation; moreover, NLR and SII were independent indicators correlated with POAG (OR 1.502; 95% CI 1.227-1.839; p < 0.001; OR 1.02; 95% CI 1.009-1.021; p < 0.001). CONCLUSION: We speculated that elevated NLR and SII might serve as readily available inflammatory predictors in POAG patients.
Assuntos
Plaquetas/imunologia , Glaucoma de Ângulo Aberto/sangue , Inflamação/sangue , Linfócitos/imunologia , Monócitos/imunologia , Neutrófilos/imunologia , Adulto , Idoso , Contagem de Células Sanguíneas , Estudos de Casos e Controles , Feminino , Citometria de Fluxo , Humanos , Masculino , Pessoa de Meia-Idade , Curva ROC , Estudos RetrospectivosRESUMO
The uptake and accumulation of cadmium (Cd) in Salvia miltiorrhiza (Bge.) negatively affects the quality of its harvested roots, and seriously threatens human health. This study investigates the effect of a microbial inoculant (MI) and garbage enzyme (GE) on Cd uptake, the accumulation of bioactive compounds, and the community composition of microbes in the rhizosphere soil of S. miltiorrhiza under Cd stress. S. miltiorrhiza seedlings were transplanted to Cd-contaminated pots and irrigated with an MI, GE, a combination of an MI and GE (MIGE) or water (control). The results indicated that treatments with an MI, GE or MIGE can reduce Cd uptake in S. miltiorrhiza. The MIGE treatment had greater efficiency in reducing Cd uptake than the control (reduction by 37.90%), followed by the GE (25.31%) and MI (5.84%) treatments. Treatments with an MI, GE and MIGE had no significant impact on fresh and dry root biomass. Relative to the control, the MI treatment had the highest efficiency in increasing the accumulation of total tanshinones (an increase of 40.45%), followed by the GE treatment (40.08%), with the MIGE treatment (9.90%) treatment not having a more favorable effect than the separate application of an MI or GE. The salvianolic acid content for all groups was higher than the standard prescribed by Chinese pharmacopoeia, notwithstanding a slightly lower level in the treated groups relative to the control. In addition, metagenomic analysis indicated changes in the relative abundance of soil microbes associated with the bioremediation of heavy metals. The relative abundances of Brevundimonas, Microbacterium, Cupriavidus and Aspergillus were significantly greater in the treated groups than in the Control. These results suggest that using MI and GE, either separately or together, may not only improve the quality of S. miltiorrhiza but may also facilitate the microbial remediation of soil contaminated with Cd.
Assuntos
Cádmio/toxicidade , Salvia miltiorrhiza/efeitos dos fármacos , Salvia miltiorrhiza/metabolismo , Poluentes do Solo/toxicidade , Abietanos/metabolismo , Alcenos/análise , Biodegradação Ambiental , Biomassa , Cádmio/farmacocinética , Raízes de Plantas/efeitos dos fármacos , Polifenóis/análise , Rizosfera , Salvia miltiorrhiza/química , Microbiologia do SoloRESUMO
In this study, the hydrogen-bonding interactions of three widely used diisocyanate-based hard-segment (HS) models in polyurethane, 2,4-toluenediisocyanate-methanol (2,4-TDI-MeOH), 2,6-toluenediisocyanate-methanol (2,6-TDI-MeOH), and 1,6-hexamethylenediisocyanate-methanol (HDI-MeOH), were investigated theoretically by density functional theory (DFT). The B3LYP/6-31G* method was used to calculate the equilibrium structures, Mulliken charges, hydrogen-bonding energies, and infrared (IR) spectra, in good agreement with previous experimental data. The HS models with benzene ring have much longer hydrogen bonds (HB), due to steric hindrance of benzene ring, whereas the aliphatic model forms much shorter hydrogen bonds. Different positions of the methyl group on the benzene ring for 2,4-TDI-MeOH and 2,6-TDI-MeOH result in different types of hydrogen bonds with various strengths. The style of hydrogen bonding for HDI-MeOH is more flexible due to simple aliphatic chemical structure without the benzene ring. The charge transfer on atoms N, H, and O involved in hydrogen bonding occurs with the forming of a hydrogen bond. The hydrogen bonding of 2,4-TDI-MeOH is much stronger than the others, and 2,6-TDI-MeOH froms the weakest hydrogen bonds. This study can supply guidance for the selection of a hard segment in the design of polyurethane and in-depth understanding of the hydrogen-bonding mechanism in the hard segments of polyurethane.
RESUMO
RNA-Sequencing (RNA-Seq) is a newly-developed method in transcriptome research, it can afford more accurate transcription information and be more quickly by using Next-generation Sequencing (NGS) technology. RNA-Seq has been widely used in various biological fields. Genuine traditional Chinese medicines (TCM), with good quality and therapeutic effect, were always praised highly and used by famous physicians. The geo-herbalism formation of TCM is based on the product of the gene expression at specific space and time. So it has been a research hotspot to analyze the mechanism of biosynthesis through RNA-Seq in the study on the secondary metabolism of medicinal plant. This article mainly illustrates the RNA-Seq and its advantages, it also discusses the potential application in genuine TCM, and it can provide useful information for other researchers.
Assuntos
Medicina Tradicional Chinesa , Plantas Medicinais/genética , Análise de Sequência de RNA , Medicamentos de Ervas Chinesas , Perfilação da Expressão Gênica , Sequenciamento de Nucleotídeos em Larga Escala , RNA , TranscriptomaRESUMO
Genuine medicinal materials with special characteristics of Traditional Chinese Medicine (TCM), is recognized as high quality medicine. Both ancient records and modern research considered that the origin is an important reason for the formation of genuine medicinal materials. However, blindly transplanting of genuine medicinal materials has led to the quality decline and counterfeit medicines appeared in production or sale progress, which may increase the risk of accidents in TCM. Frequent accidents emerged in Chinese herbal affects its export. What's more, it is a great threat to the medication safety in TCM clinical. There is an urgent need to implement traceability systems of TCM, which could provide convenient information record and traceability of TCM circulation. This paper reviews a variety of technical methods for genuine medicinal materials traceability, and proposed the establishment of genuine medicinal materials traceability system based on two-dimensional code and network database.
Assuntos
Bases de Dados Factuais , Medicamentos de Ervas Chinesas/química , Medicamentos de Ervas Chinesas/economia , Medicamentos de Ervas Chinesas/normas , Medicina Tradicional ChinesaRESUMO
Based on multi-scale characteristics inherent in the cracking process of cementitious composites, fibers with different geometric dimensions are simultaneously used to restrain the formation and development of cracks at different scales. Accordingly, hybrid fiber-reinforced cementitious composites (HyFRCCs) exhibit excellent bond behavior and deformation capacity in terms of tension and compression, accompanied by higher damage tolerance. Using these benefits of the mechanical properties of HyFRCCs, the structural performance of HyFRCC structures under complex loading conditions can be improved. To objectively evaluate the contributions of all fibers to the mechanical properties of HyFRCCs, steel macro-fibers, and polyvinyl alcohol (PVA) micro-fibers were used to design several reinforced cementitious composites. Four of the specimens were mono-fibrous cementitious composites, three specimens were cementitious composites reinforced with hybrid fibers, and one was a non-fibrous cementitious composite. The synergy effect of the steel and PVA fibers was analyzed using various fiber combinations. The results indicated a significant enhancement of the bonding properties of HyFRCCs through the incorporation of PVA and steel fibers. Specifically, the peak bond strength, peak slip displacement, and residual bond strength exhibited increments ranging from 31.0% to 41.7%, 60.6% to 118.4%, and 34.6% to 391.3%, respectively, in comparison to the reference test block. Notably, the combined presence of the PVA and steel fibers consistently demonstrated a positive confounding effect on the residual bond strength. However, negative confounding effects were observed in terms of the peak bond strength and peak slip displacement, particularly with 1.0% steel fiber content and 0.5% PVA fiber content.
RESUMO
This study investigates the potential of the plate-shaped Zn-22 wt.% Al (Zn-22Al) alloy as an innovative energy dissipation material for seismic damping devices, since plate-shaped material is more suitable to fabricate large-scale devices for building structures. The research begins with the synthesis of Zn-22Al alloy, given its unavailability in the commercial market. Monotonic tensile tests and low-cycle fatigue tests are performed to analyze material properties and fatigue performance of plate-shaped specimens. Monotonic tensile curves and cyclic stress-strain curves, along with SEM micrographs for microstructure and fracture surface analysis, are acquired. The combined cyclic hardening material model is calibrated to facilitate finite element analysis. Experimental results reveal exceptional ductility in Zn-22Al alloy, achieving a fracture strain of 200.37% (1.11 fracture strain). Fatigue life ranges from 1126 to 189 cycles with increasing strain amplitude (±0.8% to ±2.5%), surpassing mild steel by at least 6 times. The cyclic strain-life relationships align well with the Basquin-Coffin-Manson relationship. The combined kinematic/isotropic hardening model in ABAQUS accurately predicts the hysteretic behavior of the material, showcasing the promising potential of Zn-22Al alloy for seismic damping applications.
RESUMO
Objective: Angelicae Sinensis Radix (ASR, Danggui in Chinese), Cistanches Herba (CH, Roucongrong in Chinese), Ginseng Radix et Rhizoma (PG, Renshen in Chinese), and Panacis Quinquefolii Radix (PQ, Xiyangshen in Chinese), widely used as medicine and dietary supplement around the world, are susceptible to fungal and mycotoxin contamination. In this study, we aim to analyze their fungal community by DNA metabarcoding. Methods: A total of 12 root samples were collected from three main production areas in China. The samples were divided into four groups based on herb species, including ASR, CH, PG, and PQ groups. The fungal community on the surface of four root groups was investigated through DNA metabarcoding via targeting the internal transcribed spacer 2 region (ITS2). Results: All the 12 samples were detected with fungal contamination. Rhizopus (13.04%-74.03%), Aspergillus (1.76%-23.92%), and Fusarium (0.26%-15.27%) were the predominant genera. Ten important fungi were identified at the species level, including two potential toxigenic fungi (Penicillium citrinum and P. oxalicum) and eight human pathogenic fungi (Alternaria infectoria, Candida sake, Hyphopichia burtonii, Malassezia globosa, M. restricta, Rhizopus arrhizus, Rhodotorula mucilaginosa, and Ochroconis tshawytschae). Fungal community in ASR and CH groups was significantly different from other groups, while fungal community in PG and PQ groups was relatively similar. Conclusion: DNA metabarcoding revealed the fungal community in four important root herbs. This study provided an important reference for preventing root herbs against fungal and mycotoxin contamination.
RESUMO
Salvia miltiorrhiza, a widely used medicinal herb renowned for its properties in promoting blood circulation, removing blood stasis and alleviating pain, is currently facing quality degradation due to excessive heavy metal levels, posing a threat to medication safety. In order to investigate the effects of microbial inoculant, microalgae and biochar on the growth of Salvia miltiorrhiza under copper (Cu) stress, as well as its Cu absorption, antioxidant activity, active component contents and rhizosphere microbial community, a pot experiment was conducted. Salvia miltiorrhiza plants were cultivated in the soil containing 400 mg/kg of Cu for six months and treated with microbial inoculant, microalgae and biochar, either individually or in combination. Almost all soil amendment treatments led to an increase in root biomass. Notably, co-application of microbial inoculant and microalgae had the optimal effect with a 63.07 % increase compared to the group treated solely with Cu. Moreover, when microbial inoculant was applied alone or in combination with microalgae, the Cu content in plant roots was reduced by 19.29 % and 25.37 %, respectively, whereas other treatments failed to show a decreasing trend. Intriguingly, Cu stress increased the active component contents in plant roots, and they could also be enhanced beyond non-stress levels when microbial inoculant and microalgae were applied together or in combination with biochar. Analyses of plant antioxidant activity, soil properties and rhizosphere microorganisms indicated that these amendments may alleviate Cu stress by enhancing peroxidase activity, facilitating plant nutrient absorption, and enriching beneficial microorganisms capable of promoting plant growth and mitigating heavy metal-induced damage. This study suggests that the combined application of microbial inoculant and microalgae can reduce Cu levels in Salvia miltiorrhiza while enhancing its quality under Cu stress.
Assuntos
Inoculantes Agrícolas , Microalgas , Salvia miltiorrhiza , Rizosfera , Antioxidantes/metabolismo , Salvia miltiorrhiza/metabolismo , Carvão Vegetal/metabolismo , Solo , Cobre/toxicidade , Cobre/metabolismoRESUMO
Gelsemium elegans (GE) is a widely distributed hypertoxic plant that has caused many food poisoning incidents. Its pollen can also be collected by bees to produce toxic honey, posing a great threat to the health and safety of consumers. However, for the complex matrices such as cooked food and honey, it is challenging to perform composition analysis. It is necessary to establish more effective strategies for investigating GE contamination. In this study, the real-time PCR (qPCR) analysis combined with DNA barcode matK was proposed for the identification and detection of GE. Fifteen honey samples along with twenty-eight individuals of GE and the common confusable objects Lonicera japonica, Ficus hirta, Stellera chamaejasme and Chelidonium majus were gathered. Additionally, the food mixtures treated with 20-min boiling and 30-min digestion were prepared. Specific primers were designed, and the detection capability and sensitivity of qPCR in honey and boiled and digested food matrices were tested. The results demonstrated that the matK sequence with sufficient mutation sites was an effective molecular marker for species differentiation. GE and the confusable species could be clearly classified by the fluorescence signal of qPCR assay with a high sensitivity of 0.001 ng/µl. In addition, this method was successfully employed for the detection of deeply processed food materials and honey containing GE plants which even accounted for only 0.1 %. The sequencing-free qPCR approach undoubtedly can serve as a robust support for the quality supervision of honey industry and the prevention and diagnosis of food poisoning.
Assuntos
Doenças Transmitidas por Alimentos , Gelsemium , Mel , Abelhas , Animais , Mel/análise , Reação em Cadeia da Polimerase em Tempo Real , Alimento Processado , PlantasRESUMO
Copper ions in wastewater pose a significant threat to human and ecological safety. Therefore, preparing macroscopic adsorbents with reusable and high adsorption performance is paramount. This paper used graphene oxide as the adsorbent and chitosan as the thickener. Additionally, a silane coupling agent was employed to enhance the acid resistance of chitosan, and amino-modification of graphene oxide was performed. Macroscopic adsorbents with high adsorption capacity were fabricated using 3D printing technology. The results show that all five proportions of inks exhibit good printability. Dissolution experiments revealed that all materials maintained structural integrity after 180 days across pH values. Fourier Transform Infrared Spectroscopy (FTIR) and X-ray Photoelectron Spectroscopy (XPS) confirmed the successful preparation of the materials. Adsorption experiments showed that the best performing material ratio was 8 wt% graphene oxide and 7 wt% chitosan. Adsorption kinetics and isothermal adsorption experiments demonstrated that the adsorption process occurred via monolayer chemisorption. The adsorption process was attributed to strong electrostatic forces, van der Waals forces, and nitrogen/oxygen-containing functional group coordination. Cycling experiments showed that the material retained good adsorption performance after 6 cycles, suggesting its potential for practical heavy metal treatment applications.
Assuntos
Quitosana , Cobre , Grafite , Quitosana/química , Grafite/química , Cobre/química , Adsorção , Cinética , Concentração de Íons de Hidrogênio , Poluentes Químicos da Água/química , Poluentes Químicos da Água/isolamento & purificação , Purificação da Água/métodos , Águas Residuárias/química , Reagentes de Ligações Cruzadas/química , Espectroscopia de Infravermelho com Transformada de Fourier , Espectroscopia FotoeletrônicaRESUMO
To identify Salvia shandongensis and its relatives at molecular level, the psbA-trnH intergenic region of three species including Salvia shandongensis, Salvia miltiorrhiza and S. miltiorrhiza f. alba were amplified and sequenced. Sequences were assembled with CodonCode Aligner. The K2P genetic distances between Salvia shandongensis and its relatives were calculated and UPGMA tree was performed by MEGA5.0. The results indicated that the lengths of psbA-trnH regions of Salvia shandongensis were about 391 bp, while the lengths of psbA-trnH regions of Salvia miltiorrhiza and S. miltiorrhiza f. alba were about 386 bp. The psbA-trnH sequences showed considerable variations between species and thus were revealed as a promising candidate for barcoding of Salvia shandongensis and its relatives. The intra-specific genetic distances of Salvia shandongensis were 0, while the intra-specific genetic distances of Salvia miltiorrhiza and S. miltiorrhiza f. alba were 0.002 and 0.001 respectively. Additionally, the genetic distance of Salvia shandongensis and Salvia miltiorrhiza ranged from 0.034 to 0.04, and the genetic distance of Salvia shandongensis and S. miltiorrhiza f. alba ranged from 0.005 to 0.008, the intra-specific genetic distances of Salvia shandongensis were much smaller than that of Salvia miltiorrhiza and S. miltiorrhiza f. alba; clustering results showed that there were obvious differences between Salvia shandongensis, Salvia miltiorrhiza and S. miltiorrhiza f. alba, which was consistent with morphological characteristics. This study not only firstly provides the scientific basis for establishing the taxonomy position in molecular level and revealing their genetic relationships of S. shandongensis, S. miltiorrhiza and S. miltiorrhiza f. alba; but also provides DNA molecular identification scientific basis for the development of new medicinal plant resources of Salvia shandongensis. Our results suggest that the psbA-trnH intergenic spacer region can be used as a barcoding to identify Salvia shandongensis, Salvia miltiorrhiza and S. miltiorrhiza f. alba.