Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer.

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.

Effect of E. coli MutL on the steady-state ATPase activity of MutS in the presence of short blocked end DNAs.

The effect of wild-type and mutant MutL on the steady-state ATPase activity of MutS from Escherichia coli has been investigated in the absence and presence of 22, 50, and 75 base pair hetero- and homoduplex DNAs with open and blocked ends. The steady-state ATPase activity of MutS has been measured at 37 degrees C using a spectrophotometric method. The presence of MutL did not affect appreciably on the ATPase activity of MutS in the absence of DNA or in the presence of blocked end homoduplex DNAs. However, the addition of MutL affected oppositely on the ATPase activity of MutS in the presence of G-T mismatched DNAs depending on their end status. We have also found that only the ATPase active forms of MutL increased the ATPase activity of MutS in the presence of G-T mismatched DNAs with blocked ends. The results suggest that MutL ATPase activity is required to catalyze dissociation of the MutS sliding clamps.

Steady-state ATPase activity of E. coli MutS modulated by its dissociation from heteroduplex DNA.

The ability of MutS to recognize mismatched DNA is required to initiate a mismatch repair (MMR) system. ATP binding and hydrolysis are essential in this process, but their role in MMR is still not fully understood. In this study, steady-state ATPase activities of MutS from Escherichia coli were investigated using the spectrophotometric method with a double end-blocked heteroduplex containing gapped bases. The ATPase activities of MutS increased as the number of gapped bases increased in a double end-blocked heteroduplex with 2-8 gapped bases in the chain, indicating that MutS dissociates from DNA when it reaches a scission during movement along the DNA. Since movement of MutS along the chain does not require extensive ATP hydrolysis and the ATPase activity is only enhanced when MutS dissociates from a heteroduplex, these results support the sliding clamp model in which ATP binding by MutS induces the formation of a hydrolysis-independent sliding clamp.

Fluorescence sensing of ammonium and organoammonium ions with tripodal oxazoline receptors.

A new class of fluorescence sensors for ammonium and organoammonium ions has been disclosed. One of the sensors, an alaninol-derived tripodal oxazoline (1a) shows significant fluorescence enhancement upon binding NH(4)(+) but little response toward K(+), Na(+), and Mg(2+) ions. Owing to its chiral environment, a phenylglycinol-derived tripodal oxazoline (1b) shows chiral discrimination in fluorescence upon binding enantiomeric guests. [reaction: see text]

Simultaneous electrochemical detection of both PSMA (+) and PSMA (-) prostate cancer cells using an RNA/peptide dual-aptamer probe.

Using an RNA/peptide dual-aptamer probe, both PSMA (+) and PSMA (-) prostate cancer cells were simultaneously detected by electrochemical impedance spectroscopy. This approach can be applied as a general tool for early diagnosis of prostate cancer.

Functional properties of the thermostable mutL from Thermotoga maritima.

The methyl-directed mismatch repair (MMR) mechanism has been extensively studied in vitro and in vivo, but one of the difficulties in determining the biological relationships between the MMR-related proteins is the tendency of MutL to self-aggregate. The properties of a stable MutL homologue were investigated using a thermostable MutL (TmL) from Thermotoga maritima MSB8 and whose size exclusion chromatographic and crosslinking analyses were compatible with a dimeric form of TmL. TmL underwent conformational changes in the presence of nucleotides and single-stranded DNA (ssDNA) with ATP binding not requiring ssDNA binding activity of TmL, while ADPnP-stimulated TmL showed a high ssDNA binding affinity. Finally, TmL interacted with the T. maritima MutS (TmS), increasing the affinity of TmS to mismatched DNA base pairs and suggesting that the role of TmL in the formation of a mismatched DNA-TmS complex may be a pivotal observation for the study of the initial MMR system. [BMB reports 2009; 42(1): 53-58].

Structural insights of the nucleotide-dependent conformational changes of Thermotoga maritima MutL using small-angle X-ray scattering analysis.

MutL is required to assist the mismatch repair protein MutS during initiation of the methyl-directed mismatch repair (MMR) response in various organisms ranging from prokaryotes to eukaryotes. Despite this necessity, the inherent propensity of MutL to aggregate has led to significant difficulties in determining its biological relationship with other MMR-related proteins. Here, we perform analysis on the thermostable MutL protein found in Thermotoga maritima MSB8 (TmL). Size exclusion chromatographic analysis indicates the lack of aggregated forms with the exception of a dimeric TmL. Small-angle X-ray scattering (SAXS) analysis reveals that the solution structures of the full-length TmL and its corresponding complexes with nucleotides and ssDNA undergo conformational changes. The elucidated TmL SAXS model is superimposed to the crystal structure of the C-terminal domain of Escherichia coli MutL. In addition, the N-terminal SAXS model of TmL exists as monomeric form, indicating that TmL has a structurally flexible N-terminal domain. TmL SAXS analysis can suggest a considerable possibility on a new 3D view of the previously unresolved full-length MutL molecule.

Resonance spectrum of a three-dimensional photonic quantum ring laser with an equilateral triangle microcavity.

We have fabricated three-dimensional (3D) photonic quantum ring lasers with an equilateral triangle microcavity. Their spectra were well explained by combining the off-normal resonance and hexagonally bounced in-plane whispering-gallery-mode condition. The angular distribution of the emission modes and their discrete wavelengths were shown to be in excellent agreement with a 3D Rayleigh Fabry-Perot model. We confirmed that the allowed modes in the equilateral triangle microcavity decrease by decreasing the length of equilateral triangle side, L, and the spectral mode spacing linearly increases with the mode index m and is inversely proportional to L2.

Synthesis and photophysical studies of bis-enediynes as tunable fluorophores.

We have synthesized a family of bis-enediynes by two complementary Pd/Cu-catalyzed Sonogashira cross-coupling methods. One is a modified Sonogashira reaction between the TMS-protected tetraalkyne 20 (or 21) and various aromatic bromides to afford bis-enediynes 22a-d and 23a-d bearing different peripheral aryl units. The other, the reaction of bifunctional 1,1-dibromo-1-alkenes with phenylacetylene, afforded a series of bis-enediynes 24-32 bearing various core aryl groups. These chemical modifications to the core and periphery of bis-enediynes induce dramatic changes in absorption and emission spectra. Bis-enediynes 22 and 23 show a large Stokes shift of about 50-110 nm when compared to the less-conjugated bis-enediynes 20 and 21. Absorptions and emissions of bis-enediynes 25, 27-29, and 31 were red-shifted relative to those of enediyne 35. Substantial increases in fluorescence quantum yields are observed as a result of extending the pi-conjugation. The emission wavelength of bis-enediynes was tailored from indigo blue to reddish-orange, suggesting that the color of emission can be tunable by modification of the core and/or peripheral units.

Anomalously high cooperativity of oligodeoxycytidylic acid for luminescence resonance energy transfer to lanthanide ions.

The luminescence of terbium(III) and europium(III) through luminescence resonance energy transfer from mononucleotides and oligodeoxynucleotides is examined. Among mononucleotides, dGMP gives the strongest luminescence of terbium(III), while dTMP and dCMP yield a luminescence intensity of europium(III) that is larger than the other two cases. In the homodeoxydecamers, decadeoxycytidylic acid (dC10) produces the highest intensity for both metals. The anomalously large cooperativity of dC10 is explained by the easiness of deformation of the helical structure to bind lanthanide ions, and a circular dichroism study supports this explanation.